Prosecution Insights
Last updated: April 19, 2026
Application No. 18/298,998

METHODS OF SCREENING FOR PLANT GAIN OF FUNCTION MUTATIONS AND COMPOSITIONS THEREFOR

Non-Final OA §103§112
Filed
Apr 11, 2023
Examiner
CHATTERJEE, JAYANTA
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Regents of the University of California
OA Round
1 (Non-Final)
82%
Grant Probability
Favorable
1-2
OA Rounds
2y 8m
To Grant
99%
With Interview

Examiner Intelligence

Grants 82% — above average
82%
Career Allow Rate
9 granted / 11 resolved
+21.8% vs TC avg
Strong +40% interview lift
Without
With
+40.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 8m
Avg Prosecution
48 currently pending
Career history
59
Total Applications
across all art units

Statute-Specific Performance

§101
4.7%
-35.3% vs TC avg
§103
35.9%
-4.1% vs TC avg
§102
18.7%
-21.3% vs TC avg
§112
33.6%
-6.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 11 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Please note examination of the instant application has been transferred to Examiner Jayanta Chatterjee in Art Unit 1662. Election/Restrictions Applicant's election with traverse of Group I in the reply filed on 11/13/2025 is acknowledged. The traversal is on the grounds- Group II (claim 18) depends from claim 1 of Group I and there would be no search burden (response, page 10, para 1, line 2-6). The Applicant amends claim 19 of Group III while making it dependent from claim 18. Similarly, amended claim 21 of Group IV now depends from claim 1. The Applicant argues that “the Examiner has not shown that Groups I-IV are independent or distinct, or that there would be a serious search and/or examination burden if restriction were not required” (response, page 10, para 3, line 1-3). The arguments were fully considered but are not found persuasive. The inventions in the instant application separated in different Groups are distinct from the other because they satisfy at least one criterion, as described in the previous Office action (dated 8/20/2025, page 3-5). The gain of function mutation of claim 18 can be made by other methods, such as site-directed mutatgeneis, random mutagenesis and screening, or screening for naturally-occurring mutants. Claim 1 does not require the steps conducted in the method of claim 18. As such, searches for the two inventions would not be co-extensive and would be a search and/or examination burden. Moreover, the groups also belong to different CPC classification. Group I would have been classified in CPC class C12Q1/6837, Group II would have been classified in CPC class C12N15/8269, Group III would have been classified in C12N15/01, Group IV would have been classified in CPC class Y02A40/146. The Applicant added new claims 26-28. The new claims would have been included in Group I invention, and, thus, are being examined. Based on the claim amendments and/or the arguments put forward in the response by the Applicant (dated 11/23/2025), all the species election requirements are withdrawn. The requirement is still deemed proper and is therefore made FINAL. Claim Status Claims 1-28 are pending. Claims 18-25 are being withdrawn from examination as being part of non-elected inventions. Claims 1-17 and 26-28 are being examined. Claim Rejections - 35 USC § 112(a) The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Scope of Enablement Claim 9 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for the claimed method wherein the guide RNAs have at least 95% sequence identity with a target gene in a plant species, does not reasonably provide enablement for all the genes targeted by the gRNA having as little as 50% sequence identity to the target site. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to design a gRNA having only 50% sequence identity to a target site in a target gene in a plant species, and to make and use the invention commensurate in scope with these claims. Claim 9 depends from claim 1 which recites a gain of function mutation in a target gene. It is known in the art that a 20-mer long gRNA (also known as crRNA) can tolerate less than 5% difference, with two mismatches to their target, to be effective in gene editing (Anderson et al., Systematic analysis of CRISPR–Cas9 mismatch tolerance reveals low levels of off-target activity, 2015, Journal of Biotechnology, 211:56–65; Abstract). Having only 50% sequence identity to a target site will have significantly high level of off-target editing and/or in many non-target genes from across the plant species. Many of the resulting mutations may not have any gain of function trait and/or not mutating the target gene. The Applicant does not provide any working example of a gRNA less than 95% or at least 50% but less than 100% sequence identity to a target site in a gene in a plant. Undue trial and error experimentations would be needed to obtain a gain-of-function trait by mutating just 50% of the target site(s) in a target gene while checking off-target mutations and gain- and/or loss-of-function traits arising due to off-target mutations. Based on breadth of the claims, lack of any working example, lack of guidance in the instant description or in prior art, the specification at the time of the application filed would not have taught one skilled in the art how to use the full scope of the claimed invention without performing undue experiments. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 4 and 7-9 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 4 recites, “… constitutive phenotype”. Instant description does not define “constitutive phenotype” and it is not clear what type of phenotype is implied by the term “constitutive phenotype”. It is also unclear what is meant by “associated” in the context of the claim. For example, “constitutive phenotype” may indicate a phenotype that is always present, but the claim does not indicate that the target gene is always overexpressed. Claim 7 recites, “… improves yield, quality, or both…”. It is unclear what is implied by “quality”. The Applicant does not define “quality”. It is also unclear what trait is being referred to. It is also a relative term. What one person in the art would consider to be an improved ‘quality’ of a trait, may not be considered an improvement in quality by another, absent a form of measurement. It is not clear if the applicant is referring to “quality” of the yield (gain and/or biomass) or some other trait resulting from the gain of function mutation. Claim 8 recites, “… wherein the one or more RNA-guided nucleic acid modifying enzymes targeting the target gene comprise two or more different guide RNAs…”. The endonuclease does not actually “comprise” the gRNA. It is suggested to amend by replacing the recitation, “wherein…guide RNAs” in lines 1-3 with “wherein two or more different guide RNAs are used in step (a)”. It is also not clear if the RNA-guided nucleic acid modifying enzyme(s) (endonuclease) itself contains (i.e., “comprises”) two or more different guide RNAs (i.e., a single endonuclease protein molecule binds to two or more gRNA molecules); or a single enzyme molecule binds to one gRNA at a time but has the ability to bind two or more different gRNAs. Additionally in claim 8: it is unclear whether the limitation, “the guide RNAs” in line 5, is referring to “two or more different guide RNAs” recited in lines 2-3, or if it is referring to “one or more different guide RNAs” as recited in line 5 of claim 1. This issue arises because of the “and/or” in line 5 of claim 8. Claim 8 presents two alternative limitations, because of the “or”: the first “wherein” clause of lines 1-3, and the second “wherein” clause of lines 5-9. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claims 1-8 and 9-16 are rejected under 35 U.S.C. 103 as being unpatentable over Hubbart et al. (Enhanced thylakoid photoprotection can increase yield and canopy radiation use efficiency in rice, 2018, Communications Biology, 1:22), in view of Jacobs et al. (Targeted genome modifications in soybean with CRISPR/Cas9, 2015, BMC Biotechnology, 15:16) and in evidence of Woo et al. (DNA-free genome editing in plants with preassembled CRIScrisPR-Cas9 ribonucleoproteins, 2015, Nature Biotech., 33, 1162–1164). Claim 1 is drawn to a method of screening for a gain of function mutation in a target gene in a plant comprising: (a) generating a set of mutations in a non-coding sequence (NCS) of the target gene in a population of plant cells with one or more RNA-guided nucleic acid modifying enzymes targeting the target gene comprising one or more different guide RNAs; (b) regenerating the population of plant cells into two or more plants that are hemizygous for the mutation generated; (c) selfing the two or more plants to generate offspring plants, and (d) screening the offspring plants from step (c) to identify a gain of function mutation. Hubbart et al. describes a method to generate gain-of-function mutation in a rice plant, which is an important crop plant (as recited in claim 13) by overexpressing a PsbS gene encoding a central regulator of non-photochemical quenching (NPQ) (as recited in claim 14) (Abstract, line 6-8). It teaches that in comparison to wild-type plants, psbS overexpressing rice plants have increased canopy radiation use efficiency (which reads on increased photosynthetic efficiency and photoprotection efficiency, as recited in claim 5) and grain yield under fluctuating light condition (as recited in claims 7 and 15) (abstract, line 10-11). Chlorophyll fluorescence measurements in rice canopies provide evidence that NPQ resulted in reduced quantum efficiency at leaf level (page 2, left column, last para, last 3 lines). Photosynthetic efficiency was measured by monitoring chlorophyll fluorescence (page 3, right column, para 1, line 8; page 4, left column, para 1, line 3; Fig. 5-6; Table 1; page 7, right column, para 1, line 2-3). The overexpressing lines with the gain of function mutation (as recited in claims 3-4) are produced using a strong constitutive promoter (Cestrum yellow leaf curling virus, CmYLCV, promoter), which is a non-coding sequence, fused to the genomic sequence encoding the PsbS polypeptide (Os01g64960) and via agrobacterium mediated transformation1. Several primary transformants (T0) are obtained1 which subsequently gave rise to homozygous T2 plants (page 9, right column, para 2, line 1-3). These T2 plants expressing higher PbsS protein are subsequently screened to identify the gain-of-function mutation comprising increased NPQ (page 2, right column, last para, line 1), higher biomass and leaf area (page 3, left column, para 3, line 1), and higher grain yield (page 3, left column, para 4, line 1). It is well known in the art that primary transformants (T0 or T1, depending on the method) produced by agrobacterium mediated transformation are often hemizygous (as recited in claim 1), i.e., contain one copy of the transgene without having an allele in that specific genomic location in the other chromosome. Subsequently, the hemizygous plants are selfed to develop homozygous plants (as recited in claims 1 and 5) in subsequent generations including T2, as described by Hubbart et al. (page 9, right column, para 2, line 1-3). Thus, the method described herein by Hubbart et al. does not involve use of a plant with hypomorphic allele or null allele (of the psbS gene encoding the psbS protein), as recited in claim 6; wherein at least 50% (100%) of the set of mutations are in a region of the target gene selected from a promoter region, as recited in claim 10. The genomic sequence (GenBank Accession No. AP003235 BA000010) comprising the promoter sequence and encoding the psbS protein (Os01g64960), as described by Hubbart et al., maintain 100% sequence identity to instant SEQ ID NO: 94 (as recited in claim 16), as shown below. Oryza sativa Japonica Group genomic DNA, chromosome 1, PAC clone: P0039A07 Sequence ID: AP003235.2 Length: 148892 Range 1: 14538 to 21312 GenBank Graphics Alignment statistics for match #1 Score Expect Identities Gaps Strand 12512 bits (6775) 0.0 6775/6775(100%) 0/6775(0%) Plus/Plus Query 1 CAGCAGACAGAGGTATGTCAATGTGTTATTGGCCTCTACGTTCGGTAGAAACTAGTAATG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 14538 CAGCAGACAGAGGTATGTCAATGTGTTATTGGCCTCTACGTTCGGTAGAAACTAGTAATG 14597 Query 61 ATGTACTATATTATGTGTTCTGAACTCATTATAAGATCTCTACCAGCAAATGATTCTTTG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 14598 ATGTACTATATTATGTGTTCTGAACTCATTATAAGATCTCTACCAGCAAATGATTCTTTG 14657 Query 121 CTATTGTGCTACTATTTGTATATTGCGTTTCATTTATCATCATATGCAGACAACCTGGAT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 14658 CTATTGTGCTACTATTTGTATATTGCGTTTCATTTATCATCATATGCAGACAACCTGGAT 14717 Query 181 ACAACATCGTTGCTCATATTACAGGTAGAAAACGAACAAAATTAAATGGCATTGTGTGCC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 14718 ACAACATCGTTGCTCATATTACAGGTAGAAAACGAACAAAATTAAATGGCATTGTGTGCC 14777 Query 241 ATCCCGTTTTGTTTTAAAGCTTCGCCTAAATCCTAATGTATTTTAGTGTCTCGCTGTGAT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 14778 ATCCCGTTTTGTTTTAAAGCTTCGCCTAAATCCTAATGTATTTTAGTGTCTCGCTGTGAT 14837 Query 301 TGAATTGTTTCCACTAACTGTTGCATCATTTGCACTCTTGTAGTACTTCATGTACACTCT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 14838 TGAATTGTTTCCACTAACTGTTGCATCATTTGCACTCTTGTAGTACTTCATGTACACTCT 14897 Query 361 TCTCTTTAAAACGAGACTGAAATATACACTGATGTATCATATCCTTTTCTCCTGAATCTT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 14898 TCTCTTTAAAACGAGACTGAAATATACACTGATGTATCATATCCTTTTCTCCTGAATCTT 14957 Query 421 GTTGACTCAAAGTAGCTCATTCTATCACGAGTACTTATCTTCAGCAAGAACATCTTTTCA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 14958 GTTGACTCAAAGTAGCTCATTCTATCACGAGTACTTATCTTCAGCAAGAACATCTTTTCA 15017 Query 481 TTTTTCTTGTTCCTGGATGTAATTTGGAGCTAAATTGTTTTGAGTACTACTAATATTTAC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 15018 TTTTTCTTGTTCCTGGATGTAATTTGGAGCTAAATTGTTTTGAGTACTACTAATATTTAC 15077 Query 541 CAGGAACCATTTTTGTTACTCCTGAATCTGGTGGCTTGGGGGTAAATTGCATACATTAGC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 15078 CAGGAACCATTTTTGTTACTCCTGAATCTGGTGGCTTGGGGGTAAATTGCATACATTAGC 15137 Query 601 AATaaaaaaaaGTAGGTCCCACCGGGATTCGAACCCAGGTCGCCAGATTCAAAGTCTGGA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 15138 AATAAAAAAAAGTAGGTCCCACCGGGATTCGAACCCAGGTCGCCAGATTCAAAGTCTGGA 15197 Query 661 GTGCTAACCACTACACCATGGAACCGGTTGTTGCATGTGGTCCGTCGATGGTGATACTTC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 15198 GTGCTAACCACTACACCATGGAACCGGTTGTTGCATGTGGTCCGTCGATGGTGATACTTC 15257 Query 721 TGTCTTTTACTGAAGATCAGTAACAAAGGGAAGTATACTAGTTGAAACCCACATGTTCAT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 15258 TGTCTTTTACTGAAGATCAGTAACAAAGGGAAGTATACTAGTTGAAACCCACATGTTCAT 15317 Query 781 TTGTGGGCATCCATCTGCTAGGCACTTCAATTAAACAAAAACACGGGAATATCCAACGAA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 15318 TTGTGGGCATCCATCTGCTAGGCACTTCAATTAAACAAAAACACGGGAATATCCAACGAA 15377 Query 841 TCCTCTTCTCCACATTCCCGTACTTTTTTGTGCTGAATCGAATTTCCTGACGCCATATaa 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 15378 TCCTCTTCTCCACATTCCCGTACTTTTTTGTGCTGAATCGAATTTCCTGACGCCATATAA 15437 Query 901 aaaaaCGAATTTCCTGACATATCTCAGGaaaaaaaaaaGGTAATACTCGAGAGTCGATAA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 15438 AAAAACGAATTTCCTGACATATCTCAGGAAAAAAAAAAGGTAATACTCGAGAGTCGATAA 15497 Query 961 CATCCTCCTAGACTCCTACGGCGTGGCACACAGTTCACTAAAATCCAGGCAACACAAGTA 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 15498 CATCCTCCTAGACTCCTACGGCGTGGCACACAGTTCACTAAAATCCAGGCAACACAAGTA 15557 Query 1021 CACAACACGCAGAGTCACACATATGCTTGGAGTTGGAGCACTTTTCCAGGAGTCCGGCTC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 15558 CACAACACGCAGAGTCACACATATGCTTGGAGTTGGAGCACTTTTCCAGGAGTCCGGCTC 15617 Query 1081 AGGTGCAGGGAACCCTGCACATAGTAATATACAGGCCAAATCAAATCGCGACACCTGTAC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 15618 AGGTGCAGGGAACCCTGCACATAGTAATATACAGGCCAAATCAAATCGCGACACCTGTAC 15677 Query 1141 ACAAGGTAGGTCCACCCAATCAACCAAGTAACAATGTAAACGGAGGTTTAACCACGATCC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 15678 ACAAGGTAGGTCCACCCAATCAACCAAGTAACAATGTAAACGGAGGTTTAACCACGATCC 15737 Query 1201 CACAAAATCAGGTAACAGAACCATTCACCCGCGAAATACTTTGACGTCGCGCGCGACGCC 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 15738 CACAAAATCAGGTAACAGAACCATTCACCCGCGAAATACTTTGACGTCGCGCGCGACGCC 15797 Query 1261 GCACAGAGTTTCTTTCCTCTTTCTCTGTTCTTCTGTACTGCTAGATCTCTAAAATTAGAT 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 15798 GCACAGAGTTTCTTTCCTCTTTCTCTGTTCTTCTGTACTGCTAGATCTCTAAAATTAGAT 15857 Query 1321 TGGTGATTCTTGATAGAGATCAGTGTCCTCGTGAAGCAAGACGCATGGCGGAAGCCCCAG 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 15858 TGGTGATTCTTGATAGAGATCAGTGTCCTCGTGAAGCAAGACGCATGGCGGAAGCCCCAG 15917 Query 1381 TCCACCCTTCATCTTCAAAGAGTATGTTAATTGTCCATAAACTTGGCAAGACCCGATTAG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 15918 TCCACCCTTCATCTTCAAAGAGTATGTTAATTGTCCATAAACTTGGCAAGACCCGATTAG 15977 Query 1441 TTTGTCTCAATCTCTGCCATAAGTTATCTGCTAATTGTTATTAAATTAGATTGGTTTCAC 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 15978 TTTGTCTCAATCTCTGCCATAAGTTATCTGCTAATTGTTATTAAATTAGATTGGTTTCAC 16037 Query 1501 CTATATATGGTGAATAGGATTTTATATTGTTCCTTGCATGTTAAACTAGCATATACACAA 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16038 CTATATATGGTGAATAGGATTTTATATTGTTCCTTGCATGTTAAACTAGCATATACACAA 16097 Query 1561 TAATGATCACGTTATACTTATTCTTATATTTAGATCATGAAAAAGAAGACGTGGGAGACA 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16098 TAATGATCACGTTATACTTATTCTTATATTTAGATCATGAAAAAGAAGACGTGGGAGACA 16157 Query 1621 CGAATATAAGCAGTACTGATGATGCTTGTGTGCAAAAGTTAGAGCCAGTAATTGGCATGG 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16158 CGAATATAAGCAGTACTGATGATGCTTGTGTGCAAAAGTTAGAGCCAGTAATTGGCATGG 16217 Query 1681 AATTTGATGATGAAGATATAGCATATGAGTTCTACAATCGGTATGCTGGAGATGTTGGCT 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16218 AATTTGATGATGAAGATATAGCATATGAGTTCTACAATCGGTATGCTGGAGATGTTGGCT 16277 Query 1741 TTAGCATTAGAAAGTTTTGGCATGATAAATCTTCAACAAATGTGATTCGCACaaaaaaaT 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16278 TTAGCATTAGAAAGTTTTGGCATGATAAATCTTCAACAAATGTGATTCGCACAAAAAAAT 16337 Query 1801 TTGTGTGCTCAAGGGAGGGGTTCAATAAGAGGAATACTTCAGATGCATGCCAACGGAAGC 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16338 TTGTGTGCTCAAGGGAGGGGTTCAATAAGAGGAATACTTCAGATGCATGCCAACGGAAGC 16397 Query 1861 GAGCTGATACAAGAGTTGGTTGTATGGCAGAGATGACCATTAAGATCACTCCTACTGGAA 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16398 GAGCTGATACAAGAGTTGGTTGTATGGCAGAGATGACCATTAAGATCACTCCTACTGGAA 16457 Query 1921 AATATGCTATAGCTAGCTTTTCTAACACGCATAACCATGAACTCATAACTCCTAGCAAGG 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16458 AATATGCTATAGCTAGCTTTTCTAACACGCATAACCATGAACTCATAACTCCTAGCAAGG 16517 Query 1981 CCCATTTGTTACGTTCTCAGAGAAGAATGACAGAAGCTCAAAAAGCTCAAATTGACATCT 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16518 CCCATTTGTTACGTTCTCAGAGAAGAATGACAGAAGCTCAAAAAGCTCAAATTGACATCT 16577 Query 2041 TGAATGATTCAGGTGTTAGACCCAAAGAAGGCCATGAGGTGATGAGTAGGCAAGCAGGTG 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16578 TGAATGATTCAGGTGTTAGACCCAAAGAAGGCCATGAGGTGATGAGTAGGCAAGCAGGTG 16637 Query 2101 GGCGGCAAAGTCTTACATTTACCAGAAAAGATTATAAAAATTATCTCCGATCAAAGCGCA 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16638 GGCGGCAAAGTCTTACATTTACCAGAAAAGATTATAAAAATTATCTCCGATCAAAGCGCA 16697 Query 2161 TGAAATCTATCCAAGAAGGGGATACGGGTGCCATTCTTCAGTACCTACAGGACAAGCAAA 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16698 TGAAATCTATCCAAGAAGGGGATACGGGTGCCATTCTTCAGTACCTACAGGACAAGCAAA 16757 Query 2221 TGGAAAACCCTTCATTCTTCTATGCAATACAAGTAGATGAAGATGAGATGATGACTAATA 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16758 TGGAAAACCCTTCATTCTTCTATGCAATACAAGTAGATGAAGATGAGATGATGACTAATA 16817 Query 2281 TATTTTGGGCAGATGCAAGATCAGTATTGGATTTTGATTATTTGGGTGATGTCATATGCT 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16818 TATTTTGGGCAGATGCAAGATCAGTATTGGATTTTGATTATTTGGGTGATGTCATATGCT 16877 Query 2341 TTGACACAACATACAGGACAAATAATTATGGTAGGCCATTTGCTCTTTTTGTTGGTGTAA 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16878 TTGACACAACATACAGGACAAATAATTATGGTAGGCCATTTGCTCTTTTTGTTGGTGTAA 16937 Query 2401 ACCATCACAAGCAAACAGTTGTTTTTGGAGCAGCGTTACTGTATGATGAAACAACATCAA 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16938 ACCATCACAAGCAAACAGTTGTTTTTGGAGCAGCGTTACTGTATGATGAAACAACATCAA 16997 Query 2461 CATTTGAATGGTTATTTGAAACTTTCAAAAGAGCCATGTCAGGCAAAGAACCAAGGACAA 2520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16998 CATTTGAATGGTTATTTGAAACTTTCAAAAGAGCCATGTCAGGCAAAGAACCAAGGACAA 17057 Query 2521 TATTAACTGATCAATGTGCAGCCATCATTAATGCTATTGGGACTGTCTTTCCCAACTCAA 2580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 17058 TATTAACTGATCAATGTGCAGCCATCATTAATGCTATTGGGACTGTCTTTCCCAACTCAA 17117 Query 2581 CTCATCGTCTCTGCGTTTGGCATATGTACCAAAATGCTGCGGTACATTTGAGTCACATTT 2640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 17118 CTCATCGTCTCTGCGTTTGGCATATGTACCAAAATGCTGCGGTACATTTGAGTCACATTT 17177 Query 2641 TCCAAGGTTCAAAAACATTTAAGAATGATTTTGGCAAGTGTGTTTTTGATTTTGAAGAAG 2700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 17178 TCCAAGGTTCAAAAACATTTAAGAATGATTTTGGCAAGTGTGTTTTTGATTTTGAAGAAG 17237 Query 2701 TTGATTAGTTCATATCAGCATGGAACAAGATGATAGAGGAGTACAATTTGAATGATAACC 2760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 17238 TTGATTAGTTCATATCAGCATGGAACAAGATGATAGAGGAGTACAATTTGAATGATAACC 17297 Query 2761 AATGGTTACATCATTTATTTGAGATCAAGGAGAAGTGGGCTTTAGTTTATGGTCGGCAAA 2820 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 17298 AATGGTTACATCATTTATTTGAGATCAAGGAGAAGTGGGCTTTAGTTTATGGTCGGCAAA 17357 Query 2821 CATTCTGTGCAGATATGAAATCCACACAGAGAAGTGAGAGTCTCAATGCCCTGCTGAAAT 2880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 17358 CATTCTGTGCAGATATGAAATCCACACAGAGAAGTGAGAGTCTCAATGCCCTGCTGAAAT 17417 Query 2881 ATATGCAACATATGGATTGGTTCTTGAAATTTTCTTTTATTTATATAGAGCAAACACTCA 2940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 17418 ATATGCAACATATGGATTGGTTCTTGAAATTTTCTTTTATTTATATAGAGCAAACACTCA 17477 Query 2941 GGCACAAAATTGGGCtttttttACATCTCGATCTGCAGTTCAATGTCATTAATATTTCCA 3000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 17478 GGCACAAAATTGGGCTTTTTTTACATCTCGATCTGCAGTTCAATGTCATTAATATTTCCA 17537 Query 3001 TTTGCAATCTAAACAATATATCTATGCTTATGGTGTGTATACATTATAGTACAAGAAAAA 3060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 17538 TTTGCAATCTAAACAATATATCTATGCTTATGGTGTGTATACATTATAGTACAAGAAAAA 17597 Query 3061 ATTATTAAGCAGTTAGACATTAACCTGTGACAGGCTTGGTCGATCCAGAGCAAGCCCAAC 3120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 17598 ATTATTAAGCAGTTAGACATTAACCTGTGACAGGCTTGGTCGATCCAGAGCAAGCCCAAC 17657 Query 3121 CTAATCCATCAGGACTGCATGACCTCTCCCTGCTCTAAGTCTCCATGGCGACCACGGCTC 3180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 17658 CTAATCCATCAGGACTGCATGACCTCTCCCTGCTCTAAGTCTCCATGGCGACCACGGCTC 17717 Query 3181 CTTCCGCCGGCCACTCTCCCACGGTGAGCGATGCGACCTCCTCAGGACGCCCCACGGCAA 3240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 17718 CTTCCGCCGGCCACTCTCCCACGGTGAGCGATGCGACCTCCTCAGGACGCCCCACGGCAA 17777 Query 3241 GTGCGCAAGCCTGTAGTGGCACCCGGCAAGCACCGCCGCCCCACCCCGGCGGCCTGCCTC 3300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 17778 GTGCGCAAGCCTGTAGTGGCACCCGGCAAGCACCGCCGCCCCACCCCGGCGGCCTGCCTC 17837 Query 3301 GAGACCGTCGTCCTCTTCGATGGCCCATGGTGAGCACCACTTCCCAGCCAACGGCAGGTG 3360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 17838 GAGACCGTCGTCCTCTTCGATGGCCCATGGTGAGCACCACTTCCCAGCCAACGGCAGGTG 17897 Query 3361 TGCAGGCACATTTGCAGCAGCTGGCAATGGCGTGGTAAGCATTGACCTCGCTCCCGACAG 3420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 17898 TGCAGGCACATTTGCAGCAGCTGGCAATGGCGTGGTAAGCATTGACCTCGCTCCCGACAG 17957 Query 3421 CTTGCCTTGAGAGTATGGCGCCATGTGCAAGATCTTTTGGATGTGCTTTCACTGCTTTGT 3480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 17958 CTTGCCTTGAGAGTATGGCGCCATGTGCAAGATCTTTTGGATGTGCTTTCACTGCTTTGT 18017 Query 3481 GATGCAGTTCAGGAGTGGTTGAGGAAAGAGAAGGCTGGAGAGGAAAGGGGAtttttttAT 3540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 18018 GATGCAGTTCAGGAGTGGTTGAGGAAAGAGAAGGCTGGAGAGGAAAGGGGATTTTTTTAT 18077 Query 3541 GGGAGTGAGAAGGGGATTACCAACAGGAAAGAGAAATCCAGATAACAGAAGTTAACGTGA 3600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 18078 GGGAGTGAGAAGGGGATTACCAACAGGAAAGAGAAATCCAGATAACAGAAGTTAACGTGA 18137 Query 3601 TGCCTTGTGCCGTTTAGTCCTCGTTAAACCTCCGTTGCATGCGTAATTAAGTAGGGCCAC 3660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 18138 TGCCTTGTGCCGTTTAGTCCTCGTTAAACCTCCGTTGCATGCGTAATTAAGTAGGGCCAC 18197 Query 3661 CCTGGACAGGTGTCGCAATTTGATTTGGCCTGTATATTATTATGTGCAGGGTTCCCTGCA 3720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 18198 CCTGGACAGGTGTCGCAATTTGATTTGGCCTGTATATTATTATGTGCAGGGTTCCCTGCA 18257 Query 3721 CCTGAGCCGGACTCCTTTTCCAGTGACGCGTGCAGTTTACCAACCACCTGCTCTTCTCGG 3780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 18258 CCTGAGCCGGACTCCTTTTCCAGTGACGCGTGCAGTTTACCAACCACCTGCTCTTCTCGG 18317 Query 3781 CCAGTTCGCTGCGGACCTCCAAAACCCAAGCGGAGATGATCGCGCACCGTGTCAGCGCGT 3840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 18318 CCAGTTCGCTGCGGACCTCCAAAACCCAAGCGGAGATGATCGCGCACCGTGTCAGCGCGT 18377 SEQ ID NO: 7 Query 3841 CGCGGCCATAGAAGGGATTCGGGGAGACGTGgccgcccgcgcgcccgtcgcgcaccctat 3900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 18378 CGCGGCCATAGAAGGGATTCGGGGAGACGTGGCCGCCCGCGCGCCCGTCGCGCACCCTAT 18437 Query 3901 cctcgccgcgcgcccgccggccaatcgccaccccTGAATCCACAGCCACGCCACGCGGCC 3960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 18438 CCTCGCCGCGCGCCCGCCGGCCAATCGCCACCCCTGAATCCACAGCCACGCCACGCGGCC 18497 SEQ ID NO: 8 Query 3961 CATGCCTACGCCTCCCACCCGCCACAGGATCTCCCTCTCACGCGCGCGCGATCTCATAAA 4020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 18498 CATGCCTACGCCTCCCACCCGCCACAGGATCTCCCTCTCACGCGCGCGCGATCTCATAAA 18557 Query 4021 AACCTCGCCACCTCGATCGGTGAGGTAGCACGAGGCGGCCTGAGCTGAACACCGCATCAG 4080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 18558 AACCTCGCCACCTCGATCGGTGAGGTAGCACGAGGCGGCCTGAGCTGAACACCGCATCAG 18617 Query 4081 CAGCAGCAAGCAGCTAATCGCGCACGTACGCACACCGCGACCCGGGGCGAGATGGCGCAG 4140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 18618 CAGCAGCAAGCAGCTAATCGCGCACGTACGCACACCGCGACCCGGGGCGAGATGGCGCAG 18677 Query 4141 TCGATGCTGGTGTCGGGAGCCAATGGCACGGTGGCCGCCGCGAGCACCAGCAGGCTGCAG 4200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 18678 TCGATGCTGGTGTCGGGAGCCAATGGCACGGTGGCCGCCGCGAGCACCAGCAGGCTGCAG 18737 Query 4201 CCCGTGCGGCCGACGCCGTTCTCGCGGCTCGTGCTGTCGCAGCCGTCGTCGTCGCTGGGG 4260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 18738 CCCGTGCGGCCGACGCCGTTCTCGCGGCTCGTGCTGTCGCAGCCGTCGTCGTCGCTGGGG 18797 Query 4261 CGCGCGGTGTCCGTCAAGACGGTGGCGCTGTTCGGCAGGTCCAAGACCAAGGCCGCGCCC 4320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 18798 CGCGCGGTGTCCGTCAAGACGGTGGCGCTGTTCGGCAGGTCCAAGACCAAGGCCGCGCCC 18857 Query 4321 GCAAGAAAGGTTGGAATTTGGATGGATGAATGCAAGCTAAACTAAGCTAAGCTAAGCTCG 4380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 18858 GCAAGAAAGGTTGGAATTTGGATGGATGAATGCAAGCTAAACTAAGCTAAGCTAAGCTCG 18917 Query 4381 CGTTTGTTTTAGTCTTATGTTTGATGGTGCTAACTATTTTGTAACGTGTCAACGTGTGTA 4440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 18918 CGTTTGTTTTAGTCTTATGTTTGATGGTGCTAACTATTTTGTAACGTGTCAACGTGTGTA 18977 Query 4441 TGTAGGCTGAGCCGAAGCCAAAGTTCAAGACCGAGGACGGCATCTTCGGCACGTCCGGTG 4500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 18978 TGTAGGCTGAGCCGAAGCCAAAGTTCAAGACCGAGGACGGCATCTTCGGCACGTCCGGTG 19037 Query 4501 GGATCGGTTTCACCAAGGAGAACGAGCTGTTCGTCGGGCGTGTCGCCATGCTCGGGTTTG 4560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 19038 GGATCGGTTTCACCAAGGAGAACGAGCTGTTCGTCGGGCGTGTCGCCATGCTCGGGTTTG 19097 Query 4561 CCGTAAGTAGACCTTTCTTGGCCTTCTAGTTATTTGGTATGCATCATTTCTTGCCATCTT 4620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 19098 CCGTAAGTAGACCTTTCTTGGCCTTCTAGTTATTTGGTATGCATCATTTCTTGCCATCTT 19157 Query 4621 GGTACGTACCTGTGCGTTCGGGTTTGGGTTAGCTAGCTAGCAAGAGCACAAGCTTAAACG 4680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 19158 GGTACGTACCTGTGCGTTCGGGTTTGGGTTAGCTAGCTAGCAAGAGCACAAGCTTAAACG 19217 Query 4681 TCAAAAGTTTTGTGGTTAACGGAAGCACTTTACCCGGGAGCGTCATCCTTTATTCTATAA 4740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 19218 TCAAAAGTTTTGTGGTTAACGGAAGCACTTTACCCGGGAGCGTCATCCTTTATTCTATAA 19277 Query 4741 AGGGTCACATGTTGCATAGGTAGATTTGCTTCCAACTACttttttttaaaaaaaaaTTAT 4800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 19278 AGGGTCACATGTTGCATAGGTAGATTTGCTTCCAACTACTTTTTTTTAAAAAAAAATTAT 19337 Query 4801 AGTTTTTGTCATATATTTTACTTTGAATTTTCTGTGCACATAAAAATGCTATATTTCTCC 4860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 19338 AGTTTTTGTCATATATTTTACTTTGAATTTTCTGTGCACATAAAAATGCTATATTTCTCC 19397 Query 4861 TTAGCAAATATTGCTACTTTTATTTTATTTTTCAGTCCGAGTTTTGACAGCGACATTGTT 4920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 19398 TTAGCAAATATTGCTACTTTTATTTTATTTTTCAGTCCGAGTTTTGACAGCGACATTGTT 19457 Query 4921 TAATCTAGGCCAGTTAGCAACTCACATGTATACCACACACATAACTAATGAATTATCTGG 4980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 19458 TAATCTAGGCCAGTTAGCAACTCACATGTATACCACACACATAACTAATGAATTATCTGG 19517 Query 4981 ATTTAGTAATATAGGTATTGTAGGTTTTAAAAAATTCGTCTTTCGAGCAGATATATTGTT 5040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 19518 ATTTAGTAATATAGGTATTGTAGGTTTTAAAAAATTCGTCTTTCGAGCAGATATATTGTT 19577 Query 5041 TAATGAGTAAATTTTAGAGAACTATAAATTTAGTGACTAAATTATCAGCTTGTTGTAACG 5100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 19578 TAATGAGTAAATTTTAGAGAACTATAAATTTAGTGACTAAATTATCAGCTTGTTGTAACG 19637 Query 5101 TTAGTGACATATTATATTTCAGTTTAGGAAGAAGAGGGGATTTCTGaaaaaaaaaGAATG 5160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 19638 TTAGTGACATATTATATTTCAGTTTAGGAAGAAGAGGGGATTTCTGAAAAAAAAAGAATG 19697 Query 5161 AATCTCCTTCCTGCAGCAATAACAAAGAAAATCATTATAAATCTACAACTACGTGAACAA 5220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 19698 AATCTCCTTCCTGCAGCAATAACAAAGAAAATCATTATAAATCTACAACTACGTGAACAA 19757 Query 5221 CCTAACGTTAATCCTGCTGAAACGCCGCTCAGTCGGTGCACCTGAGTCAAAACCTCATTC 5280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 19758 CCTAACGTTAATCCTGCTGAAACGCCGCTCAGTCGGTGCACCTGAGTCAAAACCTCATTC 19817 Query 5281 CAAGGTAGGGCAAATGGCCATTTCATCTTCCCCTTTGCCCTTTTTAGCTTGATGGGTTTT 5340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 19818 CAAGGTAGGGCAAATGGCCATTTCATCTTCCCCTTTGCCCTTTTTAGCTTGATGGGTTTT 19877 Query 5341 AACCTCGGTGCACCAACCGAGTGCGAGTAGCATTCTAGTCGGAACAAACGGAACAATTAG 5400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 19878 AACCTCGGTGCACCAACCGAGTGCGAGTAGCATTCTAGTCGGAACAAACGGAACAATTAG 19937 Query 5401 TTTCAGGCCGATTTTAGTTACAAACTTTTTCTTCAAACTTTTAACTTTTCTATCACATCA 5460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 19938 TTTCAGGCCGATTTTAGTTACAAACTTTTTCTTCAAACTTTTAACTTTTCTATCACATCA 19997 Query 5461 AAACTTTCCTATACAAATAATCTTACAACTTTTCCGTCACATCGTTCCAATTTCAACTAT 5520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 19998 AAACTTTCCTATACAAATAATCTTACAACTTTTCCGTCACATCGTTCCAATTTCAACTAT 20057 Query 5521 AAACTTTTAAGTTTAGCGTGAACTAAACACACCCCTAGTGGAGTCGAACCAAAGTGATGC 5580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 20058 AAACTTTTAAGTTTAGCGTGAACTAAACACACCCCTAGTGGAGTCGAACCAAAGTGATGC 20117 Query 5581 ACTTAGTTGTCGGCCGATGTGGCATGCTGCTACGATGCACATCTTGACATTGACGTGTCA 5640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 20118 ACTTAGTTGTCGGCCGATGTGGCATGCTGCTACGATGCACATCTTGACATTGACGTGTCA 20177 Query 5641 TGAAGACATGTTCCTCCATCTTGCCACACTATATACTACCTCTATGACACGCGATGTCCA 5700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 20178 TGAAGACATGTTCCTCCATCTTGCCACACTATATACTACCTCTATGACACGCGATGTCCA 20237 Query 5701 TGTATCAATAATATTACTAGGATGTATATGATGTTACAGATTTGTGATAttttttttCTT 5760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 20238 TGTATCAATAATATTACTAGGATGTATATGATGTTACAGATTTGTGATATTTTTTTTCTT 20297 Query 5761 TTATTACTGTAACAAACTAAAACTGGTTGTAAATGTTGTAGCACTTAGATAGTTTAGTCA 5820 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 20298 TTATTACTGTAACAAACTAAAACTGGTTGTAAATGTTGTAGCACTTAGATAGTTTAGTCA 20357 Query 5821 CTAAATTTACAGTGCTTTAAAATTTACTCTCGTTTAATAATTTGTATAGTGTACATGCAT 5880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 20358 CTAAATTTACAGTGCTTTAAAATTTACTCTCGTTTAATAATTTGTATAGTGTACATGCAT 20417 Query 5881 GACTAGCACAATCGATCGTTGAGTCATACCAACCTGATGCAAAAGCGCTCAAACTGTGCA 5940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 20418 GACTAGCACAATCGATCGTTGAGTCATACCAACCTGATGCAAAAGCGCTCAAACTGTGCA 20477 Query 5941 GGCGTCGATCCTGGGTGAGGCCATCACCGGGAAGGGAATCCTGGCGCAGCTGAACCTGGA 6000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 20478 GGCGTCGATCCTGGGTGAGGCCATCACCGGGAAGGGAATCCTGGCGCAGCTGAACCTGGA 20537 Query 6001 GACGGGGATCCCGATCTACGAGGCGGAGCCCCTCCTCCTCTTCTTCATCCTCTTCACCCT 6060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 20538 GACGGGGATCCCGATCTACGAGGCGGAGCCCCTCCTCCTCTTCTTCATCCTCTTCACCCT 20597 Query 6061 CCTCGGCGCCATCGGCGCGCTCGGCGACCGCGGCAGCTTCGTCGACGACCAGCCGGTGAC 6120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 20598 CCTCGGCGCCATCGGCGCGCTCGGCGACCGCGGCAGCTTCGTCGACGACCAGCCGGTGAC 20657 Query 6121 GGGCCTCGACAAGGCCGTCATCGCCCCGGGCAAGGGCTTCCGCTCCGCGCTGGGCCTCAG 6180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 20658 GGGCCTCGACAAGGCCGTCATCGCCCCGGGCAAGGGCTTCCGCTCCGCGCTGGGCCTCAG 20717 Query 6181 CGAGGGCGGCCCGCTGTTCGGCTTCACCAAGGCCAACGAGCTGTTCGTCGGCCGGCTCGC 6240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 20718 CGAGGGCGGCCCGCTGTTCGGCTTCACCAAGGCCAACGAGCTGTTCGTCGGCCGGCTCGC 20777 Query 6241 GCAGCTCGGCATCGCCTTCTCCATCATCGGCGAGATCATCACCGGCAAGGGCGCCCTCGC 6300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 20778 GCAGCTCGGCATCGCCTTCTCCATCATCGGCGAGATCATCACCGGCAAGGGCGCCCTCGC 20837 Query 6301 GCAGCTCAACATCGAGACCGGCGTCCCCATCAACGAGATCGAGCCGCTCGTCCTCTTCAA 6360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 20838 GCAGCTCAACATCGAGACCGGCGTCCCCATCAACGAGATCGAGCCGCTCGTCCTCTTCAA 20897 Query 6361 CGTCGTCTTCTTCTTCATCGCCGCCATCAACCCCGGCACCGGCAAGTTCGTCAGCGACGA 6420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 20898 CGTCGTCTTCTTCTTCATCGCCGCCATCAACCCCGGCACCGGCAAGTTCGTCAGCGACGA 20957 Query 6421 CGACGAAGAGTAGAATTACGAGGATCGATCGATCTACCGAGGTTTCGCCGCCATTGTTGT 6480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 20958 CGACGAAGAGTAGAATTACGAGGATCGATCGATCTACCGAGGTTTCGCCGCCATTGTTGT 21017 Query 6481 GCTTGCGCATCATTGAGACTTTCTTTCAAGTGTATATGTACTGTGTACGTGTAGGTGTAA 6540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 21018 GCTTGCGCATCATTGAGACTTTCTTTCAAGTGTATATGTACTGTGTACGTGTAGGTGTAA 21077 Query 6541 AGACGTACCTTGTTTAATTAGTTGTTAATTAATGCCCATGGAGAAAATTAACGTGAGATT 6600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 21078 AGACGTACCTTGTTTAATTAGTTGTTAATTAATGCCCATGGAGAAAATTAACGTGAGATT 21137 Query 6601 TAGCTACTTGCTGCGGTAAATCTAATTGGAGATGCCTCTCCAATTAGTCTTAACCAGAGA 6660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 21138 TAGCTACTTGCTGCGGTAAATCTAATTGGAGATGCCTCTCCAATTAGTCTTAACCAGAGA 21197 Query 6661 CATCCAATTAGTCTTAACCAGAGACACCCATACTTTAGGAGTTTTGGTTGCTATTAATCC 6720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 21198 CATCCAATTAGTCTTAACCAGAGACACCCATACTTTAGGAGTTTTGGTTGCTATTAATCC 21257 Query 6721 ATTGAGCATCTATGCTTGAAATAAAATTATCTCTTAAATTACTCATCCGATTTAC 6775 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 21258 ATTGAGCATCTATGCTTGAAATAAAATTATCTCTTAAATTACTCATCCGATTTAC 21312 Besides listing the full-length genomic sequence and the encoded protein sequence, the PAC clone also annotates the mRNA sequence and the 5’ UTR sequence containing the promoter sequence. However, Hubbart et al. does not describe any CRISPR-Cas technique or using gene editing technique comprising at least one RNA-guided nucleic acid modifying enzymes (e.g., Cas9) and/or at least one guide RNA (gRNA). Jacobs et al. describes targeted genome editing by modify gene expression by editing promoter sequence(s) and/or inserting specific transgene(s) at a specific location in a plant genome plant using CRISPR-Cas9 (page 1, right column, para 2, line 6-9). Jacobs et al. describes using Cas9 enzyme (abstract), as recited in claim 12. Jacobs et al. also describes a novel cloning strategy and a vector system to simplify the production of CRISPR/Cas9 targeting vectors which would be applicable for targeting any gene in any organism (abstract). It also describes a vector comprising nptII selection marker cassette (page 7, right column, para 1, line 7-8), as recited in claim 2. It would have been obvious, and Jacobs et al. also describes sequencing, as recited in claim 1 (f) to determine the genetic modifications at the target locus (page 3, left column, para 2, line 1-2 and last 2 lines). It would have been obvious to an ordinarily skilled artisan to replace the endogenous promoter of the psbS gene with a strong constitutive heterologous promoter (e.g. CmYLCV promoter, as taught by Hubbart et al.; or other commonly used strong constitutive promoter like 35CaMV), a strong endogenous tissue specific promoter, or an strong endogenous inducible promoter which is induced under specific external environmental conditions including light (e.g. psbA2), cold and drought (e.g., ABA/drought-inducible promoter) using the well known standard CRISPR-Cas9 based technique, as described by Jacobs et al., to achieve a gain of function mutation via overexpression (as recited in claims 3-4) resulting in increased canopy radiation (light) use efficiency and grain yield after screening the mutant plants, as described by Hubbart et al. The said mutation would be an insertion-deletion (indel) mutation, as recited in claim 11. One ordinarily skilled artisan would have been motivated to replace the endogenous promoter of the psbS gene with a strong constitutive heterologous promoter or a strong endogenous tissue specific promoter that expresses more strongly in the leaves, or a strong endogenous inducible promoter which is induced under specific external environmental conditions including light (e.g. psbA2 promoter), cold, or drought (e.g., ABA/drought-inducible promoter) using the well-known standard CRISPR-Cas9 based technique, to achieve a gain of function traits in the mutant lines after screening the mutant plants. Designing suitable gRNA sequence to get desired indel mutations in a specific gene is well known and widely used standard practice in the art2. It would have been obvious to an ordinarily skilled artisan to design gRNA sequence(s) from any portion of the target sequence, including SEQ ID NO: 7 and 8 (as recited in claim 16) as they all are functional equivalents. It would have been an experimental design choice of an ordinarily skilled artisan to use specific gRNA sequences with a suitable spacer sequence to achieve the desired mutations in the psbS gene. However, both the sequences, SEQ ID NOs: 7-8 have 100% sequence identity to instant SEQ ID NO: 94 and also are known in the context of published genomes, as shown above in the sequence alignment. Regarding claim 2, Jacobs et al. describes binary vectors encoding a RNA-guided nucleic acid modifying enzyme (Cas9) along with four different selectable makers (nptII, GFP, hygromycin, bar) (page 7, left column, para 3, last 4 lines). Developing marker-free genome edited plant is well-known in the art. It is often achieved by using a preassembled complexe(s) of purified Cas protein(s) (e.g., Cas9) and guide RNA(s) into plant cells/protoplasts. Woo et al. teaches developing such marker-free plants would have obvious benefits including that it would not be considered a GMO and would not have faced the regulatory obstacles in countries (including United States) where transgene-free genome edited plants are not considered GMO. Claims 8 and 17 are rejected under 35 U.S.C. 103 as being unpatentable over Hubbart et al. in view of Jacobs et al. as applied to claims 1-7 and 9-16 above, and further in view of Vazquez-Vilar et al. (Design of Multiplexing CRISPR/Cas9 Constructs for Plant Genome Engineering Using the GoldenBraid DNA Assembly Standard, 2022, Matias D. Zurbriggen (ed.), Plant Synthetic Biology, Methods in Molecular Biology, 2379:27-44; first published online on 21st Feb. 2022); in evidence of Zalatan et al. (US 20170233762 A1, published in 2017) and Osakabe, K (GenBank Accession No. LC460477, published in 2019). Claim 8 depends from claim 1 and alternatively requires (see the indefinite rejection above) two or more different guide RNAs. Hubbart et al. in view of Jacobs et al. describes replacing the endogenous promoter of the psbS gene with a strong constitutive heterologous promoter or a strong endogenous tissue specific promoter that expresses more strongly in the leaves (where light absorption and photosynthesis happen), or an strong endogenous inducible promoter which is induced under specific external environmental conditions including light (e.g. psbA2 promoter), cold, or drought (e.g., ABA/drought-inducible promoter), using the well-known standard CRISPR-Cas9 based genome editing technique, to achieve gain of function trait(s) in the mutant lines after screening the mutant plants, as discussed above. However, Hubbart et al. in view of Jacobs et al. does not describe any polycistronic gRNA construct comprising two or more different guide RNAs. Vazquez-Vilar et al. describes developing a polycistronic gRNA construct that guides a version of Cas9 endonuclease to three different positions of the nopaline synthase (NOS) promoter to modify expression of the NOS gene (Abstract). The construct (cloned in a vector, pUPD2) is created by assembling the annealed oligonucleotides together with the tRNA linkers linking more than two “scaffold” sequences (present in the gRNA sequences) creating a “tRNA-protospacer-scaffold” (“tps”) (page 29, para 2, line 3-6; Fig. 1). The “tRNA” and the “scaffold” are both included in the GB kit (page 30, Fig. 1). It would have been obvious to an ordinarily skilled artisan to replace the endogenous promoter of the psbS gene with either a strong constitutive heterologous promoter (as described by Hubbart et al.), a strong endogenous tissue specific promoter that expresses more strongly in the leaves, or with an strong endogenous inducible promoter which is induced under specific external environmental conditions including light (e.g. psbA2), cold and draught (e.g., ABA/drought-inducible promoter) using the well-known standard CRISPR-Cas9 based technique, to achieve gain of function trait(s) in the mutant lines after screening the mutant plants. Using a polycistronic gRNA construct comprising more than two scaffold sequences, as described by Vazquez-Vilar et al., to replace different regions of the psbS promoter in rice with different heterologous and/or endogenous promoter sequences, as mentioned above, would have created overexpression of the psbS gene in the plant resulting in gain-of-function trait(s) including comprising increased NPQ, higher biomass and leaf area, and higher grain yield, as described by Hubbart et al. One with ordinary skill in the art would have been motivated to replace the endogenous promoter of the psbS gene with either a strong constitutive heterologous promoter, a strong endogenous tissue specific promoter that expresses more strongly in the leaves, or a strong endogenous inducible promoter which is induced under specific external environmental conditions including light (e.g. psbA2 promoter), cold, or draught (e.g., ABA/drought-inducible promoter) using the well-known standard CRISPR-Cas9 based technique, to achieve gain of function trait(s) in the mutant lines after screening the mutant plants. Using a polycistronic gRNA construct comprising more than two scaffold sequences to replace different regions of the psbS promoter in the plant with different heterologous and/or endogenous promoter sequences would have created different expression patterns of the psbS gene in the plant. That would have enabled the artisan to evaluate penetrance and/or expressivity of different mutant versions of the psbS gene in terms of gain-of-function trait(s) comprising increased NPQ, higher biomass and leaf area, and higher grain yield. Regarding claim 17, It would have been an experimental design choice of an ordinarily skilled artisan to use specific functional equivalents of the scaffold sequence(s) (that binds to the specific endonuclease, forming the ribonucleoprotein complex) and the tRNA linker sequence(s) to achieve desired mutation(s) in the promoter or other non-coding regulatory sequence(s) affecting expression of the psbS gene. Moreover, gRNA scaffold sequence comprising SEQ ID NO: 9 is a well-known standard sequence for Cas9 endonuclease, as described by Zalatan et al. (US 20170233762 A1). The gRNA scaffold comprising SEQ ID NO: 1 (claim 11) described by Zalatan et al. has 100% sequence identity to instant SEQ ID NO: 9. Similarly, instant SEQ ID NO: 10 has 100% identity to tRNA-Gly gene in Arabidopsis, which is also a known tRNA scaffold sequence used in CRISPR-Cas9 based genome editing in plants including in rice, as described by Osakabe, K (GenBank Accession No. LC460477). Claims 26-28 are rejected under 35 U.S.C. 103 as being unpatentable over Hubbart et al. in view of Jacobs et al. as applied to claims 1-7 and 9-16 above, and further in view of Zhang et al. (MsZEP, a novel zeaxanthin epoxidase gene from alfalfa (Medicago sativa), confers drought and salt tolerance in transgenic tobacco, 2016, Plant Cell Rep., 35:439–453), Sun et al. (Overexpression of the ChVDE gene, encoding a violaxanthin de‑epoxidase, improves tolerance to drought and salt stress in transgenic Arabidopsis, 2019, Biotech., 9:197) and Cao et al. (Overexpression of zeaxanthin epoxidase gene from Medicago sativa enhances the tolerance to low light in transgenic tobacco, 2018, Acta Biochimica Polonica, 65:431–435. Hubbart et al. in view of Jacobs et al. describes replacing the endogenous promoter (which is a non-coding sequence in a gene) of the rice psbS gene with a strong constitutive heterologous promoter or a strong endogenous tissue specific promoter that expresses more strongly leaves (where light absorption and photosynthesis occur), or an strong endogenous inducible promoter which is induced under specific external environmental conditions including light (e.g. psbA2 promoter), cold, or draught (e.g., ABA/drought-inducible promoter) using the well-known standard CRISPR-Cas9 based technique, to achieve a gain of function traits in the mutant lines after screening the mutant plants, as discussed above. However, Hubbart et al. in view of Jacobs et al. does not describe either ZEP or VDE. Zhang et al. describes that overexpression of a zeaxanthin epoxidase (ZEP) gene confers drought and salt tolerance in a plant (title and abstract). Zhang et al. describes replacing the endogenous promoter with 35S CaMV promoter to drive the expression of the ZEP gene in a plant (page 442, left column, para 2, line 2-7) to achieve the gain of function trait. On the other hand, Sun et al. describes that overexpression of another gene violaxanthin de-epoxidase (VDE) also confers drought and salt tolerance in a plant (title and abstract). Sun et al. also replaced the endogenous promoter with 35S CaMV promoter to drive the expression of the VDE gene in the plant to achieve the gain of function trait (page 196, right column, last para, like 1-3). It would have been obvious to further modify the gene-edited plants having increased canopy radiation use efficiency, grain yield, drought and salt tolerance produced by the Hubbart et al. in view of Jacob et al. as discussed above, by replacing the endogenous promoters of the ZEP and/or the VDE gene(s) with a strong constitutive heterologous promoter (e.g. 35S CaMV promoter), or a strong endogenous tissue specific promoter, or a strong endogenous inducible promoter which is induced under specific external environmental conditions including light (e.g. psbA2 promoter), cold, draught, and/or salt stress using the well-known standard CRISPR-Cas9 based technique, as described by Jacobs et al., to achieve a gain of function mutation (as recited in claims 26-28) comprising increased canopy radiation (light) use efficiency, grain yield, drought, and salt tolerance after screening the mutant plants, as described by Hubbart et al. (for psbS overexpression), Sun et al. (for VDE overexpression) and Zhang et al (for ZPE overexpression). Moreover, Cao et al. describes that overexpression of ZEP is also reported to confer tolerance to low light stress (title and abstract). Gene stacking is a well-known standard technique in the art to introduce new trait(s) in a crop variety. An ordinarily skilled artisan would have been motivated to replace the endogenous promoters of the ZEP and/or the VDE gene(s) with a strong constitutive heterologous promoter (e.g. 35S CaMV promoter) or a strong endogenous tissue specific promoter, or an strong endogenous inducible promoter which is induced under specific external environmental conditions including light (e.g. psbA2 promoter), cold, draught, and/or salt stress using the well-known standard CRISPR-Cas9 based technique, as described by Jacobs et al., to achieve gain of function mutation(s) (as recited in claims 26-28) comprising increased canopy radiation (light) use efficiency, grain yield, drought and salt tolerance after screening the mutant plants, as described by Hubbart et al. (for psbS overexpression), Sun et al. (for VDE overexpression) and Zhang et al (for ZPE overexpression). Moreover, overexpression of ZEP is also reported to confer tolerance to low light stress. Other art relevant to the invention, but not cited in an art rejection: It is prudent to mention here that specific mutation(s) in the non-coding regions comprising a promoter in a gene also occur naturally. Subsequent selection of necessary traits during domestication (and other breeding processes) of crop plants are screened and selected for commercially important gain-of-function trait(s), as reported for rice DRO1 gene3. Thus, screening wild type relatives and/or different varieties from different agroclimatic regions show high potential to achieve gain-of-function trait(s) conferred by mutations in the non-coding region of a gene. Conclusion No claim is allowed. Communication Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAY CHATTERJEE whose telephone number is (703)756-1329. The examiner can normally be reached (Mon - Fri) 8.30 am to 5.30 pm.. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. Jay Chatterjee Patent Examiner Art Unit 1662 /Jay Chatterjee/Examiner, Art Unit 1662 /BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1661 & 1662 1 Hubbart et al. (The photoprotective protein PsbS exerts control over CO2 assimilation rate in fluctuating light in rice, 2012, The Plant Journal, 71:402–412) provides the evidence of the detail method used to generate the psbS overexpressing lines in rice (page 410, right column, para 3, line 15-16). It describes more than 2 (3) overexpressing lines used for further analysis (page 403, right column, last para, first 2 lines). 2 Cui et al. (Review of CRISPR/Cas9 sgRNA Design Tools, 2018, Interdisciplinary Sciences: Computational Life Sciences,10:455–465) provides the evidence that designing guide RNAs for targeted gene editing using CRISPR- Cas based technique is a standard and routine practice (abstract). 3 Uga Y (US 2017/0306421 Al) provides the evidence that overexpression of DRO1 gene in rice due to two specific mutations in the upstream promoter region resulting in the gain of function trait of deep rooting (abstract; page 5, para 0063, line 14-18).
Read full office action

Prosecution Timeline

Apr 11, 2023
Application Filed
Feb 04, 2026
Non-Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12570986
SEC12-LIKE PROTEIN GENE CPU1 AND APPLICATION THEREOF IN IMPROVING SOYBEAN PHOSPHORUS EFFICIENCY
2y 5m to grant Granted Mar 10, 2026
Patent 12527270
PROMOTING REGENERATION AND TRANSFORMATION IN PLANTS
2y 5m to grant Granted Jan 20, 2026
Patent 12497630
USE OF SWEETPOTATO IBSAP15 GENE IN REGULATING LEAF SHAPE AND FLOWER SHAPE OF SWEETPOTATO
2y 5m to grant Granted Dec 16, 2025
Patent 12467059
RICE WHITE LEAF AND PANICLE GENE WLP3 AND APPLICATION THEREOF IN RICE STRESS RESISTANCE AND YIELD INCREASE
2y 5m to grant Granted Nov 11, 2025
Study what changed to get past this examiner. Based on 4 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
82%
Grant Probability
99%
With Interview (+40.0%)
2y 8m
Median Time to Grant
Low
PTA Risk
Based on 11 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month