DETAILED ACTION
This action is in reply to papers filed 5/25/2026.
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Examiner’s Note
All paragraph numbers throughout this office action, unless otherwise noted, are from the US PGPub of this application US20240156989A1, Published 5/16/2024.
Election/Restrictions
Applicant’s election without traverse of Invention I, claims 55-66, in the reply filed on 5/25/2026 is acknowledged. Claims 67-74 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 5/25/2026.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Prior Art Rejection 1
Claim(s) 55 and 65-66 is rejected under 35 U.S.C. 102(a)(1)/(a)(2) as being anticipated by Black et al. (WO2014197748A2, Published 12/11/2014; Ref. 1 in IDS filed 4/24/23).
Claim Interpretation: In both (a) and (b) of claim 55, all that is required is a first or second CRISPR/Cas9 guide RNA (or a nucleic acid comprising a nucleotide sequence encoding the first or second CRISPR/Cas guide RNA) to comprise a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a first or second target sequence corresponding to intron 44 or intron 55, respectively, of the wildtype human dystrophin gene.
The limitation of “wherein the mutant dystrophin gene comprises a mutation within the exon 45-55 region” is non-limiting. This is because the mutant dystrophin gene is not required to be comprised in the composition. Indeed, while the composition requires guide sequences having 100% complementarity over 17 contiguous or more nucleotides with target sequences within introns of the mutant dystrophin gene, said mutant dystrophin gene is not required.
Additionally, the limitation of the target sequences being separated from each other is not limiting because the guide RNAs of the composition are not in the genome of a cell. Indeed, para. 279 of the PgPub explains that when pairs of gRNAs targeted to introns 44 and 55 are co-transfected (in a cell), an exon 45-55 deletion (˜708 kb) results after NHEJ. How are the target sequences that correspond to intron 44 and intron 55 of the wildtype DMD gene separated in a composition? The rejection below is made in view of this interpretation.
Regarding claim 66, Black discloses a kit (Pg. 6, para. 19) for modifying a mutant dystrophin gene in a cell's genome (Pg. 5-6, para. 18), the kit comprising (i) a first CRISPR/Cas single guide RNA (as in claim 65) (Pg. 37, para. 168), wherein the first CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 20 (as in claim 59, in-part) or more contiguous nucleotides with a first target sequence corresponding to intron 44 of the human dystrophin gene (Pg. 43, para. 186; Pg. 14, para. 56), (ii) a second CRISPR/Cas single guide RNA (as further in claim 65), wherein the second CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over20 (as further in claim 59) or more contiguous nucleotides with a second target sequence corresponding to intron 55 of the human dystrophin gene (Pg. 43, para. 186; Pg. 14, para. 56) and a Cas9 protein (as in claim 60, claim 61, claim 62 and claim 63)(Pg. 3, para. 8). With respect to the ‘wherein’ and ‘where the’ clauses in claim 55, as noted in the ‘claim interpretation’, these limitations are not given any structural weight.
Accordingly, Black anticipates the claimed invention.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Prior Art Rejection 2
Claims 56-58 are rejected under 35 U.S.C. 103 as being unpatentable over Black et al. (WO2014197748A2, Published 12/11/2014; Ref. 1 in IDS filed 4/24/23) as applied to claims 55 and 65-66 above, and further in view of Huston et al. (WO2016161380A1, Filed 4/1/2016, PRIORITY DATE 4/1/2015; Ref. N in IDS filed 4/24/23).
The teachings of Black are relied upon as detailed above. However Black fails to teach (1) the guide sequence of the first CRISPR/Cas guide RNA comprises (a) the nucleotide sequence set forth in any of SEQ ID NOs: 1155-1159 or (b) the nucleotide sequence set forth in any of SEQ ID NOs: 1150-1154 and SEQ ID NOs: 1223-1269 (as in claim 56); (2) the guide sequence of the second CRISPR/Cas guide RNA comprises (a) the nucleotide sequence set forth in any of SEQ ID NOs: 1175-1179 or (b) the nucleotide sequence set forth in any of SEQ ID NOs: 1170-1174 and SEQ ID NOs: 1318-1365 (as in claim 57) or (3) that the guide sequence of the first CRISPR/Cas guide RNA comprises SEQ ID NO: 1158 and the guide sequence of the second CRISPR/Cas guide RNA comprises SEQ ID NO: 1177; or (b) the guide sequence of the first CRISPR/Cas guide RNA comprises SEQ ID NO: 1153 and the guide sequence of the second CRISPR/Cas guide RNA comprises SEQ ID NO: 1172 (as in claim 58).
Before the effective filing date of the claimed invention, Huston et al. teach CRISPR/CAS related compositions and methods for treatment of DMD (Abstract). At Pg. 7, lines 28-32, Huston teaches targeting domains for use in gRNAs for altering a DMD target position. Huston adds that the targeting domains of each gRNAs can comprise nucleotide sequences set forth in SEQ ID NOs: 206-826366. Huston teaches the target site of said domains were intron 44 and intron 55 (Pg. 121, lines 25-31).
Huston et al. teach a sequence that is 100% identical to SEQ ID NO: 1153 (as in claim 56 (b)) and claim 58(b) in-part). The sequence comparison between the sequence of Huston and SEQ ID No: 1153 is copied below. This sequence can be found on pg. 608 of the provided modified provisional. This sequence is identified as DMD-27309/SEQ ID NO: 27695.
RESULT 1
; APPLICANT: EDITAS MEDICINE
; APPLICANT:HSU, Patrick David
; APPLICANT:MAEDER, Morgan Lee
; APPLICANT:ODONNELL, Penrose
; APPLICANT:TYCKO, Joshua C.
; APPLICANT:HUSTON, Nicholas C.
; TITLE OF INVENTION: CRISPR/CAS-RELATED METHODS AND COMPOSITIONS FOR TREATING DUCHENNE
; TITLE OF INVENTION:MUSCULAR DYSTROPHY AND BECKER MUSCULAR DYSTROPHY
Query Match 100.0%; Score 20; DB 73; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GUUGAAAUUAAACUACACAC 20
||||||||||||||||||||
Db 1 GUUGAAAUUAAACUACACAC 20
Huston et al. further teach a sequence that is 100% identical to SEQ ID NO: 1172 (as in claim 57(b) and as further in claim 58(b)). The sequence comparison between the sequence of Huston and SEQ ID No: 1172 is copied below. This sequence can be found on pg. 128 of the provided modified provisional application. This sequence is identified as DMD-5736/SEQ ID NO: 6122.
RESULT 1
; APPLICANT: EDITAS MEDICINE
; APPLICANT:HSU, Patrick David
; APPLICANT:MAEDER, Morgan Lee
; APPLICANT:ODONNELL, Penrose
; APPLICANT:TYCKO, Joshua C.
; APPLICANT:HUSTON, Nicholas C.
; TITLE OF INVENTION: CRISPR/CAS-RELATED METHODS AND COMPOSITIONS FOR TREATING DUCHENNE
; TITLE OF INVENTION:MUSCULAR DYSTROPHY AND BECKER MUSCULAR DYSTROPHY
;
Query Match 100.0%; Score 20; DB 73; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 UGUAUGAUGCUAUAAUACCA 20
||||||||||||||||||||
Db 1 UGUAUGAUGCUAUAAUACCA 20
When taken with the teachings of Black et al., one of ordinary skill in the art would have found it prima facie obvious to use the guide sequences taught in Huston in the CRISPR mediated gene editing system of Black et al. The skilled artisan would have had a reasonable expectation of achieving the goal of treating DMD, as so set forth in Black et al., because Huston teaches their targeting domains are for use in gRNAs for altering a DMD target position.
Thus, the claimed invention would have been prima facie obvious.
Prior Art Rejection 3
Claims 60-61 and 64 are rejected under 35 U.S.C. 103 as being unpatentable over Black et al. (WO2014197748A2, Published 12/11/2014; Ref. 1 in IDS filed 4/24/23) as applied to claims 55 and 65-66 above, and further in view of Zhang et al. (U.S. Patent 9790490B2, Filed 12/18/2015).
The teachings of Black are relied upon as detailed above. However Black fails to teach
wherein the class 2 CRISPR/Cas endonuclease is a Cpfl protein and the first and second gRNAs are Cpfl gRNAs (as in claim 60, 61 and 64).
Zhang teaches systems, methods, and compositions for targeting nucleic acids. In particular, the invention provides non-naturally occurring or engineered DNA or RNA-targeting systems comprising a novel DNA or RNA-targeting CRISPR effector protein and at least one targeting nucleic acid component like a guide RNA (Abstract). Zhang teaches the guide RNA is a Cpf1 gRNA (as in claim 60, claim 61 and claim 64). Zhang teaches that unlike Cas9, tracrRNA sequences are not required in Cpf1 gRNAs for cleavage activity (Col. 5, line 30+).
When taken with the teachings of Zhang et al., one of ordinary skill in the art would have found it prima facie obvious to substitute the Cas9 protein of Black et al. for the Cpf1 protein of Zhang et al in the CRISPR-Cas delivery system of Black. The skilled artisan would have found it prima facie obvious to do so because, unlike Cas9, Cpf1 proteins do not require tracrRNA for cleavage activity in a CRISPR system. As a consequence, this makes the delivery and gRNA design simpler while still providing for efficient genome editing.
Authorization to Initiate Electronic Communications
The examiner may not initiate communications via electronic mail unless and until applicants authorize such communications in writing within the official record of the patent application. See M.P.E.P. § 502.03, part II. If not already provided, Applicants may wish to consider supplying such written authorization in response to this Office action, as negotiations toward allowability are more easily conducted via e-mail than by facsimile transmission (the PTO's default electronic-communication method). A sample authorization is available at § 502.03, part II.
Conclusion
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to TITILAYO MOLOYE whose telephone number is (571)270-1094. The examiner can normally be reached Working Hours: 5:30 a.m-3:00 p.m. M-F. Off first Friday of biweek.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Peter Paras can be reached on 571- 272-4517. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/TITILAYO MOLOYE/ Primary Examiner, Art Unit 1632
Prosecution Insights