DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of Group I (i.e., drawn to a method of increasing histone methylation by KMT2E) in the reply filed on 5th Feb, 2026, is acknowledged. Additionally, Applicant’s election without traverse of the following Species:
Genus A: The patient has one or more Gs at rs73184087;
Genus B: Substituting one or more Gs;
Genus C: pulmonary arterial hypertension;
Genus D: CRISP-Cas9; and
Genus E: SEQ ID NO: 1 (where the PAM is AGG).
in the same reply, is acknowledged.
Claims 3, 6-8, 11-12, and 14-20 withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Group and species, there being no allowable generic or linking claim. Election was made without traverse (no argument was presented) in the reply filed on 5th Feb, 2026.
Status of Claims
Claims 1, 2, 4, 5, 7, 9, 10, and 13 are currently pending and are under consideration.
Priority
Claims 1, 2, 4, 5, 7, 9, 10, and 13 have an effective filing date of 04/25/2022, which is the filing date of provisional 63/334377.
Specification
The spec. is objected to because of the following informalities:
The spec. recites “for of” in line 1 of [0011].
in [0079] “decrease in E22 and KMT2E (Fig. 5K; Fig. S5A)”, “a decrease in VEGFA and EDN1, and Ki67 (FIG. 5A (M) and FIG. 5B (0)” is stated. However, no such Figures can be found.
Examiner requests thorough checking of the specification/drawings for any such incomplete phrases.
Title
The title of the invention is not descriptive. A new title is required that is clearly indicative of the invention to which the claims are directed. The following title is suggested: Method for reprogramming endothelial cells by targeting an intronic Single Nucleotide Variant (SNV).
Claim Objections
Claim 2 is objected to because of the following informalities: The claim recites “for of” in line 1.
Claim 5 is objected to because of the following informalities: The claim recites a list of conditions. Reciting the list with a colon would improve the grammar of the claim; i.e., the patient has one of: pulmonary hypertension,….
Claim 9 is objected to because of the following informalities: The claim recites “CAS9” in line 2. This is not typical in the art. The use of lower case letters is recommended; i.e., Cas9.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 1, the preamble recites "A method of increasing histone methylation by KMT2E…" and then continues to recite "such as reducing H3K4 methylation " The juxtaposition of a phrase that requires increasing, followed by a phrase that indicates decreasing renders the claim indefinite because it is not clear what exactly is required of the claim. The specification in middle of [0035] recites:
PNG
media_image1.png
200
400
media_image1.png
Greyscale
Further, it is known in the art that KMT2E is a histone methyl transferase; i.e., its function is to methylate histones. As such one would expect that the process of methylation will result in an increase in methylation on histones, and not a decrease.
Thus, one of ordinary skill in the art would not be reasonably apprised of the scope of the invention.
Regarding claim 1 again, the same phrase discussed above uses exemplary language (“such as”). Description of examples or preferences is properly set forth in the specification rather than the claims. If stated in the claims, examples and preferences may lead to confusion over the intended scope of a claim (see MPEP 2173.05(d)).
Regarding claim 2, elevated above normal renders the claim indefinite because the specification does not define elevated above normal or normal. The cell is supposed to have some increase over this undefined level, and therefore, the claimed patient could seemingly have an unknown expression level. The lack of definition for "elevated above normal" in the specification or the art has unknown implications for the structure of the patient. Thus, a standard/control value that remains undefined, makes the metes and bounds of the claimed invention unclear.
Those claims identified in the statement of rejection but not explicitly referenced in the rejection are also rejected for depending from a rejected claim but failing to remedy the indefiniteness therein.
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
Scope of Enablement
Claims 1, 2, 4, 5, 7, 9, 10, and 13 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for:
In vitro embodiments such as: substituting the one or more Gs at rs73184087 with A, T, or C in a cell comprising: contacting the DNA with a CRISPR/Cas9a gRNA comprising a spacer sequence from any one of SEQ ID NOs: 1 - 4
Does not reasonably provide enablement for any of the following:
All in vivo and in vitro embodiments to any cell type, tissue, or patient
All routes of administration of the required components
All vector types, transfection types, integration types, or incubation types
The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims.
WANDS FACTORS
The factors to be considered in determining whether undue experimentation is required are summarized In re Wands 858 F.2d 731, 8 USPQ2nd 1400 (Fed. Cir, 1988). The Court in Wands states: “Enablement is not precluded by the necessity for some 'experimentation.'” Clearly, enablement of a claimed invention cannot be predicated on the basis of quantity of experimentation required to make or use the invention. “Whether undue experimentation is needed is not a single simple factual determination, but rather is a conclusion reached by weighing many factual considerations.” (Wands, 8 USPQ2d 1404). The factors to be considered in determining whether undue experimentation is required include: (1) the quantity of experimentation necessary, (2) the amount or direction or guidance presented, (3) the presence or absence of working examples, (4) the nature of the invention, (5) the state of the prior art, (6) the relative skill of those in the art, (7) the predictability or unpredictability of the art, and (8) the breadth of the claims. While all of these factors are considered, a sufficient amount for a prima facie case is discussed below.
NATURE OF THE INVENTION
The claims are drawn to a method of substituting the one or more Gs at rs73184087 with A, T, or C in the genome of any cell comprising contacting the DNA with a CRISPR/Cas9a gRNA comprising a spacer sequence from any one of SEQ ID NOs: 1 - 4.
BREADTH OF THE CLAIMS
Instant claims encompass
“A method of substituting a G in the genome of a cell” which includes:
In vitro embodiments of all cell types
in vivo embodiments of all subject, tissue, and cell types
While not claimed, the method includes (for all in vivo and in vitro embodiments, as applicable):
All routes of administration
All vector types, transfection types, integration types, or incubation types
DIRECTION OR GUIDANCE OF THE SPECIFICATION
While contemplating in vitro and in vivo embodiments of methods of substituting the one or more Gs at rs73184087 with A, T, or C in the genome of a cell, the specification provides no guidance on ways to introduce to the cell. However, the specification points to several references that show that CRISPR/Cas9 gene editing technology is mature enough to predictably cause a nucleotide substitution in a desired cell. However, neither the spec nor the state of the art evidences any predictability on carrying out such a substitution in any cell, tissue, or organ of the patient.
STATE OF THE ART & QUANTITY OF EXPERIMENTATION
Providing to a cell and in vitro vs. in vivo
Regarding the methods of providing to a cell and in vitro and in vivo embodiments, Applicant is first directed to the art of Dai et al. (Mol Ther Nucleic Acids. 2016;5(8):e349.; henceforth “Dai”). Dai teaches there are many hurdles to overcome such as the off-target effects of CRISPR-Cas9, efficacy of homology-directed repair, fitness of edited cells, immunogenicity of therapeutic CRISPR-Cas9 components, as well as efficiency, specificity, and translatability of in vivo delivery methods (abstract) before CRISPR systems can be applied in humans in the clinic. Dai teaches due to the potential devastating nature of off-target effects, the systems must be studied thoroughly and tested in large-animal models before applied to humans (pg. 2 col. 2).
Furthermore, regarding the methods of providing to a cell specifically, Dai teaches AAV vectors are used in the majority or CRISPR-Cas9 studies, but that AAV vectors have limitation including limited cargo capacity, expression in specific organs is limited due to AAV trophism, and lastly that effective use of AAV requires tissue-specific therapeutic effects while limiting off-target effects (pg. 3, col. 1). Dai teaches delivery methods are not predictably translatable between distinct in vivo embodiments. Specifically, Dai teaches, the number of intramuscular injections that is required to treat a human might be too big to be practical for clinical use, and the translatability of intraperitoneal injections from mouse to humans is quite questionable (pg. 3, col. ). Additionally, Dai teaches that an enormous dose of vector would be required to reach anything close to the desired efficiency for intravenous injections (pg. 3 col. 1). Lastly, Dai teaches it remains unclear whether these delivery methods work effectively in humans given the huge difference in body size and the many other genetic and morphological differences between humans and rodents (pg. 3 col. 1), and Dai teaches immunogenicity of viral vectors also plays a role in the lack of predictability in delivering to a cell in vivo. (pg. 3).
Moreover, predictability of delivering to a cell the claimed components is still an issue since the art of Dai.
Off-target Effects
Applicant is directed to the art of Zhang (J Cell Physiol. 2021 Apr;236(4):2459-2481.). Zhang teaches significant challenges also remain before CRISPR/Cas technology can be routinely employed in the clinic for treating different genetic diseases, which include toxicity and immune response of treated cells to CRISPR/Cas component, highly throughput delivery method, and potential off‐target impact (abstract). Zhang teaches the off‐target effect is one of the major concerns for CRISPR/Cas9 gene therapy, more research should be focused on limiting this impact by designing high specific gRNAs and using high specificity of Cas enzymes. Modifying the CRISPR/Cas9 delivery method not only targets a specific tissue/cell but also potentially limits the off‐target impact (abstract).
In the instant case, SEQ ID NO 2 for instance binds to:
A. Polycomb-Associated Non-Coding RNAs and B. HUMAN KINASE PROTEINS
A. Sequence 625954, US/13921738
GENERAL INFORMATION
APPLICANT: Lee, et al.
TITLE OF INVENTION: Polycomb-Associated Non-Coding RNAs
FILE REFERENCE: 31947/46625
CURRENT APPLICATION NUMBER: US/13/921,738
CURRENT FILING DATE: 2013-06-19
PRIOR APPLICATION NUMBER: 61/425,174
PRIOR FILING DATE: 2010-12-20
PRIOR APPLICATION NUMBER: 61/512,754
PRIOR FILING DATE: 2011-11-12
PRIOR APPLICATION NUMBER: PCT/US2011/060493
PRIOR FILING DATE: 2011-11-12
NUMBER OF SEQ ID NOS: 936433
SEQ ID NO 625954
LENGTH: 99896
TYPE: DNA
ORGANISM: Homo sapiens
Query Match 100.0%; Score 20; Length 99896;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ATGTTCATTATGTTTTCTCT 20
||||||||||||||||||||
Db 26126 ATGTTCATTATGTTTTCTCT 26107
And to B:
US-60-500-337-19628
(NOTE: this sequence has 1 duplicate in the database searched.
See complete list at the end of this report)
Sequence 19628, US/60500337
GENERAL INFORMATION
APPLICANT: CARGILL, Michele
TITLE OF INVENTION: POLYMORPHISMS IN NUCLEIC ACID MOLECULES
TITLE OF INVENTION: ENCODING HUMAN KINASE PROTEINS, METHODS OF DETECTION AND
TITLE OF INVENTION: USES THEREOF
FILE REFERENCE: CL001483
CURRENT APPLICATION NUMBER: US/60/500,337
CURRENT FILING DATE: 2003-09-05
NUMBER OF SEQ ID NOS: 123188
SEQ ID NO 19628
LENGTH: 112483
TYPE: DNA
ORGANISM: Homo sapiens
Query Match 100.0%; Score 20; Length 112483;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ATGTTCATTATGTTTTCTCT 20
||||||||||||||||||||
Db 79781 ATGTTCATTATGTTTTCTCT 79800
The alignment of SEQ ID NO 2 with at least two different sequences as shown above indicates the possibility of off-target effects.
Variability between Cell Types
Chen et al., (Chen et al.,2021, Cell184, 5635–5652, IDS) teach ways of enhancing efficiency of prime editing (whole paper). Despite the taught methods, one can’t overcome the inherent differences between cell types that would impact single-base pair substitutions. See recitation from pg. 5645, first few lines:
HEK293T cells are partially MMR deficient due to hypermethylation of the MLH1 promoter (Trojan et al., 2002), which may explain higher prime editing efficiency observed in HEK293T cells compared to other mammalian cell types (Anzalone et al., 2019).
Post-filing art
The post-filing art of Bao (Bao, Cells 2026, 15, 156) teaches CRISPR/Cas systems have transformed molecular medicine, yet the field still lacks principled guidance on when transient editing suffices versus when sustained exposure through in vivo viral delivery is necessary and how to keep prolonged exposure safe (first line of abstract).
Thus the art before the effective filing date and to date of the claimed invention teaches methods of administering CRISPR-Cas components to a cell were highly unpredictable, with challenges of a lack a specificity, adverse immune responses with the nucleases and cleavage agents, as well as questionable translatability of rat in vivo results to other mammal for specific results, such as therapeutic effects or providing a predictable amount of such a composition to get the intended result. Further, the post-filing art of Bao described above demonstrates that these unpredictability and hurdles to in vivo embodiment persist from the prior to the time of effective filing and post-filing.
AMOUNT OF EXPERIMENTATION
As the arts demonstrates, the obstacles that hinder the use of the claimed method in in vivo embodiments are not easy tasks to be done or solely routine experimentation to enabled particular embodiments of the claimed method. The type of experimentation would require new methodologies. This level of experimentation goes beyond what would be routine optimization know at the time of filing. As such, the amount of experimentation would be undue.
PREDICTABILITY IN THE ART
The physiological art is recognized as unpredictable (MPEP 2164.03). As set forth in In re Fisher, 166 USPQ 18 (CCPA 1970), compliance with 35 USC 112(a) requires: “That scope of claims must bear a reasonable correlation to scope of enablement provided by specification to persons of ordinary skill in the art; in cases involving predictable factors, such as mechanical or electrical elements, a single embodiment provides broad enablement in the sense that, once imagined, other embodiments can be made without difficulty and their performance characteristics predicted by resort to known scientific laws; in cases involving unpredictable factors, such as most chemical reactions and physiological activity, scope of enablement varies inversely with degree of unpredictability of factors involved.” Moreover, the courts have also stated that reasonable correlation must exist between scope of exclusive right to patent application and scope of enablement set forth in the patent application (27 USPQ2d 1662 Ex parte Maize!.). In view of the foregoing, due to the lack of sufficient guidance provided by the specification regarding the issues set forth above, the state of the relevant art, and the breadth of the claims, it would have required undue experimentation for one skilled in the art to practice the instant broadly claimed invention.
Dependent claims, 2, 4, 5, 7, 9, 10, and 13 are also rejected because they depend on Claim 1 and do not remedy the issues of lack of written description as discussed above.
CONCLUSION of Scope of Enablement
In conclusion, the breadth of the claims lack enablement because the specification provides no working examples of in vitro and in vivo embodiments. The art at the time of effective filing fail to provide specific guidance that supplement the shortcomings of the specification and further teaches that the breadth of claims cannot predictably be performed. Further, a great deal of new methodology would need to be developed to enable the full breadth of the claims and this level of experimentation is undue.
Examiner Suggestion: Limit the claims to a cell, as there is adequate written description support in the disclosure and prior art for such a limitation.
Allowable Subject Matter
Applicants own art cited in IDS is the closest prior art: YU et al., "Abstract 13074: hypoxia-driven long noncoding RNA KMT2E-AS1 modulates histone methylation to control endothelial metabolic reprogramming and pulmonary hypertension (PH)", Circulation, 2019, 6 pages, vol. 140. The abstract describes KMT2E-AS1 serves as a master epigenetic regulator of endothelial metabolic reprogramming in hypoxia with conserved activity in rodents and humans thus implying a long non-coding RNA (KMT2E-AS1) as a crucial epigenetic and metabolic regulator of PH, potentially acting as a novel therapeutic target.
Neither this art nor any other prior art discloses an association between rs73184087 and KMT2E-AS1 expression and further that this SNV is a target that is amenable to therapy.
Other pertinent art that evidences significant support for chromatin remodeling via histone methyltransferases in PAH:
The post-filing art of Awada (Awada, Bourgeois, Lemay, et al.: G9a/GLP in Pulmonary Hypertension, American Journal of Respiratory Cell and Molecular Biology Volume 68 Number 5 | May 2023) teaches another histone methyltransferase called G9a/GLP, is upregulated in human pulmonary arterial hypertension (PAH) and experimental animal models (Fig. 1). Targeting this enzyme with a consequential decrease in H3K9me2 ameliorates pulmonary vascular remodeling in Pulmonary Arterial Hypertension (Fig. 2).
The prior art of Batie (BATIE et al., "Hypoxia induces rapid changes to histone methylation and reprograms chromatin", Science, 2019, pp.1222-1226, vol. 363.IDS 11/06/2023) evidences histone methylation changes with respect to hypoxia; i.e., increases in H3K4me3 in response to hypoxia (Fig. 1D). Knockdown of a histone demethylase called KDM5A (and family members) mimics this hypoxic increase (Fig. 3).
Conclusion
No claims are allowed.
Correspondence
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
SHABANA S. MEYERING, Ph.D.
Examiner
Art Unit 1635
/SHABANA S MEYERING/Examiner, Art Unit 1635
/CATHERINE KONOPKA/Primary Examiner, Art Unit 1635