DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Applicant’s election without traverse of rhabdosarcoma, siRNA, SEQ ID NO: 86, alkylating agent, and temozolomide, in the reply filed on 11/21/25 is acknowledged.
Claims 6-9, 12-14, and 16-18 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 11/21/25.
Since rhabdomyosarcoma, the elected species, is free of the prior art, glioblastoma, the next listed species, has been examined.
Drawings
The drawings filed on 5/8/26 are objected to for the following reasons:
37 C.F.R. 1.84 states “Character of lines, numbers, and letters. All drawings must be made by a process which will give them satisfactory reproduction characteristics. Every line, number, and letter must be durable, clean, black (except for color drawings), sufficiently dense and dark, and uniformly thick and well-defined.”
In the current case, the Figures are not fully legible and comprise fuzzy figures and words.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Improper Markush Rejection
Claims 1, 10, 15, 20, and 21 are rejected on the judicially-created basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). The improper Markush grouping includes species of the claimed invention that do not share both a substantial structural feature and a common use that flows from the substantial structural feature. The members of the improper Markush grouping do not share a substantial feature and/or a common use that flows from the substantial structural feature for the following reasons: each sequence has a different order of nucleotides and no common searchable core. Each sequence has a different activity that is dependent upon the specific order of nucleotides. One cannot be substituted for another with expectation of identical activity.
As set forth in MPEP2117, “Note that where a Markush group includes only materials from a recognized scientific class of equivalent materials or from an art-recognized class, "the mere existence of such a group in an application tend[s] to prove the equivalence of its members and when one of them [is] anticipated the group [is] therefore rendered unpatentable, in the absence of some convincing evidence of some degree of non-equivalency of one or more of the remaining members." In re Ruff, 256 F.2d 590, 598-99, 118 USPQ 340, 348 (CCPA 1958)("[A]ctual equivalence is not enough to justify refusal of a patent on one member of a group when another member is in the prior art. The equivalence must be disclosed in the prior art or be obvious within the terms of Section 103." Id. at 599, 118 USPQ at 348).”
In the instant case, art against any one siRNA would not be evidence against any of the remaining members that have completely different sequences and do not have identical activity.
For example, in Ex Parte CHETTIER (Appeal 2016-003639), the Board affirmed an improper Markush grouping of various sequences because: “The sequences shown in Table 1 do not share any common sequence, and therefore do not share a common structure. For example, the first two sequences shown in Table 1 are ggtgattctgaagacc[A/G]ctgctatatgtcatct and taaaggatgggaactg[A/C]aactagaagaccgtca. (Spec. 57.4) Although both sequences, like all DNA sequences, are made up of the same four bases, they do not share any significant similarity in the order in which those bases are arranged. Thus, the structures of the DNA molecules represented by the sequences are different. We therefore agree with the Examiner that the 133 DNA sequences shown in the Specification’s Table 1 do not make up a proper Markush group.” (page 4).
Also see MPEP 806.04 Genus and/or Species Inventions [R-08.2012]
Where an application includes claims directed to different embodiments or species that could fall within the scope of a generic claim, restriction between the species may be proper if the species are independent or distinct. However, 37 CFR 1.141 provides that an allowable generic claim may link a reasonable number of species embraced thereby. The practice is set forth in 37 CFR 1.146.
37 C.F.R. 1.146 Election of species.
In the first action on an application containing a generic claim to a generic invention (genus) and claims to more than one patentably distinct species embraced thereby, the examiner may require the applicant in the reply to that action to elect a species of his or her invention to which his or her claim will be restricted if no claim to the genus is found to be allowable. However, if such application contains claims directed to more than a reasonable number of species, the examiner may require restriction of the claims to not more than a reasonable number of species before taking further action in the application.
See MPEP § 806.04(d) for the definition of a generic claim, and MPEP § 806.04(e) for a discussion of claims that include one or more species.
Claims 5 and 22 are not included because they are directed to a reasonable number of species.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 5, 10, and 15, are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for treating rhabdomyosarcoma via contacting the target cell with the siRNA of the specification that has a strand that is fully complementary to a specific AVIL target sequence and the complement thereof (SEQ ID NOs: 1 and 2), does not reasonably provide enablement for a method for treating any of the instantly recited types of brain cancers or cancerous tumors via delivery of the instantly recited siRNAs targeting AVIL. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims.
Factors to be considered in a determination of lack of enablement include, but are not limited to:
(A) The breadth of the claims;
(B) The nature of the invention;
(C) The state of the prior art;
(D) The level of one of ordinary skill;
(E) The level of predictability in the art;
(F) The amount of direction provided by the inventor;
(G) The existence of working examples; and
(H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure.
In re Wands, 858 F.2d 731, 737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988)
The claims are directed to a method for treating any brain cancer or cancerous tumor, wherein the brain cancer or cancerous tumor is any glioblastoma, rhabdomyosarcoma, glioma, lung cancer bladder cancer, urothelial carcinoma, or renal cancer via delivery of the instantly recited siRNAs targeting AVIL.
However, the specification does not draw an adequate nexus between inhibition of AVIL alone and the predictable outcome of treating any of the instantly recited brain cancers or cancerous tumors, each having different etiologic considerations. Not all possible brain cancers or cancerous tumors have been shown to be reliant upon AVIL expression alone.
For example, Axelsen et al. (PNAS, 2007, 104, 32, 13122-13127) teach that different gene expression profiles are present in different brain cancers (abstract).
The specification demonstrates that overexpressing AVIL alone in MSC cells was sufficient to transform the cells to tumor masses (page 60).The specification discloses that the AVIL locus was frequently amplified in sarcoma cell lines and therefore AVIL activation may be a general oncogenic pathway in sarcomas (page 61).
The specification discloses that transfection of rhabdosarcoma cells (subpopulation that were selected that overexpress AVIL) with a specific AVIL siRNA (SEQ ID NOs: 1 and 2) (page 63); as well as subcutaneous injection of RH30 or RD cells transfected with shRNA targeted to AVIL into mice to form tumors with a resultant smaller or no tumor (page 66).
The treatment of rhabdomyosarcoma with a specific siRNA, wherein the specific siRNA has shown to result in effective inhibition is not commensurate in scope with the treatment of any of the instantly recited brain cancers or cancerous tumors, which encompasses an enormous possible genus of diseases that have not been shown to be reliant upon the expression of AVIL alone.
The specification does not draw an adequate nexus between delivery of any of the instantly recited siRNAs targeting AVIL and the predictable outcome of treating any of the instantly recited brain cancers or cancerous tumors, which encompasses an enormous genus of diseases that have not been shown to be reliant upon AVIL expression alone.
The specification does not draw an adequate nexus between any level of inhibition of AVIL and the predictable outcome of treating any possible disease within the instantly recited genus.
The scope of the claims in view of the specification as filed together do not reconcile the unpredictability in the art to enable one of skill in the art to make and/or use the claimed invention, namely a broad method of treating any brain cancer or cancerous tumor of the instantly recited genus via inhibition of AVIL alone encompassing in vivo effects.
MPEP 2164.01
Any analysis of whether a particular claim is supported by the disclosure in an application requires a determination of whether that disclosure, when filed, contained sufficient information regarding the subject matter of the claims as to enable one skilled in the pertinent art to make and use the claimed invention.
Also, MPEP 2164.01(a)
A conclusion of lack of enablement means that, based on the evidence regarding each of the above factors, the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed invention without undue experimentation. In re Wright, 999 F.2d 1557,1562, 27 USPQ2d 1510, 1513 (Fed. Cir. 1993).
Given the teachings of the specification as discussed above, one skilled in the art could not predict a priori whether inhibition of AVIL in vivo would result in successful treatment of any possible brain cancer or cancerous tumor. To practice the claimed invention, one of skill in the art would have to de novo determine; the stability of the molecule in vivo, delivery of the molecule to the whole organism, specificity to the target tissue in vivo, dosage and toxicity in vivo, and entry of the molecule into the cell in vivo and the effective action therein. Without further guidance, one of skill in the art would have to practice a substantial amount of trial and error experimentation, an amount considered undue and not routine, to practice the instantly claimed invention.
A conclusion of lack of enablement means that, based on the evidence regarding each of the above factors, the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed invention without undue experimentation (see MPEP 2164.01(a)).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 1, 5, 10, 15, and 22 is/are rejected under 35 U.S.C. 103 as being unpatentable over Crespo et al. (PLOS ONE, 2012, 7, 9, e46088, 1-11), in view of
Astsaturov et al. (WO 2009/062199 A1), Naito et al. (US 2008/0113351 A1), and Messaoudi et al. (Drug Discovery Today, 20, 6, 2015, 772-779).
The references are considered as enabled as the instant specification.
Crespo et al. teach that Glioblastoma multiforme (GBM) displays multiple amplicons and homozygous deletions that involve relevant pathogenic genes (abstract). Crespo et al. teach: Recurrently amplified segments for chromosome 12 ranged from 44 Mb to 1,479 Mb and they included distinct segments localized at 12q including up to 41 different genes (Supplementary Table S3). Among other, these included the CYP27B1, METTL1, FAM119B, TSFM and AVIL genes at chromosome 12q14.1 in 8/ 46 patients (17%), and the CDK4 and AGAP2 genes in 7 GBM (15%) (page 5).
Crespo et al. teach: However, from all these genes listed in table 2, only AVIL, FAM119B, METTL1, CYP27B1 and TSFM were systematically amplified in tumors displaying 12q amplicons (page 7).
Crespo et al. teach: From these genes, special attention should be paid to the AVIL and CYP27B1 genes. AVIL encodes for advillin, a member of the gelsolin/villin family of actin regulatory proteins which is almost exclusively expressed by peripheral sensory neurons, and that has been recently identified as a new candidate driver gene in GBM (page 7).
Since Crespo et al. teach that AVIL is a new candidate driver gene in GBM and that it was systematically amplified in tumors displaying 12q amplicons, it would have been obvious to inhibit AVIL to treat glioblastoma.
It would have been obvious to inhibit AVIL with any known gene inhibition technology as a matter of design choice.
However, it was known to design siRNAs targeting AVIL, as evidenced by Astsaturov et al. (see page 73, Table 3, AVIL siRNA sense sequence CTGGACCAAAGTGGAACCAAA). Astsaturov et al. teach delivery of the siRNA to cancer cells and screening for cell viability (claims 1-5). Since it was known to design siRNAs for inhibition of AVIL, this would have been an obvious choice for the method of inhibiting AVIL to treat GBM with a reasonable expectation of success.
Naito et al. teach a siRNA targeting AVIL wherein the sense strand is 19 nucleotides in length and consists of nucleotides 3-21 of instant SEQ ID NO: 15 (target region 765-783 of NM_006576.2) (instant claim 5). See the sequence search file titled “us-18-306-680-15.szlim50.rnpbm”, result #5, as follows:
RESULT 5
US-11-598-052B-114836
Sequence 114836, US/11598052B
Publication No. US20080113351A1
GENERAL INFORMATION
APPLICANT: RNAi Co., Ltd.
APPLICANT: NAITO, Yuki
APPLICANT: FUJINO, Masato
APPLICANT: OGUCHI, Shinobu
APPLICANT: NATORI, Yukikazu
TITLE OF INVENTION: POLYNUCLEOTIDES FOR CAUSING RNA INTERFERENCE AND METHOD FOR INHIBITING GENE EXPRESSION USING THE
TITLE OF INVENTION: SAME
FILE REFERENCE: 0230-0243PUS1
CURRENT APPLICATION NUMBER: US/11/598,052B
CURRENT FILING DATE: 2006-11-13
PRIOR APPLICATION NUMBER: PCT/IB2005/00164
PRIOR FILING DATE: 2005-05-11
PRIOR APPLICATION NUMBER: JP 2004-232811
PRIOR FILING DATE: 2004-05-11
NUMBER OF SEQ ID NOS: 817670
SEQ ID NO 114836
LENGTH: 19
TYPE: DNA
ORGANISM: Homo sapiens
FEATURE:
OTHER INFORMATION: siRNA target sequence for AVIL (NM_006576.2,765-783).
Query Match 86.4%; Score 19; Length 19;
Best Local Similarity 100.0%;
Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 3 CAGAAATCAACTATCATGT 21
Db 1 CAGAAATCAACTATCATGT 19
Naito et al. teach a siRNA targeting AVIL wherein the sense strand is 19 nucleotides in length and consists of nucleotides 3-21 of instant SEQ ID NO: 18 (target region 779-797 of NM_006576.2) (instant claim 5). See the sequence search file titled “us-18-306-680-18.szlim50.rnpbm”, result #2, as follows:
RESULT 2
US-11-598-052B-114837
Sequence 114837, US/11598052B
Publication No. US20080113351A1
GENERAL INFORMATION
APPLICANT: RNAi Co., Ltd.
APPLICANT: NAITO, Yuki
APPLICANT: FUJINO, Masato
APPLICANT: OGUCHI, Shinobu
APPLICANT: NATORI, Yukikazu
TITLE OF INVENTION: POLYNUCLEOTIDES FOR CAUSING RNA INTERFERENCE AND METHOD FOR INHIBITING GENE EXPRESSION USING THE SAME
FILE REFERENCE: 0230-0243PUS1
CURRENT APPLICATION NUMBER: US/11/598,052B
CURRENT FILING DATE: 2006-11-13
PRIOR APPLICATION NUMBER: PCT/IB2005/00164
PRIOR FILING DATE: 2005-05-11
PRIOR APPLICATION NUMBER: JP 2004-232811
PRIOR FILING DATE: 2004-05-11
NUMBER OF SEQ ID NOS: 817670
SEQ ID NO 114837
LENGTH: 19
TYPE: DNA
ORGANISM: Homo sapiens
OTHER INFORMATION: siRNA target sequence for AVIL (NM_006576.2,779-797).
Query Match 82.6%; Score 19; Length 19;
Best Local Similarity 100.0%;
Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 3 CATGTTGTATCATATCTCA 21
Db 1 CATGTTGTATCATATCTCA 19
Naito et al. teach a siRNA targeting AVIL wherein the sense strand is 19 nucleotides in length and consists of nucleotides 3-21 of instant SEQ ID NO: 21 (target region 1109-1127 of NM_006576.2) (instant claim 5). See the sequence search file titled “us-18-306-680-21.szlim50.rnpbm”, result #2.
Naito et al. teach a siRNA targeting AVIL wherein the sense strand is 19 nucleotides in length and consists of nucleotides 3-21 of instant SEQ ID NO: 29 (target region 1575-1593 of NM_006576.2) (instant claim 5). See the sequence search file titled “us-18-306-680-29.szlim50.rnpbm”, result #2.
Naito et al. teach a siRNA targeting AVIL wherein the sense strand is 19 nucleotides in length and consists of nucleotides 1-19 of instant SEQ ID NO: 86 (target region 593-611 of NM_006576.2) (instant claim 5). See the sequence search file titled “us-18-306-680-86.szlim50.rnpbm”, result #1 (instant claim 22).
Naito et al. teach a siRNA targeting AVIL wherein the sense strand is 19 nucleotides in length and consists of nucleotides 1-19 of instant SEQ ID NO: 116 (target region 593-611 of NM_006576.2) (instant claim 5). See the sequence search file titled “us-18-306-680-116.szlim50.rnpbm”, result #1.
Naito et al. teach: [0080] Depending on the conditions, for example the species of an organism, in cases of siRNA having an excessively large number of bases, cytotoxicity is known to occur. The upper limit of the number of bases varies depending on the species of organism to which RNA interference is desired to be caused. The number of bases of the single strand constituting siRNA is preferably 30 or less regardless of the species. Furthermore, in mammals, the number of bases is preferably 24 or less, and more preferably 22 or less. The lower limit, which is not particularly limited as long as RNA interference is caused, is preferably at least 15, more preferably at least 18, and still more preferably at least 20. With respect to the number of bases as a single strand constituting siRNA, searching with a number of 21 is particularly preferable.
Given that some of the instant siRNA sequences recited are 23 nucleotides in length, it would have been obvious to extend the 19-mers of Naito et al. to 23 nucleotides as a matter of design choice because this length is in the routine size range for siRNAs, as evidenced by Naito et al. The resulting siRNA would be identical to the instant sequences and the complement thereof.
When selecting a silencing oligonucleotide that reduces the expression of AVIL, one would have selected the siRNA of Astsaturov et al. or the siRNAs of Naito et al. as a matter of design choice given that it was a known inhibitor of the same target (instant claims 1 and 5).
Crespo et al. does not teach the additional delivery of temozolomide.
Messaoudi et al. teaches that RNAi is a promising way to sensitize glioblastomas to temozolomide (title). Messaoudi et al. teaches that RNA interference (RNAi) is a strategy of gene regulation that has opened up many opportunities for the treatment of cancers, especially glioblastoma multiforme (GBM). This strategy reduced the expression of many proteins involved in the resistance of these tumors to anticancer drugs, particularly to temozolomide (TMZ) (abstract). Temozolomide is a routine chemotherapeutic. It would have been obvious to deliver temozolomide in combination with the siRNA for the treatment of the cancer with an expectation that the siRNA would inhibit the target, AVIL, that is overexpressed in the cancer, and that temozolomide would serve as a chemotherapeutic. Additionally, it was known that RNAi is a promising opportunity to sensitive the cells to the chemotherapeutic, as evidenced by Messaoudi et al. (instant claims 10 and 15).
Response to Arguments
The Su et al. reference is no longer cited because the claims do not read upon neuroblastoma. It is noted that each of the genes taught by Su et al. is considered to be equally obvious and the specific teachings of Su et al. regarding AVIL would result in motivation to inhibit AVIL in neuroblastoma.
Contrary to applicant’s arguments, the primary reference is not required to mention "inhibit" or "siRNA," but is rather required to offer some teaching that would result in a motivation for one to desire to inhibit the target. Selection of inhibitors that were known to be used for the same target is considered obvious. One is not required to arrive at siRNA over another silencing technology. Any known AVIL inhibitor is considered to be an obvious selection.
Applicant argues that regarding Naito, Naito does not appear to mention "cancer" or "sarcoma." Naito is not relied upon for teaching cancer or sarcoma, but is rather relied upon for teaching that siRNAs within the instant genus were known AVIL inhibitors. Although applicant argues that Naito et al. is silent as to “AVIL”, the sequences are taught as “siRNA target sequence for AVIL”.
Substituting a sequence for a completely different siRNA sequence is not the same as extending a specific siRNA sequence within the known size range of siRNAs. Naito et al. teaches some sequences that are identical to the instantly recited sequences (i.e. SEQ ID NO: 86) and other 19-mers that would be identical to instant sequences if extended to 23-mers.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Amy R Hudson whose telephone number is (571)272-0755. The examiner can normally be reached M-F 8:00am-6:00pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AMY ROSE HUDSON/Primary Examiner, Art Unit 1636