Prosecution Insights
Last updated: April 19, 2026
Application No. 18/306,680

THERAPEUTIC TARGETING OF ACTIVATED AVIL-INDUCED SARCOMAS

Non-Final OA §103§112
Filed
Apr 25, 2023
Examiner
HUDSON, AMY ROSE
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
UNIVERSITY OF VIRGINIA PATENT FOUNDATION
OA Round
1 (Non-Final)
75%
Grant Probability
Favorable
1-2
OA Rounds
2y 7m
To Grant
86%
With Interview

Examiner Intelligence

Grants 75% — above average
75%
Career Allow Rate
1076 granted / 1432 resolved
+15.1% vs TC avg
Moderate +11% lift
Without
With
+11.3%
Interview Lift
resolved cases with interview
Typical timeline
2y 7m
Avg Prosecution
60 currently pending
Career history
1492
Total Applications
across all art units

Statute-Specific Performance

§101
3.0%
-37.0% vs TC avg
§103
33.6%
-6.4% vs TC avg
§102
14.5%
-25.5% vs TC avg
§112
33.2%
-6.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1432 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicant’s election without traverse of rhabdosarcoma, siRNA, SEQ ID NO: 86, alkylating agent, and temozolomide, in the reply filed on 11/21/25 is acknowledged. Claims 6-9, 12-14, 16, and 17 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 11/21/25. Drawings Color photographs and color drawings are not accepted in utility applications unless a petition filed under 37 CFR 1.84(a)(2) is granted. Any such petition must be accompanied by the appropriate fee set forth in 37 CFR 1.17(h), one set of color drawings or color photographs, as appropriate, if submitted via the USPTO patent electronic filing system or three sets of color drawings or color photographs, as appropriate, if not submitted via the via USPTO patent electronic filing system, and, unless already present, an amendment to include the following language as the first paragraph of the brief description of the drawings section of the specification: The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. Color photographs will be accepted if the conditions for accepting color drawings and black and white photographs have been satisfied. See 37 CFR 1.84(b)(2). Claim Objections Claims 3 and 19 are objected to because of the following informalities: The claims recite “rhabdosarcoma”, although the specification discloses only “rhabdomyosarcoma”, which appears to be consistent with the terminology of the art. Appropriate correction is required. Improper Markush Rejection Claims 4-9 are rejected on the judicially-created basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). The improper Markush grouping includes species of the claimed invention that do not share both a substantial structural feature and a common use that flows from the substantial structural feature. The members of the improper Markush grouping do not share a substantial feature and/or a common use that flows from the substantial structural feature for the following reasons: The claims recite the Markush group of a siRNA, shRNA, or sgRNA. Each are RNAs that must be able to hybridize to a nucleic acid sequence found in an AVIL gene (assuming that the agents are targeted to an AVIL gene-see Written Description rejection). The term “gRNA’ refers to an RNA that will bind to a Cas protein for the purpose of localizing that protein with a DNA or RNA target. In contrast, siRNAs do not bind to Cas proteins, but instead bind to Argonaute proteins and function to guide those proteins to targets. Accordingly, siRNAs and gRNAs do not have sufficiently similar structures to provide the same function because each has a structure that dictates that it must bind to a different protein effector molecule. shRNAs are engineered to form a stem-loop structure and requires an integrated or episomal vector and is produced endogenously within the cell rather than being delivered in its active form like siRNAs. Therefore, the members of the Markush group lack any common substantial structural feature that provides a common use, and the group of alternatives is an improper Markush group. In response to this rejection, Applicant should either amend the claim(s) to recite only individual species or grouping of species that share a substantial structural feature as well as a common use that flows from the substantial structural feature, or present a sufficient showing that the species recited in the alternative of the claims(s) in fact share a substantial structural feature as well as a common use that flows from the substantial structural feature. This is a rejection on the merits and may be appealed to the Board of Patent Appeals and Interferences in accordance with 35 U.S.C. 134 and 37 CFR 41.31(a)(1). With regards to the siRNA sequences of claim 5, each sequence has a different order of nucleotides and no common searchable core. Each sequence has a different activity that is dependent upon the specific order of nucleotides. One cannot be substituted for another with expectation of identical activity. As set forth in MPEP2117, “Note that where a Markush group includes only materials from a recognized scientific class of equivalent materials or from an art-recognized class, "the mere existence of such a group in an application tend[s] to prove the equivalence of its members and when one of them [is] anticipated the group [is] therefore rendered unpatentable, in the absence of some convincing evidence of some degree of non-equivalency of one or more of the remaining members." In re Ruff, 256 F.2d 590, 598-99, 118 USPQ 340, 348 (CCPA 1958)("[A]ctual equivalence is not enough to justify refusal of a patent on one member of a group when another member is in the prior art. The equivalence must be disclosed in the prior art or be obvious within the terms of Section 103." Id. at 599, 118 USPQ at 348).” In the instant case, art against any one siRNA would not be evidence against any of the remaining members that have completely different sequences and do not have identical activity. For example, in Ex Parte CHETTIER (Appeal 2016-003639), the Board affirmed an improper Markush grouping of various sequences because: “The sequences shown in Table 1 do not share any common sequence, and therefore do not share a common structure. For example, the first two sequences shown in Table 1 are ggtgattctgaagacc[A/G]ctgctatatgtcatct and taaaggatgggaactg[A/C]aactagaagaccgtca. (Spec. 57.4) Although both sequences, like all DNA sequences, are made up of the same four bases, they do not share any significant similarity in the order in which those bases are arranged. Thus, the structures of the DNA molecules represented by the sequences are different. We therefore agree with the Examiner that the 133 DNA sequences shown in the Specification’s Table 1 do not make up a proper Markush group.” (page 4). Also see MPEP 806.04 Genus and/or Species Inventions [R-08.2012] Where an application includes claims directed to different embodiments or species that could fall within the scope of a generic claim, restriction between the species may be proper if the species are independent or distinct. However, 37 CFR 1.141 provides that an allowable generic claim may link a reasonable number of species embraced thereby. The practice is set forth in 37 CFR 1.146. 37 C.F.R. 1.146 Election of species. In the first action on an application containing a generic claim to a generic invention (genus) and claims to more than one patentably distinct species embraced thereby, the examiner may require the applicant in the reply to that action to elect a species of his or her invention to which his or her claim will be restricted if no claim to the genus is found to be allowable. However, if such application contains claims directed to more than a reasonable number of species, the examiner may require restriction of the claims to not more than a reasonable number of species before taking further action in the application. See MPEP § 806.04(d) for the definition of a generic claim, and MPEP § 806.04(e) for a discussion of claims that include one or more species. The examiner has searched and examined 25 sequences, which is considered to be a reasonable number of species (SEQ ID NOs: 12-34,elected SEQ ID NO: 86, and SEQ ID NO: 116). Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1-5, 10, 11, 15, 18, and 19 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Instant claim 1 is directed to a method comprising contacting a cell with an effective amount of any “silencing oligonucleotide that reduces the expression” of any AVIL-encoding gene. At the outset, it is noted that the claims do not recite a specific AVIL nucleotide sequence by SEQ ID NO, but rather refer to the broad genus of AVIL sequences. The claims encompass a method of introducing any silencing oligonucleotide that reduces the expression of any AVIL sequence, as well as encompass any AVIL homolog or allele from any species known or yet to be discovered of AVIL, as well as DNA genomic fragments, spliced variants or fragment that retains AVIL -like activity. Although the specification discloses some silencing oligonucleotides (shRNAs, siRNAs, and sgRNAs) that have a strand that is fully complementary to a specific AVIL target sequence, the specification does not describe any other species of silencing oligonucleotides that have the structure to function be reducing the expression of any other AVIL sequence. The instant genus of silencing oligonucleotides is very large, including aptamers, triplexes, ribozymes, saRNAs, and miRNAs, for example. Without further description of the structure required for the function, one would not be able to readily envision which silencing oligonucleotides with what structural requirements would function as claimed. The instant silencing oligonucleotides are not required to have any specific structural relationship with any specific target sequence. The oligonucleotides encompass those targeted to other targets other than AVIL that have a secondary effect of reducing the expression of AVIL. Each of the instantly disclosed agents is targeted to a single sequence, although the claims are drawn to any silencing oligonucleotide that reduces the expression of any AVIL-encoding gene. The specification does not adequately describe the genus of AVIL-encoding gene sequences. The single species of the specification is not representative of the entire claimed genus. One of ordinary skill in the art could not make such agents to any AVIL without knowledge of the sequence and knowledge of the structure of the silencing oligonucleotide. With regards to instant claim 5, the siRNA is required to comprise one of the recited sequences, but has not sequence requirement for the second strand. The specification does not adequately describe the genus of siRNAs comprising any of the instantly recited sequences and any possible opposing strand. Additionally, claim 10 requires the addition of any agent known to treat cancer, which is a genus of agents that has not been adequately described in the specification. Without further knowledge of the structure required for the function, one would not be able to readily recognize which agents are known to treat cancer. The MPEP states that for a generic claim, the genus can be adequately described if the disclosure presents a sufficient number of representative species that encompass the genus. See MPEP § 2163. If the genus has a substantial variance, the disclosure must describe a sufficient variety of species to reflect the variation within that genus. See MPEP § 2163. Although the MPEP does not define what constitute a sufficient number of representative species, the courts have indicated what do not constitute a representative number of species to adequately describe a broad genus. In Gostelli, the courts determined that the disclosure of two chemical compounds within a subgenus did not describe that subgenus. In re Gostelli, 872, F.2d at 1012, 10 USPQ2d at 1618. Additionally, in Carnegie Mellon University v. Hoffman-La Roche Inc., Nos. 07-1266, -1267 (Fed. Cir. Sept. 8, 2008), the Federal Circuit affirmed that a claim to a genus described in functional terms was not supported by the specification’s disclosure of species that were not representative of the entire genus. Furthermore, for a broad generic claim, the specification must provide adequate written description to identify the genus of the claim. In Regents of the University of California v. Eli Lilly & Co. the court stated: "A written description of an invention involving a chemical genus, like a description of a chemical species, 'requires a precise definition, such as by structure, formula, [or] chemical name,' of the claimed subject matter sufficient to distinguish it from other materials." Fiers, 984 F.2d at 1171, 25 USPQ2d 1601; In re Smythe, 480 F.2d 1376, 1383, 178 USPQ 279, 284985 (CCPA 1973) ("In other cases, particularly but not necessarily, chemical cases, where there is unpredictability in performance of certain species or subcombinations other than those specifically enumerated, one skilled in the art may be found not to have been placed in possession of a genus ...") Regents of the University of California v. Eli Lilly & Co., 43 USPQ2d 1398. The Guidelines for Examination of Patent Applications under the 35 USC § 112, first paragraph, “Written Description” Requirement”, published at Federal Register, Vol. 66, No. 4, pp. 1099-1111 outline the method of analysis of claims to determine whether adequate written description is present. The first step is to determine what the claim as a whole covers, i.e., discussion of the full scope of the claim. Second, the application should be fully reviewed to understand how applicant provides support for the claimed invention including each element and/or step, i.e., compare the scope of the claim with the scope of the description. Third, determine whether the applicant was in possession of the claimed invention as a whole at the time of filing. With regards to the elected species of siRNAs, a single species of silencing oligonucleotides, Elbashir et al. (The EMBO Journal, Vol. 20, No. 23, pages 6877-6888, 2001) teaches that duplexes of 21-23 nt RNAs are the sequence specific mediators of RNAi and that even single mismatches between the siRNA duplex and the target mRNA abolish interference (abstract and page 6888). Therefore, the scope of the claimed invention is broad and the skilled artisan would not be able to envisage the entire genus claimed of silencing oligonucleotides that inhibit the expression of any AVIL-encoding gene such that the skilled artisan would recognize that the applicant was in possession of the claimed genus at the time of filing. Claims 1-5, 10, 11, 15, 18, and 19 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for treating rhabdomyosarcoma via contacting the target cell with the siRNA of the specification that has a strand that is fully complementary to a specific AVIL target sequence and the complement thereof (SEQ ID NOs: 1 and 2), does not reasonably provide enablement for a method for treating any possible cancer via delivery of any silencing oligonucleotide that reduces the expression of any AVIL-encoding gene. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims. Factors to be considered in a determination of lack of enablement include, but are not limited to: (A) The breadth of the claims; (B) The nature of the invention; (C) The state of the prior art; (D) The level of one of ordinary skill; (E) The level of predictability in the art; (F) The amount of direction provided by the inventor; (G) The existence of working examples; and (H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure. In re Wands, 858 F.2d 731, 737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988) The claims are directed to a method for treating any possible cancer, any possible brain cancer, or any possible cancerous tumor via delivery via any means of any silencing oligonucleotide that reduces the expression of any AVIL-encoding gene. The specification demonstrates that overexpressing AVIL alone in MSC cells was sufficient to transform the cells to tumor masses (page 60).The specification discloses that the AVIL locus was frequently amplified in sarcoma cell lines and therefore AVIL activation may be a general oncogenic pathway in sarcomas (page 61). The specification discloses that transfection of rhabdosarcoma cells (subpopulation that were selected that overexpress AVIL) with a specific AVIL siRNA (SEQ ID NOs: 1 and 2) (page 63); as well as subcutaneous injection of RH30 or RD cells transfected with shRNA targeted to AVIL into mice to form tumors with a resultant smaller or no tumor (page 66). The treatment of rhabdomyosarcoma with siRNAs that have a strand that is fully complementary to a specific AVIL target and the complementary sequence thereof, wherein the specific siRNA has shown to result in effective inhibition is not commensurate in scope with any silencing oligonucleotide directed to any target sequence that has the secondary effect of reducing the expression of any AVIL-encoding gene by any level; and is not commensurate in scope with the treatment of any possible cancer, any possible brain cancer, or any possible cancerous tumor, which encompasses an enormous possible genus of diseases that have not been shown to be reliant upon the expression of AVIL alone. Instant claim 15 is directed to the delivery of specific alkylating agents or of any pharmaceutically acceptable salt. Certainly not any pharmaceutically acceptable salt would function as an alkylating agent as claimed. The specification does not draw an adequate nexus between delivery of any possible silencing oligonucleotide of any structure that reduces the expression of any AVIL-encoding gene and the predictable outcome of treating possible cancer, any possible brain cancer, or any possible cancerous tumor, which encompasses an enormous genus of diseases that have not been shown to be reliant upon AVIL expression alone. The specification does not draw an adequate nexus between any level of inhibition of AVIL and the predictable outcome of treating any possible disease within the instantly recited genus. Additionally, there is no guidance in the specification as filed that teaches how to deliver the instantly recited genus of inhibitors, each having different delivery challenges, and predictably treat possible cancer, any possible brain cancer, or any possible cancerous tumor in vivo. With regards to siRNAs, a single species of the instant silencing oligonucleotides, the instant siRNAs are not required to have any specific structural relationship with any specific target sequence. The siRNAs of the specification that resulted in treatment of rhabdomyosarcoma are targeted to a specific region of a specific AVIL target sequence. However, the instant claims not only encompass targeting any target that has the secondary effect of inhibiting AVIL, but also encompasses siRNAs targeted to any possible region of any AVIL sequence. It is known in the siRNA field that not any siRNA to any target sequence will result in inhibitory effect. Even from those that are inhibitory to AVIL, not all of this pool would predictably result in treatment effects in vivo. Activity in vitro is not predictable of the in vivo therapeutic effect in the in vivo complex environment. For example, Elbashir et al. (The EMBO Journal, Vol. 20, No. 23, pages 6877-6888, 2001) teaches that duplexes of 21-23 nt RNAs are the sequence specific mediators of RNAi and that even single mismatches between the siRNA duplex and the target mRNA abolish interference (abstract and page 6888). Friedrich et al. (BioDrugs (2022) 36:549–571) teach that still, the development of siRNA therapeutics faces several challenges and issues, including the definition of optimal siRNAs in terms of target, sequence, and chemical modifications, siRNA delivery to its intended site of action, and the absence of unspecific off-target effects (Abstract). Friedrich et al. teach that the use of short siRNA is preferred because longer siRNAs can provoke an inflammatory antiviral immune response (page 551). Friedrich et al. teach: As a basic parameter, the GC content of an siRNA is addressed by algorithms and its range should be between ~30 and 60%. Too low GC content can lead to weak or unspecific binding, whereas too high GC content may impede unwinding by helicase and incorporation in the RISC complex. Between nucleotides 9 and 14, however, low GC content is important to increase RISC function during mRNA cleavage. Sequences that could lead to secondary structures in the sense or antisense stand must be avoided (e.g., internal repeats, palindromes, CCC or GGG sequences). A proper duplex formation is essential for functional siRNA. Additionally, sequences that contain single nucleotide polymorphisms, miRNA seed matches, and known toxic motifs must be avoided (page 552). Friedrich et al. teach: The 5′-untranslated region (and 3′-untranslated region) of mRNA as well as sequences close to the start codon are not recommended as siRNA targets, as the binding of regulatory proteins in this area may impede RISC binding and thus the silencing effect. Rather, selecting regions in the open reading frame about 50–100 nucleotides downstream of the start codon is recommended. Furthermore, siRNAs closer to the start codon seem to be more efficient than those further downstream (page 552). Friedrich et al. is evidence as to the delivery challenges, as well as the fact that not any siRNA inhibitor of a target would result in the desired therapeutic effect. As outlined above, it is well known that there is a high level of unpredictability in the siRNA art (a single species of the instant silencing oligonucleotides) for therapeutic in vivo applications and design. The scope of the claims in view of the specification as filed together do not reconcile the unpredictability in the art to enable one of skill in the art to make and/or use the claimed invention, namely a broad method of treating any cancer, any brain cancer, or any cancerous tumor via delivery of a broad genus of agents that act via different mechanisms and have different levels of activity encompassing in vivo effects. MPEP 2164.01 Any analysis of whether a particular claim is supported by the disclosure in an application requires a determination of whether that disclosure, when filed, contained sufficient information regarding the subject matter of the claims as to enable one skilled in the pertinent art to make and use the claimed invention. Also, MPEP 2164.01(a) A conclusion of lack of enablement means that, based on the evidence regarding each of the above factors, the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed invention without undue experimentation. In re Wright, 999 F.2d 1557,1562, 27 USPQ2d 1510, 1513 (Fed. Cir. 1993). Given the teachings of the specification as discussed above, one skilled in the art could not predict a priori whether introduction of any silencing oligonucleotide that reduces the expression of any AVIL-encoding gene in vivo by the broadly disclosed methodologies of the instantly claimed invention, would result in successful treatment of any possible cancer, any brain cancer, or any cancerous tumor. To practice the claimed invention, one of skill in the art would have to de novo determine; the stability of the molecule in vivo, delivery of the molecule to the whole organism, specificity to the target tissue in vivo, dosage and toxicity in vivo, and entry of the molecule into the cell in vivo and the effective action therein. Without further guidance, one of skill in the art would have to practice a substantial amount of trial and error experimentation, an amount considered undue and not routine, to practice the instantly claimed invention. A conclusion of lack of enablement means that, based on the evidence regarding each of the above factors, the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed invention without undue experimentation (see MPEP 2164.01(a)). Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 1-5, 10, 11, 15, 18, and 19 is/are rejected under 35 U.S.C. 103 as being unpatentable over Su et al. (Cancer Genetics and Cytogenetics 154 (2004) 131–137), in view of Astsaturov et al. (WO 2009/062199 A1), Naito et al. (US 2008/0113351 A1), Barr et al. (Genes, Chromosomes, and Cancer, 48, 8, 2009, 661-672), and Messaoudi et al. (Drug Discovery Today, 20, 6, 2015, 772-779). The references are considered as enabled as the instant specification. Su et al. teach: AVIL is overexpressed in the 12q13-q15 amplicon (Table 1). Su et al. teach that AVIL is overexpressed in a variety of carcinomas and sarcomas. To our knowledge, this is the first description of AVIL overexpression in neuroblastoma. Its role in neurogenesis makes AVIL an interesting candidate oncogene in neuroblastoma (page 136). Therefore, Su et al. offers motivation to inhibit AVIL in a variety of carcinomas, sarcomas, and neuroblastoma. Su et al. does not teach delivery of a silencing oligonucleotide that reduces the expression of the AVIL-encoding gene. However, it was known to design siRNAs targeting AVIL, as evidenced by Astsaturov et al. (see page 73, Table 3, AVIL siRNA sense sequence CTGGACCAAAGTGGAACCAAA). Astsaturov et al. teach delivery of the siRNA to cancer cells and screening for cell viability (claims 1-5). Naito et al. teach a siRNA targeting AVIL wherein the sense strand is 19 nucleotides in length and consists of nucleotides 3-21 of instant SEQ ID NO: 15 (target region 765-783 of NM_006576.2) (instant claim 5). See the sequence search file titled “us-18-306-680-15.szlim50.rnpbm”, result #5, as follows: RESULT 5 US-11-598-052B-114836 Sequence 114836, US/11598052B Publication No. US20080113351A1 GENERAL INFORMATION APPLICANT: RNAi Co., Ltd. APPLICANT: NAITO, Yuki APPLICANT: FUJINO, Masato APPLICANT: OGUCHI, Shinobu APPLICANT: NATORI, Yukikazu TITLE OF INVENTION: POLYNUCLEOTIDES FOR CAUSING RNA INTERFERENCE AND METHOD FOR INHIBITING GENE EXPRESSION USING THE TITLE OF INVENTION: SAME FILE REFERENCE: 0230-0243PUS1 CURRENT APPLICATION NUMBER: US/11/598,052B CURRENT FILING DATE: 2006-11-13 PRIOR APPLICATION NUMBER: PCT/IB2005/00164 PRIOR FILING DATE: 2005-05-11 PRIOR APPLICATION NUMBER: JP 2004-232811 PRIOR FILING DATE: 2004-05-11 NUMBER OF SEQ ID NOS: 817670 SEQ ID NO 114836 LENGTH: 19 TYPE: DNA ORGANISM: Homo sapiens FEATURE: OTHER INFORMATION: siRNA target sequence for AVIL (NM_006576.2,765-783). Query Match 86.4%; Score 19; Length 19; Best Local Similarity 100.0%; Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 3 CAGAAATCAACTATCATGT 21 Db 1 CAGAAATCAACTATCATGT 19 Naito et al. teach a siRNA targeting AVIL wherein the sense strand is 19 nucleotides in length and consists of nucleotides 3-21 of instant SEQ ID NO: 18 (target region 779-797 of NM_006576.2) (instant claim 5). See the sequence search file titled “us-18-306-680-18.szlim50.rnpbm”, result #2, as follows: RESULT 2 US-11-598-052B-114837 Sequence 114837, US/11598052B Publication No. US20080113351A1 GENERAL INFORMATION APPLICANT: RNAi Co., Ltd. APPLICANT: NAITO, Yuki APPLICANT: FUJINO, Masato APPLICANT: OGUCHI, Shinobu APPLICANT: NATORI, Yukikazu TITLE OF INVENTION: POLYNUCLEOTIDES FOR CAUSING RNA INTERFERENCE AND METHOD FOR INHIBITING GENE EXPRESSION USING THE SAME FILE REFERENCE: 0230-0243PUS1 CURRENT APPLICATION NUMBER: US/11/598,052B CURRENT FILING DATE: 2006-11-13 PRIOR APPLICATION NUMBER: PCT/IB2005/00164 PRIOR FILING DATE: 2005-05-11 PRIOR APPLICATION NUMBER: JP 2004-232811 PRIOR FILING DATE: 2004-05-11 NUMBER OF SEQ ID NOS: 817670 SEQ ID NO 114837 LENGTH: 19 TYPE: DNA ORGANISM: Homo sapiens OTHER INFORMATION: siRNA target sequence for AVIL (NM_006576.2,779-797). Query Match 82.6%; Score 19; Length 19; Best Local Similarity 100.0%; Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 3 CATGTTGTATCATATCTCA 21 Db 1 CATGTTGTATCATATCTCA 19 Naito et al. teach a siRNA targeting AVIL wherein the sense strand is 19 nucleotides in length and consists of nucleotides 3-21 of instant SEQ ID NO: 21 (target region 1109-1127 of NM_006576.2) (instant claim 5). See the sequence search file titled “us-18-306-680-21.szlim50.rnpbm”, result #2. Naito et al. teach a siRNA targeting AVIL wherein the sense strand is 19 nucleotides in length and consists of nucleotides 3-21 of instant SEQ ID NO: 29 (target region 1575-1593 of NM_006576.2) (instant claim 5). See the sequence search file titled “us-18-306-680-29.szlim50.rnpbm”, result #2. Naito et al. teach a siRNA targeting AVIL wherein the sense strand is 19 nucleotides in length and consists of nucleotides 1-19 of instant SEQ ID NO: 86 (target region 593-611 of NM_006576.2) (instant claim 5). See the sequence search file titled “us-18-306-680-86.szlim50.rnpbm”, result #1. Naito et al. teach a siRNA targeting AVIL wherein the sense strand is 19 nucleotides in length and consists of nucleotides 1-19 of instant SEQ ID NO: 116 (target region 593-611 of NM_006576.2) (instant claim 5). See the sequence search file titled “us-18-306-680-116.szlim50.rnpbm”, result #1. Naito et al. teach: [0080] Depending on the conditions, for example the species of an organism, in cases of siRNA having an excessively large number of bases, cytotoxicity is known to occur. The upper limit of the number of bases varies depending on the species of organism to which RNA interference is desired to be caused. The number of bases of the single strand constituting siRNA is preferably 30 or less regardless of the species. Furthermore, in mammals, the number of bases is preferably 24 or less, and more preferably 22 or less. The lower limit, which is not particularly limited as long as RNA interference is caused, is preferably at least 15, more preferably at least 18, and still more preferably at least 20. With respect to the number of bases as a single strand constituting siRNA, searching with a number of 21 is particularly preferable. Given that the instant siRNA sequences recited in instant claim 5 are 23 nucleotides in length, it would have been obvious to extend the 19-mers of Naito et al. to 23 nucleotides as a matter of design choice because this length is in the routine size range for siRNAs, as evidenced by Naito et al. The resulting siRNA would be identical to the instant sequences and the complement thereof (instant claim 5). When selecting a silencing oligonucleotide that reduces the expression of AVIL, one would have selected the siRNA of Astsaturov et al. or the siRNAs of Naito et al. as a matter of design choice given that it was a known inhibitor of the same target (instant claims 1, 2, and 4). Su et al. does not teach that the cancer is rhabdomyosarcoma. However, since Su et al. teach that AVIL is overexpressed in the 12q13-q15 amplicon and is overexpressed in a variety of carcinomas and sarcomas, it would have been obvious to treat rhabdomyosarcoma via inhibition of AVIL because rhabdomyosarcoma is known to have the 12q13-q14 amplicon, as evidenced by Barr et al. (instant claims 3 and 19). Barr et al. teach that analysis of the 12q13-q14 amplicon in glioblastoma on a cDNA array found evidence of amplification of a 0.18 Mb region including the B4GALNT1 through AVIL loci (page 670). Su et al. does not teach the additional delivery of temozolomide. Messaoudi et al. teaches that RNAi is a promising way to sensitize glioblastomas to temozolomide (title). Messaoudi et al. teaches that RNA interference (RNAi) is a strategy of gene regulation that has opened up many opportunities for the treatment of cancers, especially glioblastoma multiforme (GBM). This strategy reduced the expression of many proteins involved in the resistance of these tumors to anticancer drugs, particularly to temozolomide (TMZ) (abstract). Temozolomide is a routine chemotherapeutic. It would have been obvious to deliver temozolomide in combination with the siRNA for the treatment of the cancer with an expectation that the siRNA would inhibit the target, AVIL, that is overexpressed in the cancer, and that temozolomide would serve as a chemotherapeutic. Additionally, it was known that RNAi is a promising opportunity to sensitive the cells to the chemotherapeutic, as evidenced by Messaoudi et al. (instant claims 10, 11, 15, and 18). Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to Amy R Hudson whose telephone number is (571)272-0755. The examiner can normally be reached M-F 8:00am-6:00pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /AMY ROSE HUDSON/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Apr 25, 2023
Application Filed
Oct 15, 2025
Examiner Interview Summary
Oct 15, 2025
Applicant Interview (Telephonic)
Feb 05, 2026
Non-Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600969
EXPRESSION CONTROL USING A REGULATABLE INTRON
2y 5m to grant Granted Apr 14, 2026
Patent 12595479
ANTISENSE OLIGONUCLEOTIDE-BASED PROGRANULIN AUGMENTATION THERAPY IN NEURODEGENERATIVE DISEASES
2y 5m to grant Granted Apr 07, 2026
Patent 12595483
TREATMENT OF TUMORS WITH MIRNA TARGETING CDK4/CDK6
2y 5m to grant Granted Apr 07, 2026
Patent 12589133
METHODS OF DOWNREGULATING CCL20 GENES FOR TREATMENT OF TRAUMATIC BRAIN INJURIES
2y 5m to grant Granted Mar 31, 2026
Patent 12584132
NUCLEIC ACID DRUG TARGETING MURF1
2y 5m to grant Granted Mar 24, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
75%
Grant Probability
86%
With Interview (+11.3%)
2y 7m
Median Time to Grant
Low
PTA Risk
Based on 1432 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month