DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
[Copied from Final Action 13November2025→] Applicant’s election without traverse of Group II, (A)(1) and IPA1 gene, (B)(i) SPL, (C) SPL9a (and sequences SEQ ID NOs: 143, 144, 178, and 145), (D)(IV) a mutation in an miR156 binding site located from about nucleotide 6624-6847 (numbered according to SEQ ID NO: 143) in the reply filed on 09Mau2025 is acknowledged. Applicant did not specify a mutant SPL9a sequence for examination1, so the Office presumes Applicant elects the “CE56385” sequence SEQ ID NO: 295 for examination (see claims 66 and 123).2 Claims 1, 4, 13, 17, 19, 31, 34, 35, 45, 97, 100, 114, 117, 118, and 142 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected group or species, there being no allowable generic or linking claim. Please also note that claim 54 “orthologue thereof” as well as parts (b) and (c); claim 60 parts (b) and (c); claim 90 parts (b) and (c); claim 102 parts (b)-(f) [both lists]; claim 123 parts (b)-(e); and claim 160 parts (b)-(c) ARE ALSO WITHDRAWN as being directed toward non-elected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 09May2025.
Status of the Claims
The amendments and arguments filed 03February2026 are acknowledged and have been fully considered. Claims 2-3, 5-18, 20-44, 46-53, 55-59, 61-62, 64-65, 67-89, 91-101, 103-106, 108-122, 124-159 were previously canceled. Claims 1, 4, 19, 45, 54, 60, 63, 66, 90, 102, 107, 123, 160, 161 are pending. Claims 1, 19, 54, 60, 90, 102, 160-161 are currently amended. Claims 4, 45, 63, 66, 107, 123 were previously amended. Following the restriction requirement mailed 17April2025 and Applicant’s election dated 09May2025, claims 1, 4, 19, 45 REMAIN withdrawn as being directed toward a non-elected group and/or species (rejoinder currently being inappropriate).
Claims 54(part a), 60(part a), 63, 66(as it relates to elected SPL9), 90(part a), 102(parts a), 107, 123(part a), 160(part a), 161 remain examined on the merits herein.
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) [US provisional 63337244 filed 02May2022] is acknowledged. Claims 54(part a), 60(part a), 63, 66(as it relates to elected SPL9), 90(part a), 102(parts a), 107, 123(part a), 160(part a), and 161 MAINTAIN an effective filing date of 02May2022.
Withdrawn Objections and/or Rejections
Objections and Rejections made of record in the nonfinal office action dated 04March2026 that are not otherwise discussed herein are withdrawn. In particular:
RE ¶ 7: The objections to claims 54 and 90 is withdrawn in view of the claim amendments (amending claim language for consistency and adding “environmental conditions” phrases);
RE ¶ 8: The Indefiniteness rejection of claims 54 and 90 is withdrawn in view of the claim amendments (removing “improved yield trait” language); and
RE ¶ 9: The Utility rejection of claims 160-161 is withdrawn in view of the claim amendments (specifying that the claimed subject matter is a “gene editing system”).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 160-161 are rejected under 35 U.S.C. 103 as being unpatentable over TRIPATHI et al. (“Genomic organization, phylogenetic comparison, and expression profiles of the SPL family genes and their regulation in soybean” 2017 Dev Genes Evol. 227:101-119, DOI 10.1007/s00427-017-0574-7) in view of BAO et al. (“CRISPR/Cas9-mediated targeted mutagenesis of GmSPL9 genes alters plant architecture in soybean” 2019 BMC Plant Biology 19(131): 12 total pages; of record IDS 03November2023) and SUN et al. (“Genetic improvement of the shoot architecture and yield in soya bean plants via the manipulation of GmmiR156b” 2019 Plant Biotechnology Journal 17:50-62; of record Form PTO-892 10July2025).
Claims 160 and 161 are now amended to overcome the Utility issues of record. As amended, claims 160-161 are directed toward gene editing systems which target GmSPL9a miR156 sequences sequences SEQ ID NOs: 178-181, 218-221, 251-254, 285-288 [claim 160] or the reverse complement of sequences SEQ ID NOs: 114, 115, 301 [claim 161]. Please note that claims 54 and 90 (and all claims referring thereto) recite particular phenotype changes and, therefore, are not rejected here (i.e., none of the other pending and examined claims are rejected here). Candidly, the Office does not see a path toward patentability for claims 160-161 (please note that it does not make sense to specify a resulting mutation within a claim directed toward a gene editing system).
TRIPATHI et al. teaches GmSPL9a miR156 sequence “gugcucucucucuucugucaa” (i.e., “gtgctctctctcttctgtcaa”) at Figure 4—this sequence is within all of sequences SEQ ID NOs: 178-181, 218-221, 251-254, 285-288 [claim 160] and within the reverse complement of sequences SEQ ID NOs: 114, 115, 301 [claim 161].
PNG
media_image1.png
155
398
media_image1.png
Greyscale
BAO et al., discussed of record, teaches the following (copied from the Final action 13November2025 for consistency of the record):
using CRISPR/Cas9 to introduce a “null” deletion mutation into the first exon of an endogenous Glycine max (soybean) SPL9a gene (“GmSPL9a” therein) causing a premature translation termination codon.3 For clarity of the claims, elected and examined sequences SEQ ID NOs: 143, 144, 145, 178 are Glycine max (soybean) SPL9a sequences (where “SPL9a” is described as being that published as Glyma.02G1775004) and, based on the “Additional file 4” information provided by BAO et al. as well as the fact that BAO et al. also describes its SPL9a as corresponding to Glyma.02G1775005, the sequences taught by BAO et al. appear to be the same (or at least “80% identical” to) the sequences of this application’s claims. Finally, the deletion mutation of BAO et al. is in the first exon of the SPL9a gene,6 whereas the elected and examined mutant sequence SEQ ID NO: 295 (corresponding to this application’s “CE56385” embodiment) has a 9-nucleotide deletion at the 3’ end of the gene sequences (down in the putative miR156 binding site of the encoded SPL9a mRNA molecule)7. This means that the truncated sequence taught by BAO et al. is the same (or at least “90% identical” to) the 5’/upstream sequence of SEQ ID NO: 295. For context, please note that the null GmSPL9a mutant of BAO et al. would lack the miR156 binding site entirely (i.e., the miR156 binding site would not be functional and any transcript may be considered miR156 resistant for lack of an miR156 binding site).
BAO et al. do not teach mutating SPL9a within an miR156 binding site.
SUN et al. discussed of record, teaches the following (copied from the Final action 13November2025 for consistency of the record):
that at least Glycine max (soybean) GmSPL9a and GmSPL9d genes (or gene transcripts) are targets of GmmiR156.8 SUN et al. teach introducing substitution mutations into a GmSPL9d gene at the miR156 binding site9 to obtain a GmSPL9d that is resistant to miR156 regulation.10 Importantly, SUN et al. teach the miR156 binding/target site within GmSPL9a (Glyma.02G177500)11 which corresponds to “about nucleotide 6624 to about nucleotide 6847” of this application’s SEQ ID NO: 143. For context, the mutant sequence SEQ ID NO: 295 of this application (corresponding to the “CE56385” embodiment) is modified with respect to the wild type GmSPL9a/Glyma.02G177500 sequence by having a nine-nucleotide (“CTGTGCTCT”) deletion within the GmSPL9a miR156 binding site. The nine-nucleotide (“CTGTGCTCT”) deletion sequence of this application’s SEQ ID NO: 295 is underlined within the screen-capture below (showing Figure 5 of SUN et al.):
PNG
media_image2.png
112
452
media_image2.png
Greyscale
Absent evidence to the contrary, it is believed that a person with ordinary skill in the art at the time this application was filed (a “POSA”) would have viewed it as obvious via BAO et al. and SUN et al. to edit an miR156 sequence of GmSPL9a using CRISPR/Cas and, in view of TRIPATHI et al., for the specific target to comprise the “gugcucucucucuucugucaa” (i.e., “gtgctctctctcttctgtcaa”) sequence recited in these claims [claims 160-161]. To be clear, it is believed that obtaining the claimed gene editing systems would have been, at the very least, “obvious to try” MPEP § 2143(I)(E) in view of TRIPATHI et al., BAO et al., and SUN et al. with a reasonable expectation of success and motivation to obtain an miR156-resistant GmSPL9a (noting that plants comprising BAO et al.’s null GmSPL9a mutant expressing an miR156-resistant SPL9a sequence have modified architectural phenotypes)12.
Claim Rejections - 35 USC § 112 – Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 54(part a), 60(part a), 63, 66(as it relates to elected SPL9), 90(part a), 102(parts a), 107, 123(part a), 160(part a), 161 REMAIN rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
As a reminder, these claims continue to recite non-elected, non-examined subject matter. Only claims 54(part a), 60(part a), 66(as it relates to elected SPL9), 90(part a), 102(parts a), 123(part a), 160(part a) are under examination (claims 63, 107 and 161 do not appear to recite non-elected parts and are, thus, examined in their entirety).
As amended 03June2026, claims 54 and 90 (and, therefore, all claims referring thereto) recite the specific soybean phenotype change of increased pods on main stem or pods per node main stem and corn phenotype change of increased kernel row number. Please note that Applicant elected soybean-specific species SPL9a for examination (and did not elect, for example, “orthologues”), so “corn plants” are believed to be non-elected and withdrawn. Nonetheless, because there does not appear to be support for achieving the “increased kernel row number” in corn (especially across the breadth of modifications claimed), part (4) of the rejection is maintained. The claims now specify corn or soybean plants, so part (1) is updated to reflect that change. The claims also now recite “90%” sequence identities, so part (2) is updated to reflect that change.
The rejection below is largely copied from the nonfinal 04March2026 (new content is at the “Response to Applicant’s Remarks” section).
Executive summary of the issues:
(1) These claims recite corn or soybean plants, but the limited evidence in the specification and prior art only support claims requiring a soybean plant;
(2) These claims recite a breadth of sequence structures (note the use of “90%” sequence identities), but the specification and prior art only support claims requiring 95% or more sequence identity to the listed sequences;
(3) These claims recite any insertion and/or deletion mutation (including any out-of-frame insertion or any out-of-frame deletion [claim 63] and including any in-frame-deletion [claim 107]), but the specification and prior art only support achieving increased pods on main stem or pods per node main stem phenotypes via a homozygously present mutant SPL9a allele characterized by having a 9 basepair deletion at the position corresponding to 6720 of the sequence SEQ ID NO: 295 (i.e., the elected CE56385 species currently under examination);
(4) These claims recite a function/phenotype change being increased pods on main stem or pods per node main stem (if the “plant” is soybean) and increased kernel row number (if the plant is “corn”), but the specification and prior art only support generating a specifically modified soybean plant (see (3) above) that has, a result of that modification, increased pods on main stem or pods per node main stem as compared to a wild type control plant devoid of the mutation and grown in the same environmental conditions. In any event, “corn plants” are believed to be non-elected subject matter. Please delete “corn” from the claims.
With respect to the elected, examined SPL9a mutant [soybean] plant referred to as “CE56385”, Examples 2 and 8 of the specification are relevant. In the absence of further information from Applicant (such as declaration practice, which has been recommended of record), and given only means/averages and standard deviation values for E2 soybean plants (Example 8 at pages 108-109 of the specification, Tables 9-10); the Office has generated charts with accompanying 2x Standard Error of the Mean (SE) error bars (below) to make it clear on the record that there is no statistically significant difference between the wild type control group’s phenotypes as compared to the elected CE56385 group’s phenotypes for 6 of the 8 assayed phenotypes: nodes on main stem, branches per plant, pods on branches, pods per plant, seeds per plant, and seeds per pod (shown in the below charts via overlapping 2xSE error bars, where the overlap is unclear a horizontal line has been provided for ease of review). The only 2 assayed phenotypes that do appear to have a statistically significant difference (between wild type control group and the elected CE56385 group) are pods on main stem and pods per node main stem (denoted in the below charts by open boxes). To ensure a clear record, please see CUMMING et al.13 for a description of 2xSE error bars and how to interpret error bars generally (in brief, 2xSE error bars may be used for an approximation of p-value and when 2xSE error bars touch or overlap, that generally means that the difference between the means/averages is not statistically significant (i.e., p > 0.05)). To be clear, the Office focused on the E2 generation (Example 8) at least because the data for E1 plants (Example 2, Table 3 at pages 104-105 of the specification) is incomplete (e.g., without both mean/average and standard deviation information, SE error bars (and 2xSE error bars) cannot be generated. The charts below show that, even for the elected CE56385 plants characterized by a homozygously present, 9 basepair, in-frame deletion in SPL9a (corresponding to position 6720 of SEQ ID NO: 295)14, Applicant has not shown that “altered plant architecture and/or improved yield trait(s)” as compared to a control plant can actually be achieved. At most, Applicant has only shown that pods on main stem and pods per node main stem are increased (there is currently no evidence of record to support any alteration to any plant architecture or any “improved” (increase?) to any yield trait). The currently claimed functions/phenotypes are much broader than what is supported by the specification and prior art.
The prior art does not supplement the deficiencies of this specification. BAO et al. and SUN et al. (discussed of record with respect to obviousness) are relevant to these claims in terms of modifying SPL9 in soybean, but neither can account for the function/phenotype changes now recited in these claims. As said of record, BAO et al. and SUN et al. both teach increasing SPL9 by decreasing suppression thereof (BAO et al. increase SPL9a via mutating the SPL9b suppressor, SUN et al. increase SPL9d by mutating the binding site of the miR156 suppressor). Notably, BAO et al. specifically observed that plants with increased SPL9a (via decreased SPL9b suppression) "showed comparable plant architecture as [wild type] plants"15. Therefore, a skilled artisan would not reasonably expand the specification’s showing of “increased pods on main stem and/or increased pods per node main stem” out to any altered plant architecture or any improved (increased?) yield trait in view of the prior art (including in view of BAO et al. and SUN et al.). In fact, BAO et al. evidences that the full breadth of the claimed function/phenotype changes cannot be achieved and they certain cannot be achieved with the full breadth of mutations being claimed, the full breadth of sequence structures being claimed, or in any plant type.
It follows that Applicant has not shown that the full breadth of structures being claimed will actually achieve “increased pods on main stem or pods per node main stem” as compared to a control plant. Absent evidence to the contrary (e.g., data and/or data analysis submitted via declaration practice), a skilled artisan at the time this application was filed would not reasonably recognize Applicant as having possession of the full metes and bounds of what is being claimed. It would be remedial of this rejection to amend the claims so that they require: a soybean plant homozygously comprising a modified SPL9a characterized by having a 9 basepair deletion at the position corresponding to 6720 of the sequence SEQ ID NO: 295 and wherein the soybean plant exhibits increased pods on main stem or pods per node main stem as compared to a wild type control plant devoid of the mutation and grown in the same environmental conditions.
Charts Including 2xSE Error Bars for Results in Tables 9 and 10 (Example 8)—Input data follows:
PNG
media_image3.png
351
312
media_image3.png
Greyscale
PNG
media_image4.png
347
318
media_image4.png
Greyscale
PNG
media_image5.png
348
311
media_image5.png
Greyscale
PNG
media_image6.png
376
323
media_image6.png
Greyscale
PNG
media_image7.png
347
356
media_image7.png
Greyscale
PNG
media_image8.png
330
297
media_image8.png
Greyscale
PNG
media_image9.png
313
299
media_image9.png
Greyscale
PNG
media_image10.png
312
272
media_image10.png
Greyscale
Table 9 Nodes on Main Stem
Wild Type Control
CE56385 E2
Average
18.7
18.4
Standard Error of the Mean (SE)
0.138
0.183
2xSE
0.276
0.366
Table 9 Branches Per Plant
Wild Type Control
CE56385 E2
Average
15.2
14.4
Standard Error of the Mean (SE)
0.447
0.447
2xSE
0.894
0.894
Table 9 Pods on Branches
Wild Type Control
CE56385 E2
Average
115.4
113.8
Standard Error of the Mean (SE)
5.63
4.59
2xSE
11.26
9.18
Table 9 Pods on Main Stem
Wild Type Control
CE56385 E2
Average
38.3
56.4
Standard Error of the Mean (SE)
1.97
2.29
2xSE
3.94
4.58
Table 10 Pods Per Node Main Stem
Wild Type Control
CE56385 E2
Average
2
3
Standard Error of the Mean (SE)
0.112
0.109
2xSE
0.224
0.218
Table 10 Pods Per Plant
Wild Type Control
CE56385 E2
Average
153.7
170.2
Standard Error of the Mean (SE)
5.55
5.57
2xSE
11.1
11.14
Table 10 Seeds Per Plant
Wild Type Control
CE56385 E2
Average
264.4
307
Standard Error of the Mean (SE)
11.61
14.99
2xSE
23.22
29.98
Table 10 Seeds Per Pod
Wild Type Control
CE56385 E2
Average
1.7
1.9
Standard Error of the Mean (SE)
0.067
0.066
2xSE
0.134
0.132
Response to Applicant’s Remarks 03June2026:
(1) Applicant asserts that the claim amendments are sufficient to overcome this rejection (Remarks at page 15). Applicant emphasizes that the target sequences are specified (Remarks at the bridge of pages 15-16).
This is not persuasive for the reasons stated above. Namely, the amendments are not commensurate with the description (in view of the prior art). Materially, Applicant has not addressed the teachings by the prior art (BAO et al. and SUN et al.) demonstrating, at least, SPL9 mutations which have no material impact on soybean phenotypes and how the limited examples within this specification may be extrapolated out to the breadth of subject matter claimed in view of the prior art teachings such as BAO et al. and SUN et al.
(2) Applicant asserts that the specification sufficiently describes structure::function relationships such that a skilled artisan would recognize Applicant as having possession of the full metes and bounds of the claimed subject matter (Remarks at pages 15-17 emphasizing the several IPA1 sequences taught, supposed functional characteristics to distinguish the claimed genus, and supposed success by Applicant in achieving the claimed phenotypes).
This is not persuasive for the reasons stated above. The specification has already been reviewed in its entirety and is believed to be deficient for at least the reasons of record. Materially, Applicant has not addressed the teachings by the prior art (BAO et al. and SUN et al.) demonstrating, at least, SPL9 mutations which have no material impact on soybean phenotypes and how the limited examples within this specification may be extrapolated out to the breadth of subject matter claimed in view of the prior art teachings such as BAO et al. and SUN et al.
Please amend the claims as suggested (including cancelling claims 160-161 and removing non-elected subject matter) so that a Notice of Allowance may be mailed.
Conclusion
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Rebecca STEPHENS whose telephone number is (571)272-0070. The examiner can normally be reached Monday through Friday 8:30-4:30.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad ABRAHAM can be reached at (571) 270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/REBECCA STEPHENS/Examiner, Art Unit 1663
/MATTHEW R KEOGH/Primary Examiner, Art Unit 1663
1 See part (D) of the Election of Species (page 5) dated 17April2025.
2 For the sake of a clear record, please note that the “CE52366” embodiment in the specification comprises a SPL9a mutation (in combination with an SPL9b mutation) and is represented by SEQ ID NO: 300.
3 BAO et al. at Abstract, right column on page 3, Fig. 1 on page 3, Fig. 5 on page 5, paragraph bridging pages 7-8,
4 See, e.g., the specification at page 7, line 16.
5 BAO et al. at the top of the right column on page 10.
6 BAO et al. at the right column on page 3.
7 See specification at Examples 1-3 at pages 102-105 and Example 8 at pages 108-109.
8 SUN et al. at page 53.
9 Referred to therein as the “7mGmSPL9d” mutant having seven point mutations (mismatches) at the miR156 binding site that interrupt the miR156 binding site without changing amino acid residues. Please note that SUN et al. say that their mutations “were designed as described by JIAO et al. (2010)” (left column on page 59).
10 SUN et al. at the left column on page 54
11 SUN et al. at Figure 5 on page 56.
12 See BAO et al. at page 8 emphasizing architectural phenotype changes at least of later generation plants including “increased levels in node number on main stem, total node number per plant, branch number and dry weight compared with [wild type] and spl9b single mutant plants”.
13 See CUMMING et al. “Error bars in experimental biology” 2007 J. Cell Biology 177(1):7-11.
14 Specification at page 103 describing the modified soybean plant referred to as “CE56385”.
15 BAO et al. at page 7, right column and Figure S5.