Prosecution Insights
Last updated: April 19, 2026
Application No. 18/310,969

COMPOSITION FOR PREVENTING OR TREATING PROGERIA AND NATURAL AGING THROUGH GENE EDITING

Final Rejection §103
Filed
May 02, 2023
Examiner
POPA, ILEANA
Art Unit
1633
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Korea Research Institute Of Bioscience And Biotechnology
OA Round
2 (Final)
21%
Grant Probability
At Risk
3-4
OA Rounds
4y 8m
To Grant
35%
With Interview

Examiner Intelligence

Grants only 21% of cases
21%
Career Allow Rate
172 granted / 820 resolved
-39.0% vs TC avg
Moderate +14% lift
Without
With
+13.9%
Interview Lift
resolved cases with interview
Typical timeline
4y 8m
Avg Prosecution
61 currently pending
Career history
881
Total Applications
across all art units

Statute-Specific Performance

§101
1.7%
-38.3% vs TC avg
§103
45.2%
+5.2% vs TC avg
§102
9.3%
-30.7% vs TC avg
§112
19.8%
-20.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 820 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . 1. Claims 2, 4, 8-10, and 13 have been cancelled. Claims 1, 3, 5, and 6 have been amended. Claim 14 is new Claims 1, 3, 5-7, 11, 12, and 14 are pending and under examination. 2. All rejections/objections pertaining to claim 2 are moot because the claim was cancelled with the reply filed on 01/15/2026. The objections to claims 1, 3, 5, and 6 are withdrawn in response to the amendment filed on 01/15/2026. The rejection of claims 1-3 under 35 U.S.C. 112(b) is withdrawn in response to the amendment specifying that by SEQ IS NOs: 1-5 are the sequences of the spacers, not the gRNAs. Claim Objections 3. Claim 3 should recite “The gRNA of claim 14, wherein the spacer hybridizes to the nucleotide sequence spanning the junction between exons 11 and 12 of the progerin mRNA”. 4. Claims 5 and 14 are objected to because of the recitation ”a complementary sequence to any one”. Appropriate correction to ”a sequence complementary to any one” is required. Claim Rejections - 35 USC § 103 5. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. 6. Claims 1, 3, 5-7, 11, 12, and 14 are rejected under 35 U.S.C. 103 as being unpatentable over Djabali (WO 07/044940), in view of Zhao et al. (Cancer Letters, 2018, 431: 171-181). Djabali teaches: (1) siRNAs (and encoding vectors) targeting a sequence present only in the aberrantly spliced mRNA variant encoding progerin; and (2) a method for treating progeria in a subject by using the siRNAs or the vectors encoding it. The target sequence is GGAGCCCAGAGCCCCCAGAACTGCAGCATCATG (SEQ ID NO: 6) which spans the junction between exons 11 and 12 of the progerin mRNA; it is used to specifically target the progerin mRNA, leaving the mRNA encoding the wild type protein intact (see [0019]-0021]; [0024]; [0027]; [0031]; [0055]-[0056]; [0059]; [0077]; [0105]-[0152]; [0171]). As evidenced by the alignments below, the target sequence taught by Djabali is: Complementary to nucleotides 1-18 of the claimed SEQ ID NO: 1 PNG media_image1.png 116 596 media_image1.png Greyscale Complementary to nucleotides 1-21 of the claimed SEQ ID NO: 2 PNG media_image2.png 110 638 media_image2.png Greyscale - Complementary to nucleotides 1-23 of the claimed SEQ ID NO: 3: PNG media_image3.png 114 582 media_image3.png Greyscale - Complementary to nucleotides 1-24 of the claimed SEQ ID NO: 4 PNG media_image4.png 108 584 media_image4.png Greyscale - Complementary to nucleotides 1-27 of the claimed SEQ ID NO: 5 PNG media_image5.png 110 590 media_image5.png Greyscale Thus, the siRNAs taught by Djabali target and the spacers set forth by the claimed SEQ ID NO: 1-5 target the same site (claims 1, 3, 11, and 14). Djabali teaches siRNAs and not CRISPR/Cas13 (claims 1, 3, 5, 6, 11, 12, and 14). Zhao et al. teach that siRNAs often elicits off-target effects. Zhao et al. teach that CRSPR/Cas13 can be used to specifically inhibit mutants at the mRNA level with no off-target effects. Zhao et al. teach delivering CRISPR/Cas13 via an AAV encoding the gRNA and Cas13 (see Abstract; paragraph bridging p. 171 and 172; p. 179, paragraph bridging columns 1 and 2; paragraph bridging p. 179 and 180). Based on these teachings, one of skill in the art would have found obvious to modify Djabali by replacing the siRNA with gRNA targeting the nucleic acid sequence set forth by SEQ ID NO: 6 and further using an AAV to deliver the gRNA/Cas13 to achieve the predictable result of treating progeria in the subject. While the spacer taught by the cited prior art may not be exactly the same as the claimed spacers set forth by SEQ ID NO: 1-5 (for example, SEQ ID NO: 6 is shorter by one nucleotide), the spacer taught by the prior art and the claimed spacers target the same sequence on the aberrantly spliced mRNA variant. As per MPEP § 716.02, [a]ny differences between the claimed invention and the prior art may be expected to result in some differences in properties. The issue is whether the properties differ to such an extent that the difference is really unexpected. In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). In this case, there is no evidence of record indicating that SEQ ID NOs: 1-5 provide unexpected results over the sequence taught by Djabali. With respect to claim 7, SEQ ID NOs: 6-15 are the sequences of lentiviral vectors expressing the gRNA and Cas13 (see Examples 1 and 2 on p. 14 and 22, respectively; Fig. 5-9 and 29-33). While the cited prior art does not teach SEQ ID NOs: 6-15, the essential components (i.e., the sgRNA and Cas13) and a vector comprising these essential elements are taught by the cited prior art. The difference between the claimed vector and the vector taught by the prior art is the vector backbone and there is no evidence on the record that the vector backbone results in a construct exhibiting an unexpected property. The vector backbone is not significant if it does not provide a novel feature. Thus, the claimed invention was prima facie obvious at the time of its effective filing date. Response to Arguments 7. The arguments addressing the references individually are not found persuasive because none of the references has to teach every claim limitation. The test for obviousness is not whether the features of a secondary reference may be bodily incorporated into the structure of the primary reference; nor is it that the claimed invention must be expressly suggested in any one or all of the references. Rather, the test is what the combined teachings of the references would have suggested to those of ordinary skill in the art. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981). The argument that, even if combined, the references do not suggest the specific gRNAs, the recombinant vectors, and the method of treating progeria is not found persuasive. As set forth in the rejection, the targeted site and the method treating progeria are taught by Djabali. While Djabali does not teach gRNA, the cited prior art provides the motivation to use a gRNA to target this site; designing such a gRNA would have only entailed routine experimentation. While the cited prior art does not specifically teach the claimed recombinant vectors, the cited prior art teaches the essential components (i.e., the gRNA targeting the claimed site and Cas13); the cited prior art also teaches a vector comprising these essential elements. While the backbone of the claimed vector may be different, the difference is not significant because there is no evidence of record that it provides a novel feature over the prior art. For the reasons set forth above, the 132 Declaration is not found persuasive. The 132 Declaration provides data showing that the sgRNAs comprising the spacers set forth by SEQ ID NOs: 1-5 are capable of selectively suppress progerin mRNA, while the sgRNAs comprising spacers targeting sequences adjacent to the claimed targeted sequence did not. However, these results are not material to the rejection because the rejection is not based on replacing adjacent sites with the claimed targeted site. Djabali already teaches targeting the claimed sequence to specifically suppress progerin mRNA, while leaving the mRNA encoding the wild type protein (i.e., lamin A) intact. The only difference is that Djabali teaches siRNAs and not an sgRNA. The cited prior art provides the motivation to use sgRNA instead of siRNA and there is no evidence of record indicating that using an sgRNA instead of an siRNA provides for more than was expected from the teachings in the cited prior art. Conclusion 8. THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ILEANA POPA whose telephone number is (571)272-5546. The examiner can normally be reached 8:00 am to 4:30 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher Babic can be reached at 571-272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ILEANA POPA/Primary Examiner, Art Unit 1633
Read full office action

Prosecution Timeline

May 02, 2023
Application Filed
Sep 12, 2025
Non-Final Rejection — §103
Jan 15, 2026
Response Filed
Mar 26, 2026
Final Rejection — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12594295
CFTR MRNA COMPOSITIONS AND RELATED METHODS AND USES
2y 5m to grant Granted Apr 07, 2026
Patent 12527882
IMMOLATIVE CELL-PENETRATING COMPLEXES FOR NUCLEIC ACID DELIVERY
2y 5m to grant Granted Jan 20, 2026
Patent 12522811
ENHANCED BCL11A RNP / CRISPR DELIVERY & EDITING USING A 3XNLS-CAS9
2y 5m to grant Granted Jan 13, 2026
Patent 12514887
ONCOLYTIC TUMOR VIRUSES AND METHODS OF USE
2y 5m to grant Granted Jan 06, 2026
Patent 12514888
Immuno-Oncolytic Therapies
2y 5m to grant Granted Jan 06, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
21%
Grant Probability
35%
With Interview (+13.9%)
4y 8m
Median Time to Grant
Moderate
PTA Risk
Based on 820 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month