Prosecution Insights
Last updated: October 02, 2026
Application No. 18/311,941

METHODS AND COMPOSITIONS FOR MODIFYING ROOT ARCHITECTURE AND/OR IMPROVING PLANT YIELD TRAITS

Final Rejection §102§103
Filed
May 04, 2023
Priority
May 05, 2022 — provisional 63/338,467
Examiner
CHATTERJEE, JAYANTA
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Monsanto Technology LLC
OA Round
4 (Final)
46%
Grant Probability
Moderate
5-6
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 46% of resolved cases
46%
Career Allowance Rate
10 granted / 22 resolved
-14.5% vs TC avg
Strong +80% interview lift
Without
With
+80.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 7m
Avg Prosecution
54 currently pending
Career history
82
Total Applications
across all art units

Statute-Specific Performance

§101
3.6%
-36.4% vs TC avg
§103
41.9%
+1.9% vs TC avg
§102
17.2%
-22.8% vs TC avg
§112
29.6%
-10.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 22 resolved cases

Office Action

§102 §103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claim Status Claims 1, 3, 6, 12, 15, 20, 65-66, 68-69, 77-78, 93 and 113-116 are pending. Claims 15, 65-66, 68-69, 77-78, 93 and 116 are withdrawn from examination as part of non-elected groups. New claims 113-116 are added by the Applicant while claim 116 is withdrawn (by the Applicant) from examination. Claims 1, 3, 6, 12, 20 and 113-115 are being examined. Due to applicant’s amendments, the rejection is modified from the rejection set forth on pages 3-8 in the Office action dated 03/27/2026. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 1, 3, 12, 20 and 115 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Hirsch et al. (Draft Assembly of Elite Inbred Line PH207 Provides Insights into Genomic and Transcriptome Diversity in Maize, 2016, The Plant Cell, 28:2700–2714; Phytozome Gene Identifier: Zm00008a006863). This is a new rejection based necessitated by claim amendments. Hirsch et al. describes genomes of elite corn inbred lines PH207 and B73 (abstract). Both the corn genomes contain several LOG genes which encode cytokinin riboside 5'-monophosphate phosphoribohydrolase proteins. One of the LOG genes, LOG6 gene (Gene ID: Zm00008a006863) encodes the LOG6 protein. The upstream cis-regulatory element (promoter sequence 5’ upstream of the ATG start codon, as recited in claim 3) of the LOG6 gene comprises a 6 base pair deletion mutation (grey highlighted sequence) (as recited in claim 115) in the region having at least 80% (94%) sequence identity to instant SEQ ID NO: 142, as shown below. >jgi:2_833 Zmays|833|Zm-B73-REFERENCE-NAM-5.0.55|dna:chromosome chromosome:Zm-B73-REFERENCE-NAM-5.0:2:1:243675191:1 Length=243675191 Score = 142 bits (157), Expect = 1e-31 Identities = 87/93 (94%), Gaps = 6/93 (6%) Strand=Plus/Minus SEQ ID NO: 142 TGTGGTGGTGCAATCGAGTGCAGTAAAGCTAGCCATGCCCATGCTGTAGTGGGATATCTC 60 |||||||||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct 29507843 TGTGGTGGTGCAATCGAGTGCAGTAAAGCTAGCCATGC------TGTAGTGGGATATCTC 29507790 SEQ ID NO: 142 CCCCATTCTGCTGCGCCACCATTGCTGCAAGGG 93 ||||||||||||||||||||||||||||||||| Sbjct 29507789 CCCCATTCTGCTGCGCCACCATTGCTGCAAGGG 29507757 The same log LOG6 gene (Gene ID: Zm00008a006863) in the maize cultivar B73 has a 3 base pair deletion mutation (grey highlighted sequence) (as recited in claim 115) in another of its cis-regulatory element (in 3’ terminator sequence after the TAA stop codon) in the region having at least 80% (95%) sequence identity to instant SEQ ID NO: 142, as shown below. >jgi:2_833 Zmays|833|Zm-B73-REFERENCE-NAM-5.0.55|dna:chromosome chromosome:Zm-B73-REFERENCE-NAM-5.0:2:1:243675191:1 Length=243675191 Score = 187 bits (206), Expect = 6e-45 Identities = 113/119 (95%), Gaps = 3/119 (3%) Strand=Plus/Minus SEQ ID NO: 142 TATATAATTCTAGTTTCTACTAGTAGCAAATGAGGTGTTACTAGATTGATTATTACTGTG 260 ||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| Sbjct 29503341 TATATAATTCTAGTTTCTA---GTAGCAAATGAGGTGTTACTGGATTGATTATTACTGTG 29503285 SEQ ID NO: 142 TACGCGGAGGGGGGACAGAAGATTACCGCGTGTAACCCTGAGAGGCCGAGACATTTGAG 319 |||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| Sbjct 29503284 TACGCGGAGGGGGGACAGAAGATTACCGCGTGTAGCCCTGAGAGACCGAGACATTTGAG 29503226 Regarding claim 20, the genome of maize cultivar B73 has a polynucleotide sequence comprising more than 90% sequence identity (95%) to instant SEQ ID NO: 125, as shown below. Score = 3710 bits (4114), Expect = 0.0 Identities = 2254/2372 (95%), Gaps = 90/2372 (4%) Strand=Plus/Minus Query 171 GGAGATCAAGAACCGAGGTAGCAGCAGCGGAGGCGATGATGATGGGCATGCCGACGGTGC 230 |||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| Sbjct 29507735 GGAGATCAAG----GAGGTAGCAGCAGCGGAGGCGATGACGATGGGCATGCCGACGGTGC 29507680 Query 231 CCTCTCGGTTCAGGAGGATCTGCGTC---------AGCAGCCAGGGGAGGAAGAAGAGCT 281 |||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct 29507679 CCTCTCGGTTCAGGAGGATCTGCGTCTTCTGCGGAAGCAGCCAGGGGAGGAAGAAGAGCT 29507620 Query 282 ACCAGGATGCTGCCGTCGAGCTCGGCGAGGAGCTGGTGTGTCTTCT----TTCTCCTCGT 337 |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct 29507619 ACCAGGATGCTGCCGTCGAGCTCGGCGAGGAGCTGGTGTGTCTTCTAGCTTTCTCCTCGT 29507560 Query 338 CGTAATCTCGGTAGACAGGGTTGCGCGCATCAGCTTTCAGCATATTTATGCCTGTTACTG 397 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 29507559 CGTAATCTCGGTAGACAGGGTTGCGCGCATCAGCTTTCAGCATATTTATGCCTGTTACTG 29507500 Query 398 CTCAAATGGTTGTTTCTTTTGCTTATCAACGGTAATAACACATGTGCATGGTTAATTTCT 457 ||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| Sbjct 29507499 CTCAAATGGTTGTTTATTTTGCTGATCAACGGTAATAACACATGTGCATGGTTAATTTCT 29507440 Query 458 TATTAGTCTAGCAGCCTGCATGCGCGAAGTTTTTCTTCAGCTCGAGTGCATGACTGCATG 517 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 29507439 TATTAGTCTAGCAGCCTGCATGCGCGAAGTTTTTCTTCAGCTCGAGTGCATG----CAT- 29507385 Query 518 CATGACCACGACGTGCCCATAAACGTTTATCTTGTTTTCTTTCGACCTTAATTGCAACTT 577 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 29507384 CATGACCACGACGTGCCCATAAACGTTTATCTTGTTTTCTTTCGACCTTAATTGCAACTT 29507325 Query 578 TTCACTCACTACTGCACTGAAACTACTAATGCTTCACTTCTTTTCAGAAATGGCGatttt 637 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct 29507324 TTCACTCACTACTGCACTGAAACTACTAATGTTTCACTTCTTTTCAGAAATGGCGATTTT 29507265 Query 638 gattttgaatttgattttttgGATGTTAAAATATATATGGACTCACGCATAGTACAACAC 697 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 29507264 GATTTTGAATTTGATTTTTTGGATGTTAAAATATATATGGACTCACGCATAGTACAACAC 29507205 Query 698 ATGTCtttttttttCCATAT--GTATATGTGAAGCACTGCACCAACCACCATGTAGCTTT 755 |||| ||||||| ||||| ||||||||||||||||||||||||||||||||| |||| Sbjct 29507204 ATGTATTTTTTT---CATATACGTATATGTGAAGCACTGCACCAACCACCATGTAACTTT 29507148 Query 756 GACATATAGGGACCCATGCATGCATATATGCTCCCGT--------TGGCATCATCTCCTC 807 ||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 29507147 GACATATAGGGACCCATGCATGCATATATGCTCCCGTAGTCCCGTTGGCATCATCTCCTC 29507088 Query 808 ACTCATTATAATATTGACGCTCCACGCCTCCACCCCCACTACTAGTGATTATTCCCATGC 867 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 29507087 ACTCATTATAATATTGACGCTCCACGCCTCCACCCCCACTACTAGTGATTATTCCCATGC 29507028 Query 868 ATCTACTGAATTAATTTTCAACAATTCTCGATCTGTTCCTGGCACATCCTCAGTTTCAGT 927 |||||||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct 29507027 ATCTACTGAATTAATTTTCAACAATTCTAC----GTTCCTGGCACATCCTCAGTTTCAGT 29506972 Query 928 TAATATCTTCTTCCACTTCATG----GCAATGTATGGATGCATATAAAATAAGATATGTA 983 |||||||||||||||||||||| |||||||||||||||| |||||| |||||||||| Sbjct 29506971 TAATATCTTCTTCCACTTCATGCATGGCAATGTATGGATGCAGATAAAAAAAGATATGTA 29506912 Query 984 AGGTCACACAACATTGTAGCTAACTAGCTACCCTACTATGTAGATAATTAATTAATGGAC 1043 |||||||||||| |||||| ||| ||| |||||||||||||||||||||||| Sbjct 29506911 AGGTCACACAAC----TAGCTACCTA------CTA-TATGTAGATAATTAATTAATGGAC 29506863 Query 1044 TAGTAGACATACCCATCACGTTAACTAGTTCCATTACATTTGTTTAATTATCACTTGAAT 1103 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 29506862 TAGTAGACATACCCATCACGTTAACTAGTTCCATTACATTTGTTTAATTATCACTTGAAT 29506803 Query 1104 TGACATTTGTAGGTCTCAAGGAACATCGATCTGGTCTATGGCGGGGGAAGTGTCGGGCTG 1163 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 29506802 TGACATTTGTAGGTCTCAAGGAACATCGATCTGGTCTATGGCGGGGGAAGTGTCGGGCTG 29506743 Query 1164 ATGGGCCTGGTCTCTCGAGCAGTCTACAATGGAGGGAGGCACGTCATAGGGTACGTAAAC 1223 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct 29506742 ATGGGCCTGGTCTCTCGAGCAGTCTACAATGGAGGGAGGCACGTCATAGGGTATGTAAAC 29506683 Query 1224 AAACAGCAATGATGGTCAGTCTTCAGCAC--TACACTATACTAGCACATGTACACATAAA 1281 ||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| Sbjct 29506682 AAACAGCAATGATGGTCAGTCTTCAGCACACTACACTA--CTAGCACATGTACACATAAA 29506625 Query 1282 AAGAATGGCCCGAAAACTTTGTAAAATCATGACAAAAAGAGTTGGATTGGTCGCATCTTC 1341 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 29506624 AAGAATGGCCCGAAAACTTTGTAAAATCATGACAAAAAGAGTTGGATTGGTCGCATCTTC 29506565 Query 1342 AGGTGCTAA-AAAATGCTACTATATATATAATTTGCCATATATATGTGCAGGGTGATTCC 1400 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 29506564 AGGTGCTAAAAAAATGCTACTATATATATAATTTGCCATATATATGTGCAGGGTGATTCC 29506505 Query 1401 CAAGACCCTCATGCCAAGAGAGGTACGACCACGCTCTCACGCCTCCCTAAAACCCTGTCA 1460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 29506504 CAAGACCCTCATGCCAAGAGAGGTACGACCACGCTCTCACGCCTCCCTAAAACCCTGTCA 29506445 Query 1461 TTGTTTAATCGCACGCAATGATTCCCATGAACTCGACAAAGCATGGCAGATCAGATCCTT 1520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 29506444 TTGTTTAATCGCACGCAATGATTCCCATGAACTCGACAAAGCATGGCAGATCAGATCCTT 29506385 Query 1521 TTTTATTGTTCGTTTGTTTTTCTTAGTACTTATATTGTCTTTAATTTGTATAACTATTTT 1580 |||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct 29506384 TTTTATTGTT-TTTTGTTTTTGTTAGTACTTATATTGTCTTTAATTTGTATAACTATTTT 29506326 Query 1581 CTTACATAACAAGTGTATATATGACGAACGAACGAACTCCTGAACAACTGTTTTTGTTTC 1640 || |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 29506325 CTGACATAACAAGTGTATATATGACGAGCGAACGAACTCCTGAACAACTGTTTTTGTTTC 29506266 Query 1641 TGAACAATAAATACGGAAGAAAGAATTTACATATGaaaaaaaaaa---TTTCTCTGGAGG 1697 |||||||||||||||||||||||||||||||| |||||||||| | |||||||||||| Sbjct 29506265 TGAACAATAAATACGGAAGAAAGAATTTACATGTGAAAAAAAATATTTTTTCTCTGGAGG 29506206 Query 1698 GAAAAGAAGGATGCAGGCCTATTATATATCTTCTCTGCACTGAGAGATCACGTTGAATGT 1757 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct 29506205 GAAAAGAAGGATGCAGGCCTATTATATATCTTCTCCGCACTGAGAGATCACGTTGAATGT 29506146 Query 1758 TCTGTGTGAAAATCCGGTCTTCCTTTACCTGATGATAGATAAGATCTTGGCATCTTTTGC 1817 |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct 29506145 TCTGTGTGAAAATCCGGTCTTCCTTTACCTGATGATAGATAAGATCTTGGCATC--TTGC 29506088 Query 1818 TGATCCTGACCGCTGCTTCTAGTGCCTGCCCCCCTTTGTTCTGAAGGCCTTCGACCCTTT 1877 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct 29506087 TGATCCTGACCGCTGCTTCTAATGCCTGCCCCCCTTTGTTCTGAAGGCCTTCGACCCTTT 29506028 Query 1878 AAGCAGATAACGACTTTGTTAACGAAAAGAAATGCCCGTCGCATTTCTTTTTGTCCCCCA 1937 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 29506027 AAGCAGATAACGACTTTGTTAACGAAAAGAAATGCCCGTCGCATTTCTTTTTGTCCCCCA 29505968 Query 1938 CAACAACACCATGATTACTTCTCCTGAACCATGCGCTCTGCCCCGGCTAAAATAAAATAC 1997 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 29505967 CAACAACACCATGATTACTTCTCCTGAACCATGCGCTCTGCCCCGGCTAAAATAAAATAC 29505908 Query 1998 TCCTAGGAGATAACAGGC--------CAGCAGGCCTCTCACAATCACAGCCACCCCATAG 2049 |||||||||||||||||| |||||||||||||||| ||||||||||||||||| Sbjct 29505907 TCCTAGGAGATAACAGGCCAGCAGGGCAGCAGGCCTCTCACAGTCACAGCCACCCCATAG 29505848 Query 2050 CTTTCGGTTTTGCCTCTGTTAGCTAGGCTATGGGCTGTTGATTACATTACAGGCATGCAT 2109 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Sbjct 29505847 CTTTCGGTTTTGCTTCTGTTAGCTAGGCTATGGGCTGTTGATTACATTACAGGCATGCAT 29505788 Query 2110 CGGTGTGTTGTTGCTTGTGTGTGCAGATTACAGGTGAGACGGTTGGGGAGGTGAAGGCCG 2169 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 29505787 CGGTGT-TTGTTGCTTGTGTGTGCAGATTACAGGTGAGACGGTTGGGGAGGTGAAGGCCG 29505729 Query 2170 TGGCGGATATGCATCAGAGGAAGGCTGAGATGGCCAGGCAATCTGATGCCTTCATAGCAC 2229 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct 29505728 TGGCGGATATGCATCAGAGGAAGGCTGAGATGGCCAGACAATCTGATGCCTTCATAGCAC 29505669 Query 2230 TTCCTGGTATATATATAGCAACTTTTTT-AAGGGTTAATTAGATATGTGCTATTATAATT 2288 ||||||| |||||||| |||||||||| ||||||||||| ||| ||||||||||||||| Sbjct 29505668 TTCCTGG--TATATATAACAACTTTTTTAAAGGGTTAATTGGATCTGTGCTATTATAATT 29505611 Query 2289 TTATCGTTTTCTAAGCGTAATATTAATATTCGAGTTATTAAAACTCTACC----TATGTT 2344 |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| Sbjct 29505610 TTATCGTTTTCTAAGCGTAATATTAACATTCGAGTTATTAAAACTCTACCTATATATGTT 29505551 Query 2345 TGAGATACGCTGTTACCTACGTCTGGAATAGCAGAATAAATATCGTATACAATGGACAAG 2404 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 29505550 TGAGATACGCTGTTACCTACGTCTGGAATAGCAGAATAAATATCGTATACAATGGACAAG 29505491 Query 2405 ATTGCCC------TCTTTTTCTCTCACACTCACTAACACATGGAGCCCACTCGTCAGCCT 2458 ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 29505490 ATTGCCCTCCTTTTCTTTTTCTCTCACACTCACTAACACATGGAGCCCACTCGTCAGCCT 29505431 Query 2459 TTCATGCAGTCTCCTTCTTTTCTTCTATCTTT 2490 ||||||||||||| | |||||||||||||| Sbjct 29505430 TTCATGCAGTCTC---CGTTTCTTCTATCTTT 29505402 Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claims 1, 3, 6, 10 and 12 are rejected under 35 U.S.C. 103 as being unpatentable over Chen et al.(a) (The LONELY GUY gene family: from mosses to wheat, the key to the formation of active cytokinins in plants, 2022, Plant Biotechnology Journal, 20:625–645) and Wang et al. (A cytokinin-activation enzyme-like gene improves grain yield under various field conditions in rice, 2020, Plant Molecular Biology, 102:373–388) in view of Hirsch et al. Chen et al.(a) describes many LOG genes encoding cytokinin riboside 5-monophosphate phosphoribohydrolase proteins which convert inactive cytokinin nucleotides directly to the active free base form of cytokinin in plants including rice, wheat, Arabidopsis (abstract), cotton, Medicago sp., tomato, lotus, and kiwifruit (p.628, table 1). Overexpression of specific LOG gene(s) by using the heterologous 35S promoter (which reads on to “at least one mutation in a cis-regulatory promoter element of the endogenous LOG gene”, as recited in claims 1 and 3, and also in claim 12, considering the fact that the 35S promoter is inserted by deleting the endogenous LOG promoter) and specific mutations in specific LOG genes(s) in specific plants confer change in root architecture comprising root length and lateral root number in rice for LOG5 gene; reduced primary root length due to overexpression of a LOG gene in Medicago tranculata, decrease in number of lateral roots in Arabidopsis for LOG2, 4, 5, 7, 8 genes (as recited in claim 6); increased tolerance to salt/salinity (NaCl) which would increase yield (as recited in claim 6) under salinity or salt stress growing condition (for GhLOG3 gene) (page 627-628, Table 1). Chen et al.(a) also describes reduced, silenced, and/or knocked out expression of MtLOG1 gene confers increased density of lateral roots in Medico tranculata (Chen et al.(a), Table 1). With the reference to Wang et al., Chen et al.(a) describes that specific sequence edits around the 25 amino acid in the C-terminal end (page 636, right column, para 3, line 5-6) of the protein in a specific LOG gene (LOG5) in rice increased grain yield (page 627, Table 1). Reduced expression of OsLOGL6 and OsLOGL5 also leads to increased yield ((Chen et al.(a), page 636, right column, para 4, line 1-2)). Wang et al. describes mutations at the 3'-end of OsLOGL5 gene in monocot rice plants resulted in increased grain yield under well-watered, drought, normal nitrogen, and low nitrogen field conditions at multiple geographical locations (abstract). Wang et al. also describes overexpressing rice LOG5 gene using 35S promoter and also editing specific LOG gene using CRISPR-Cas technique (page 375, left column, para 3, line 1-7; bridging paragraph between page 375 and 376; page 379, right column, para 6, line 1-3). Wang et al. asserted that the C-terminal end of OsLOGL5 protein plays an important role in regulating rice yield improvement under different abiotic stress conditions, and OsLOGL5 is important for rice yield enhancement and stability (abstract, last 2 lines). Before the effective filing date of the invention, it would have been obvious to an ordinarily skilled artisan to overexpress one or more LOG gene(s) in corn. Number of LOG genes in corn genome was known to be finite. Searching published (before the effective filing date) corn genomes (as described by Hirsch et al.) using well-known and routine methods in the art would have enabled an ordinarily skilled artisan to identify LOG gene homologs/orthologues of the LOG gene(s) described by Chen et al.(a). Overexpression of corn LOG gene(s) can be achieved by deleting (as recited in claim 10) the cis-regulatory element(s) in the endogenous LOG gene promoter and inserting (as recited in claim 10) any well-known strong constitutive promoter like 35SCaMV promoter or maize ubiquitin 1 promoter and/or known transcription enhancer using the standard CRISPR-Cas based gene editing technique. It would also have been obvious to try choosing from a finite number of identified and predictable solutions with a reasonable expectation of success by an ordinarily skilled artisan to downregulate or knocking out one of more specific LOG gene(s) (from a limited number of known LOG genes) in monocot corn plants, as described by Chen et al.(a) for another monocot plant rice. Before the effective filing date, an ordinarily skilled artisan would have been motivated to overexpress specific corn LOG gene(s) with a realistic goal to modify root architecture comprising increased in root length, number of lateral roots, and/or increased grain yield under abiotic stress condition, as described by Chen et al.(a), in commercially important maize cultivar(s). An ordinarily skilled artisan would also have been motivated to downregulate or knocking out one or more specific LOG gene(s) including the ortholog(s) of rice OsLOG5 gene in corn plants to increase yield, as described by Chen et al.(a). Response to Applicant’s Arguments The argument set forth in Applicant’s reply on 6/25/2026 to the rejection of claims under 35 U.S.C. 103 has been fully considered but is not found persuasive. Regarding rejections under 35 U.S.C. 103, the Applicant argues, “… the combination of Chen and Wang fails describe a single LOG gene in corn by sequence or reference to an accession number” (response, p.10, para 3, line 2-4) and “there was no predictable expectation that a base deletion and/or base insertion in a cis-regulatory element of an endogenous LOG gene and/or in a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:75-78, 82-120 or 139-151 in corn would predictably, or even likely, result in a corn plant exhibiting a phenotype of a modified root architecture of a steeper root angle and/or longer roots and/or an improved yield trait of increased KRN and/or an ear width that is not substantially changed as claimed” (response, bridging para between p.11-12). It would have been obvious for an ordinarily skilled artisan to overexpress and/or downregulate specific LOG gene(s) in corn with a realistic objective to get same or similar trait as observed in other plants including another monocot plant rice, as described by Chen et al.(a) and Wang et al. The Examiner disagrees. Claim 1 recites, “… the at least one mutation is located in a cis-regulatory element of the endogenous LOG gene and/or…” . Thus, the “at least one mutation” does not need to be “in a region having at least 80% sequence identity to any one of the nucleotide sequences of SEQ ID NOs:75-78, 82-120 or 139-151… ”. Any mutation (comprising one or more base pair deletion and/or insertion in any of the cis-regulatory element(s) including promoter, terminator, or any other cis-regulatory element(s) would satisfy the claim limitations. Examiner acknowledges that Chen et al.(a) and Wang et al. do not explicitly teach any corn LOG gene. However, LOG family of genes in several corn cultivars were well known before the effective filing date, as taught by Hirsch et al. (as discussed above) and Chen et al.(b) (Structural variation at the maize WUSCHEL1 locus alters stem cell organization in inflorescences, 2021, Nature Communications, 12:2378; p.8, left column, para 2, line 1-5). The Applicant does not provide evidence to support the opinion that the method of Chen et al.(a) and Wang et al. would not work in corn. Applicant’s opinion cannot take the place of evidence (MPEP 716.01(c)(II), 2145(I)). The Applicant is reminded that the test for obviousness is not whether the features of a secondary reference may be bodily incorporated into the structure of the primary reference; nor is it that the claimed invention must be expressly suggested in any one or all of the references. Rather, the test is what the combined teachings of the references would have suggested to those of ordinary skill in the art. In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981). Explicit analysis for U.S. C. 103 obviousness rejections does not require record evidence of an explicit teaching of a motivation to combine in the prior art. See MPEP ¶ 2143. Conclusion Claims 1, 3, 6, 12, 20 and 115 are rejected. Claims 113-114 are free of prior art. However, the claims are objected to and not allowable as the base claims are rejected. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Communication Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAY CHATTERJEE whose telephone number is (703)756-1329. The examiner can normally be reached (Mon - Fri) 8.30 am to 5.30 pm.. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. Jay Chatterjee Patent Examiner Art Unit 1662 /Jay Chatterjee/Examiner, Art Unit 1662 /BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1661 & 1662
Read full office action

Prosecution Timeline

Show 3 earlier events
Jun 24, 2025
Examiner Interview Summary
Jul 15, 2025
Response Filed
Sep 23, 2025
Final Rejection mailed — §102, §103
Nov 05, 2025
Request for Continued Examination
Nov 06, 2025
Response after Non-Final Action
Mar 27, 2026
Non-Final Rejection mailed — §102, §103
Jun 25, 2026
Response Filed
Aug 10, 2026
Final Rejection mailed — §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12703870
REGULATION OF ROOT DEVELOPMENT
2y 2m to grant Granted Aug 11, 2026
Patent 12662514
METHODS TO BLOCK APHID TRANSMISSION OF POLEROVIRUSES AND TO DEVELOP VIRUS MANAGEMENT TOOLS
3y 6m to grant Granted Jun 23, 2026
Patent 12649926
USE OF MfERF026 GENE REGULATION IN GROWTH, DEVELOPMENT, AND STRESS TOLERANCE OF MEDICAGO SATIVA
2y 1m to grant Granted Jun 09, 2026
Patent 12642203
TOMATO PLANTS RESISTANT TO TOBRFV, TMV, TOMV AND TOMMV AND CORRESPONDING RESISTANCE GENES
2y 12m to grant Granted Jun 02, 2026
Patent 12635627
PLANTS RESISTANT TO INFECTION BY PEPINO MOSAIC VIRUS
2y 5m to grant Granted May 26, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

5-6
Expected OA Rounds
46%
Grant Probability
99%
With Interview (+80.0%)
2y 7m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 22 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month