Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of Group I, comprising claims 1, 3, 6, 10, 12, 15 and 20, in the reply filed on 2/20/2026 is acknowledged.
The Applicant elected the following species:
(a) SEQ ID NO:142, in claim 1
(b)(i) (polynucleotide) SEQ ID NO:125, in claim 20
(b)(ii) (polypeptide) SEQ ID NO:126, in claim 20
Claim 15 is indicated as withdrawn in accordance with this species election.
The requirement is still deemed proper and is therefore made FINAL.
Claim Status
Claims 1, 3, 6, 10, 12, 15, 20, 65-66, 68-69, 77-78, 93 are pending.
Claims 15, 65-66, 68-69, 77-78 and 93 are withdrawn from examination as part of non-elected groups.
Claims 1, 3, 6, 10, 12 and 20 are being examined.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1, 10 and 12 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Hirsch et al. (Draft Assembly of Elite Inbred Line PH207 Provides Insights into Genomic and Transcriptome Diversity in Maize, 2016, The Plant Cell, 28:2700–2714; Phytozome Gene Identifier: Zm00008a006863).
Hirsch et al. describes genomes of an elite corn inbred line PH207 and another elite corn line B73 as a reference genome (abstract). The corn genomes contain LOG genes, which encode cytokinin riboside 5'-monophosphate phosphoribohydrolase proteins, having at least one mutation and comprising more than 80% sequence identity compared to instant SEQ ID NO: 142 in different chromosomes (1-3 and 5) in corn line PH207, as shown below (in the box). The difference in sequence at any specific position is interpreted as a mutation.
One such example is in chromosome 1 in corn line PH207 comprising 89% sequence identity with SEQ ID NO: 142, is shown below.
>jgi:chr01_443 ZmaysPH207|443|v1.1, Length=302956453
Score = 79.7 bits (87), Expect = 5e-13, Identities = 54/61 (89%), Gaps = 0/61 (0%)
Query 83 GGTTCAGGAGGATCTGCGTCTTCTGCGGAAGCAGCCAGGGGAGGAAGAAGAGCTACCAGG 142
|||||| |||||||||||||||||| || ||||||||||||| |||| ||||||||| |
Sbjct 235122186 GGTTCAAGAGGATCTGCGTCTTCTGTGGCAGCAGCCAGGGGAAGAAGGCGAGCTACCATG 235122127
Query 143 A 143
|
Sbjct 235122126 A 235122126
Another example is in chromosome 2 in line B73, comprising 84% sequence identity with SEQ ID NO: 142, as shown below. That gene encodes a LOG6 protein (Gene ID:
Zm00008a006863).
>jgi:1_833 Zmays|833|Zm-B73-REFERENCE-NAM-5.0.55|dna:chromosome chromosome:Zm-B73-REFERENCE-NAM-5.0:1:1:308452471:1, REF Length=308452471
Identities = 51/61 (84%), Score = 66.2 bits (72), Expect = 3e-08, Gaps = 0/61 (0%)
Query 83 GGTTCAGGAGGATCTGCGTCTTCTGCGGAAGCAGCCAGGGGAGGAAGAAGAGCTACCAGG 142
|||||| || |||||| ||||||||||| |||||| | |||| || || ||||||||| |
Sbjct 58638315 GGTTCACGACGATCTGTGTCTTCTGCGGCAGCAGCGAAGGGAAGAGGACGAGCTACCACG 58638256
Query 143 A 143
|
Sbjct 58638255 A 58638255
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 1, 3, 6, 10 and 12 are rejected under 35 U.S.C. 103 as being unpatentable over Chen et al. (The LONELY GUY gene family: from mosses to wheat, the key to the formation of active cytokinins in plants, 2022, Plant Biotechnology Journal, 20:625–645) and Wang et al. (A cytokinin‑activation enzyme‑like gene improves grain yield under various field conditions in rice, 2020, Plant Molecular Biology, 102:373–388).
Chen et al. describes many LOG genes encoding cytokinin riboside 5-monophosphate phosphoribohydrolase, which converts inactive cytokinin nucleotides directly to the active free base form of cytokinin (abstract), in plants including rice, Arabidopsis, cotton and alfalfa. Overexpression of LOG gene(s) by using 35S promoter confers longer roots (as recited in claim 6) in rice; increased number of lateral roots in Arabidopsis; increased tolerance to salt/salinity (NaCl), which would increase yield (as recited in claim 6) under salinity or salt stress growing condition, in cotton (page 627-628, Table 1). Chen describes reduced, silenced, and/or knocked out expression of LOG gene(s) confer increased density of lateral roots in alfalfa (Chen et al., Table 1). With the reference to Wang et al., Chen et al. describes that specific sequence edits around the 25 amino acid in the C-terminal end (page 636, right column, para 3, line 5-6) of the protein in a specific LOG gene (LOG5) in rice increased grain yield (page 627, Table 1). Reduced expression of OsLOGL6 and OsLOGL5 also leads to increased yield (Chen et al., page 636, right column, para 4, line 1-2).
Wang et al. describes mutations at the 3'-end of OsLOGL5 gene resulted in increased grain yield under well-watered, drought, normal nitrogen, and low nitrogen field conditions at multiple geographical locations (abstract). Wang et al. also describes overexpressing rice LOG5 gene using 35S promoter and also editing specific LOG gene using CRISPR-Cas technique (page 375, left column, para 3, line 1-7; bridging paragraph between page 375 and 376; page 379, right column, para 6, line 1-3).
Before the effective filing date of the invention, it would have been obvious to an ordinarily skilled artisan to overexpress a LOG gene in corn with realistic goal to engineer root system comprising increase in root length, as described by Chen et al. Overexpression of the corn LOG gene can be achieved by replacing or substituting (as recited in claim 10) the cis-regulatory element in the endogenous LOG gene promoter (as recited in claim 3) with well-known 35SCaMV promoter (or any other well-known and widely used constitutive promoter including the ones from corn itself, e.g. maize ubiquitin 1 promoter) using the standard CRISPR-Cas based gene editing technique.
It would also have been obvious for the artisan to reduce or silence the expression of specific LOG gene(s) with a realistic goal to engineer the root architecture by increasing the density of lateral roots, as shown in alfalfa, and/or increased grain yield, as observed in rice (as described by Chen et al.), in corn. One of ordinary skill in the art would have also expected that specific edits by base substitutions (as recited in claim 10) of specific LOG gene(s), as described by Wang et al. in rice LOG5 gene (page 380, Fig. 5), in corn, would also have conferred increased grain yield, as shown in rice and as described by Chen et al. and Wang et al. Downregulation or silencing would have been achieved by deleting (as recited in claim 12) the cis regulatory sequence comprising the promoter element(s) in the LOG gene(s) using the standard CRISPR-Cas based technique. Such deletion and/or substitution mutations can also be achieved by well-known standard methods like chemical, physical or biological mutagenesis and then screening the mutant population for specific mutation in the cis-acting elements in the LOG genes conferring economically valuable traits in commercially important corn varieties/cultivars.
Before the effective filing date, an ordinarily skilled artisan would have been motivated to overexpress specific corn LOG gene(s) with a realistic goal to increase number of lateral roots; and/or increased salt tolerance by replacing the cis-regulatory element in the endogenous LOG gene promoter in corn with well-known 35SCaMV promoter using the standard CRISPR-Cas based gene editing technique. The ordinarily skilled artisan would also have been motivated to reduce or silence the expression of specific LOG gene(s) with a realistic goal to enhance lateral root density and/or increase in yield in corn.
Conclusion
Claims 1, 3, 6, 10, 12 are rejected.
Claims 20 is free of prior art. However, the claims are objected to and not allowable as the base claims are rejected.
Communication
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAY CHATTERJEE whose telephone number is (703)756-1329. The examiner can normally be reached (Mon - Fri) 8.30 am to 5.30 pm..
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
Jay Chatterjee
Patent Examiner
Art Unit 1662
/Jay Chatterjee/Examiner, Art Unit 1662
/BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1661 & 1662
Prosecution Insights