DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Information Disclosure Statement
The information disclosure statements (IDS) submitted on 05/11/2023 are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner.
Objection to Drawings
The drawings are objected to as failing to comply with 37 CFR 1.84(p)(5) because they do not include the following reference sign(s) mentioned in the description:.
In the specification, under “Brief Description of the Figures” at pages 6-7, it states :
“Figures. 4A-4B are graphs showing enrichment using families of TACS versus a single TACS, as illustrated by increase in the average read-depth. Figure. 4A shows loci enriched using a family of TACS (square symbol) as compared to loci enriched using a single TACS (X symbol), with different target sequences shown on the X-axis and the fold change in read-depth shown on the Y-axis. “
Thus, according to the specification, the reference sign for “single TACS” should be indicated in the drawings using “X symbol.” However, Figure 4A does not include such symbol.
PNG
media_image1.png
594
802
media_image1.png
Greyscale
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Status of Claims
This office action is in response to Applicant's Response to Election / Restriction filed on December 19, 2025.
Claims 1-13 are currently pending, with claims 4, 6-7 and 9-10 withdrawn.
Claims 1-3, 5, 8 and 11-13 are under examination. This is the first action on the merits.
Election/Restrictions
Applicant's election with traverse of the following species in the reply filed on December 19, 2025 is acknowledged:
Species of member sequence binding position: C) each member sequence has different start and stop positions with respect to a reference coordinate system for the genomic sequence of interest (claim 1);
Species of pool of TACS: D) the pool of TACS comprises at least 2 TACS families (claim 3) 1;
Species of member sequences binding: G) the member sequences bind to all chromosomes within the human genome (claim 8)2;
Species of start and/or stop positions: I) the start and/or stop positions of the member sequences are staggered by at least 3 base pairs (claim 2)3;
Species of additional Kit component: Species Q - a combination of - i) one or more components for isolating cell free DNA from a biological sample (claim 13) and (ii) one or more components for preparing the sequencing library comprising primers, adapters, buffers, linkers, restriction enzymes, ligation enzymes and polymerase enzymes (claim 13).
Applicant's traversal is on the ground that there is no undue search burden (Remarks, page 6). This is not found persuasive because MPEP §818.01 states a traverse must include a written statement of the reasons for traverse, distinctly and specifically pointing out the supposed errors upon which the applicant relies for concluding that the requirement is in error.
MPEP§ 803 sets forth two criteria for a proper requirement for restriction between patentably distinct inventions:
• (A) The inventions must be independent (see MPEP § 802.01, § 806.06, § 808.01) or distinct as claimed (see MPEP § 806.05 - § 806.05(j)); and
• (B) There would be a serious search and/or examination burden on the examiner if restriction is not required (see MPEP § 803.02, § 808, and § 808.02).
MPEP§ 803 further states: "An election of species requirement is a type of restriction requirement."
Applicant argues that "the claims do not incur undue search burden"; however, this argument is unpersuasive because Applicant's remarks are made in a generic manner and are not specific to any particular species or species group. Thus, the traversal by the applicant lacks argument that distinctly and specifically point out the reasons why this requirement for species election is improper.
Furthermore, Applicant's assertion that "the foregoing search requires the same components to the kit comprising a pool of TArget Capture Sequences (TACS)" is incorrect. Each species is presented in the claims as an alternative, meaning the species are directed to alternative kits with patently distinct features. For instance, a search adequate for species A does not cover the features and elements as required by other species such as species B or C. This discrepancy underlines the necessity for separate consideration of each species to ensure a thorough examination process. Therefore, the restriction requirement as initially imposed is properly maintained and is therefore made FINAL.
In this instant case, the requirement for species election is properly made.
As stated in the restriction requirement (mail date 10/24/2025), and reiterated here:
The species are independent or distinct because the different species recite separate characteristics of such species, and there is no disclosure of relationship between species (see MPEP § 806.04(b)). In addition, these species are not obvious variants of each other based on the current record. The species necessitate separate searches, leading to serious search and/or examination burden (see MPEP § 808.01(a)) because the species of member sequence binding position reflect different functional requirements for the claimed member sequences, resulting in separate research requirements; the species of pool of TACS reflect different structural characteristics, requiring separate searches; the species of member sequences binding reflect different functional requirements, resulting in separate searches; the species of start and/or stop positions reflect different structural and functional requirements, requiring separate searches; the species of additional Kit component reflect different kit compositions, resulting in separate searches.
Additionally, there is a serious search and/or examination burden for the patentably distinct species as set forth above because at least the following reason(s) apply: The species require a different field of search (e.g., searching different classes/subclasses or electronic resources, or employing different search queries); and/or the prior art applicable to one species would not likely be applicable to another species; and/or the species are likely to raise different non-prior art issues under 35 U.S.C. 101 and/or 35 U.S.C. 112, first paragraph.
Therefore, these species in the species groups are directed to independent and patentably distinct inventions, and there would be a serious search and/or examination burden if species election is not required. The requirement is still deemed proper and is therefore made FINAL.
Claims 4, 6-7 and 9-10 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention.
Examination on the merits commences on claims 1-3, 5, 8 and 11-13.
Priority
The priority date of the instant claims 1-3, 5, 8 and 11-13 is 07/07/2017, filling date of the US provisional application NO. 62/529,790.
Claim Interpretation
In evaluating the patentability of the claims presented in this application, claim terms have been given their broadest reasonable interpretation (BRI) consistent with the specification, as understood by one of ordinary skill in the art, as outlined in MPEP§ 2111.
For the purpose of applying prior art, claim 1 recites "a pool of TArget Capture Sequences (TACS)."
The specification provides definition for the term "TArget Capture Sequences (TACS)" as follows:
"As used herein, the term “TArget Capture Sequences” or “TACS” refers to short DNA sequences that are complementary to the region(s) of interest on a genomic sequence(s) of interest (e.g., chromosome(s) of interest) and which are used as “bait” to capture and enrich the region of interest from a large library of sequences, such as a whole genomic sequencing library prepared from a biological sample. " (page 50, lines 1-5)
Accordingly, "a pool of TArget Capture Sequences (TACS)" is interpreted as a collection of at least two short DNA nucleic acids.
For the purpose of applying prior art, claim 1 recites a "reference coordinate system," which is a term not expressly defined by the specification.
The specification at page 53, lines 23-27 provides the following relevant description:
"In one embodiment, the pool of TACS comprises a plurality of TACS families directed to different genomic sequences of interest. Each TACS family comprises a plurality of members that bind to the same genomic sequence of interest but having different start and/or stop positions with respect to a reference coordinate system for the genomic sequence of interest.
Typically, the reference coordinate system that is used for analyzing human genomic DNA is the human reference genome built hg19, which is publically available in the art, but other coordinate systems may also be used. Alternatively, the reference coordinate system can be an artificially created genome based on built hg19 that contains only the genomic sequences of interest."
Thus, under BRI and in light of the specification, the term "reference coordinate system" is interpreted to encompass any sequence or collection of sequences that can be used as reference for nucleotide positions.
For the purpose of applying prior art, claim 1 recites TArget Capture Sequences (TACS) family comprising member sequences. However, the claim does not specify any sequence feature of the member sequences. Instead, the claim recites only functional language, such as "each member sequence binds to the same genomic sequence of interest," without specifying either the sequence of the member sequences or the identity or structure of the genomic sequence of interest.
Accordingly, under BRI, the member sequences are interpreted to encompass any DNA nucleic acids, 100-500 base pairs in length (recited in claim 1), capable of binding to any genomic sequence.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
Claims 1-3, 5, 8 and 11-13 are rejected under 35 U.S.C. 112(b), as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 1, it recites "each member sequence binds to the same genomic sequence of interest at least 50 base pairs away, on both the 5' end and the 3' end, from regions harboring Copy Number Variations (CNVs), Segmental duplications or repetitive DNA elements," which is indefinite for several reasons.
First, it is unclear what qualifies as "the same genomic sequence of interest." The claim is directed to a kit comprising "a plurality of member sequences," and the context indicates that these member sequences refer to physical entities (e.g., DNA oligonucleotides).
The claim further recites that each member sequence binds to "the same genomic sequence of interest," but also "at least 50 base pairs away," implying that the member sequences possibly bind to different locations. It is therefore unclear how to determine what constitutes "the same genomic sequence of interest," and whether it refers to a physical molecule, or a conceptual sequence.
If "genomic sequence of interest," similar to "member sequence," refers to a physical molecule (e.g., genomic DNA), it is unclear whether two member sequences binding to separate fragments generated after fragmentation would still be considered as binding to the same genomic sequence.
Alternatively, if "genomic sequence of interest" refers to a conceptual sequence (e.g., a reference sequence from a database such as GenBank), the definition becomes subjective, as any genomic region can be arbitrarily subdivided into subregions (e.g., chromosomes, genes, ORFs, promoters, etc.). For example, two member sequences may bind within the same chromosome but to different gene regions. Whether they bind to "the same genomic sequence of interest" would then depend on a subjective definition of what is "of interest." The specification does not clearly define the term "genomic sequence of interest" or provide criteria for determining what qualifies. As a result, the scope of the claim is ambiguous.
Second, it is unclear whether "at least 50 base pairs away" refers to the distance between the member sequences and the regions harboring CNVs, Segmental duplications or repetitive DNA elements; between the member sequences, or both.
Third, it is unclear how the "at least 50 base pairs" distance is to be measured. It is not clear whether "on both the 5' end and the 3' end" refers to the ends of the member sequences or the ends of the regions harboring CNVs, Segmental duplications or repetitive DNA elements. Therefore, the claim does not have clear metes and bounds.
For the purpose of compact prosecution and applying prior art under 35 USC§ 102 and 103, this limitation is interpreted to require the binding targets of member sequences to be apart from each other and from the recited regions when mapped to a reference sequence (e.g.. reference genome), since any unspecified genomic sequence could be located at least 50 base pairs away from another sequence and from genomic variant regions (e.g. regions harboring CNVs) located elsewhere in a genome.
Claims 2-3, 5, 8 and 11-13 are rejected for depending from claim 1 and not remedying the indefiniteness.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-3, 5, 8 and 11-13 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea) without significantly more.
Independent claim 1 is drawn to a kit, comprising:
a pool of TArget Capture Sequences (TACS),
wherein the pool of TACS comprises a plurality of TACS families,
wherein each TACS family comprises a plurality of member sequences,
wherein each member sequence binds to the same genomic sequence of interest but has different start and/or stop positions with respect to a reference coordinate system for the genomic sequence of interest, and further
wherein:
(i) each member sequence within each TACS family is between 100-500 base pairs in length, each member sequence having a 5' end and a 3' end;
(ii) each member sequence binds to the same genomic sequence of interest at least 50 base pairs away, on both the 5' end and the 3' end, from regions harboring Copy Number Variations (CNVs), Segmental duplications or repetitive DNA elements; and
(iii) the GC content of the pool of TACS is between 19% and 80%, as determined by calculating the GC content of each member within each family of TACS.
Therefore, the claims are directed to a nucleic acid fragments between 100-500 base pairs in length, with undefined sequence.
Following the analysis below the claims are not patent eligible under 35 U.S.C. 101.
Step 1 - Whether the Claim is to a Statutory Category : YES. The claims are drawn to sets of oligonucleotides, therefore to one of the of statutory categories.
Step 2A
According to MPEP § 2106, Step 2A is a two-prong inquiry, in which examiners determine in Prong One whether a claim recites a judicial exception, and if so, then determine in Prong Two if the recited judicial exception is integrated into a practical application of that exception. Together, these prongs represent the first part of the Alice/Mayo test, which determines whether a claim is directed to a judicial exception.
Step 2A Prong 1 - Whether the Claim Recite an Abstract idea, Law of Nature, or Natural Phenomenon: Yes.
The claims recite nucleic acid fragments without specifying any unique, markedly different characteristics compared to what occurs in nature. As stated in MPEP 2106.04(b)(I), laws of nature and natural phenomena, as identified by the courts, include naturally occurring principles/relations and nature-based products that are naturally occurring or that do not have markedly different characteristics compared to what occurs in nature.
The courts have identified that "short, synthetic, single-stranded DNA molecule[s] that bind specifically to … intended targets nucleotide sequence[s]" are products of nature because they claim the same nucleotide sequence as naturally occurring DNA. See University of Utah Research Foundation v. Ambry Genetics Corp., 774 F.3d 755, 761, 113 USPQ2d 1241, 1244 (Fed. Cir. 2014). See also MPEP 2106. In this instant case, the member sequences bind to a genome, which is a naturally occurring DNA. Thus, these short DNA molecules are products of nature.
Applicant does not claim any specific structural feature or characteristics, that could distinguish the claimed member sequences (defined in the specification as short DNA sequences) from naturally occurring nucleic acid sequences.
The claim recites "the GC content of the pool of TACS is between 19% and 80%," which encompasses the GC content range of naturally occurring nucleic acid sequences such as the human genome 4.
Thus, the member sequences recited in claim 1 are classified as nature-based products because they do not have markedly different characteristics compared to what occurs in nature. In conclusion, the claims recite nature-based products.
Step 2A Prong 2 - Whether the Claim Recite Additional Elements that Integrate the Judicial Exception into a Practical Application: No. The claim as a whole do not integrates the exception into a practical application of that exception.
For a claim reciting a judicial exception to be eligible, the additional elements (if any) in the claim must “transform the nature of the claim” into a patent-eligible application of the judicial exception, Alice Corp., 573 U.S. at 217, 110 USPQ2d at 1981.
In this instant case, the claim does not recite any additional element (such as a detectable label), that transform the claimed nature-based products to something that are markedly different than their naturally occurring counterparts in their natural state.
Since the claim is directed to a kit, which is a product, it is limited by its structural features. Therefore, the analysis of whether the claim integrates a judicial exception into a practical application does not apply, as intended use without related structural feature does not impose a meaningful limitation on a product claim.
See MPEP§ 2111.04:
"Claim scope is not limited by claim language that suggests or makes optional but does not require steps to be performed, or by claim language that does not limit a claim to a particular structure."
See MPEP 2106:
“A claim that integrates a judicial exception into a practical application will apply, rely on, or use the judicial exception in a manner that imposes a meaningful limit on the judicial exception, such that the claim is more than a drafting effort designed to monopolize the judicial exception.”
However, if the claim specifically recite a detectable label (e.g., biotin, see specification at page 53) attached to the member sequences, it would likely overcome the 101 rejection, as it would provide the requisite distinction from nature-based products.
Step 2B - Whether a Claim Amounts to Significantly More: No.
According to MPEP§ 2106.05, The second part of the Alice/Mayo test is often referred to as a search for an inventive concept. Alice Corp. Pty. Ltd. v. CLS Bank Int'l, 573 U.S. 208, 217, 110 USPQ2d 1976, 1981 (2014) (citing Mayo Collaborative Servs. v. Prometheus Labs., Inc., 566 U.S. 66, 71-72, 101 USPQ2d 1961, 1966 (2012)). An “inventive concept” is furnished by an element or combination of elements that is recited in the claim in addition to (beyond) the judicial exception, and is sufficient to ensure that the claim as a whole amounts to significantly more than the judicial exception itself. Alice Corp., 573 U.S. at 27-18, 110 USPQ2d at 1981 (citing Mayo, 566 U.S. at 72-73, 101 USPQ2d at 1966).
In this instant case, the claims, when considered as a whole, do not recite any inventive concept with additional elements that amount to significantly more than the judicial exception. The claims do not appear to add markedly different characteristics that significantly modify the naturally occurring oligonucleotides in a manner that is not naturally occurring.
The dependent claims do not recite additional elements that amount to significantly more than the judicial exception, as they represent mere general linkage of the judicial exception to the additional elements in the claims (MPEP § 2106.05(h)).
In conclusion, the claims are not patent eligible under 35 U.S.C. 101.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-3, 5, 11 and 13 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by
KOUMBARIS et al. (US20160340733A1 - Multiplexed parallel analysis of targeted genomic regions for non-invasive prenatal testing; published 2016-11-24; cited as U.S. patent document “M” in IDS filed on IDS - 05/11/2023 ; herein after “Koumbaris1” )5
Regarding claim 1, Koumbaris1 teaches a kit comprising a container comprising a pool of TArget Capture Sequences (TACS) (entire document, see [0088]) ,
wherein the pool of TACS comprises a plurality of TACS families ([0094]; Fig. 2) ,
wherein each TACS family comprises a plurality of member sequences([0094]; Fig. 2),
wherein each member sequence binds to the same genomic sequence of interest but has different start and/or stop positions with respect to a reference coordinate system for the genomic sequence of interest (Figure 2), and further
wherein:
(i) each member sequence within each TACS family is between 100-500 base pairs in length, each member sequence having a 5' end and a 3' end ([0094] “TACS range from 100-260 bp in size and are generated through a PCR-based approach”; Fig. 2);
(ii) each member sequence binds to the same genomic sequence of interest at least 50 base pairs away, on both the 5' end and the 3' end, from regions harboring Copy Number Variations (CNVs), Segmental duplications or repetitive DNA elements ([0055]); and
(iii) the GC content of the pool of TACS is between 19% and 80% ([0059]), as determined by calculating the GC content of each member within each family of TACS.
Regarding claim 2, Koumbaris1 teaches wherein the start and/or stop positions of the member sequences are staggered by at least 3 base pairs (Fig. 2).
Regarding claim 3, Koumbaris1 teaches wherein the pool of TACS comprises at least 2 TACS families (Fig.2 ).
Regarding claim 5, Koumbaris1 teaches wherein each TACS family comprises at least 2 member sequences (Fig. 2).
Regarding claim 11, Koumbaris1 teaches wherein the different member sequences have different % GC content ([0059]).
Regarding claim 13, Koumbaris1 teaches wherein the kit further comprises one or more of the following:(i) one or more components for isolating cell free DNA from a biological sample and (ii) one or more components for preparing the sequencing library comprising primers, adapters, buffers, linkers, restriction enzymes, ligation enzymes and polymerase enzymes ([0088]).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-3, 5, 11 and 13 are rejected under 35 U.S.C. 103 as being unpatentable over
Koumbaris et al. (Cell-Free DNA Analysis of Targeted Genomic Regions in Maternal Plasma for Non-Invasive Prenatal TestingClin. Chem., vol. 62, supplemental material pp. 1-33; Epub 2016 Apr; hereinafter “Koumbaris2”), as evidenced by
UCSC Genome Browser (Kent et al. The human genome browser at UCSC. Genome Res. 2002 Jun;12(6):996-1006; genome.ucsc.edu) ;
Romiguier (Romiguier, J. et al., Contrasting GC-content dynamics across 33 mammalian genomes: Relationship with life-history traits and chromosome sizes, Genome Res., vol. 20, pp. 1001-1009 ; 2010);
Dunham (Dunham, A. et al., The DNA sequence and analysis of human chromosome 13, Nature, vol. 428, pp. 522-528; 2004);
Weiner (Weiner et al. Kits and their unique role in molecular biology: a brief retrospective. Biotechniques. 2008 Apr;44(5):701-4. doi: 10.2144/000112796. PMID: 18474048.)
A) Koumbaris2 teaches an assay based on the targeted analysis of cell-free DNA for the detection of fetal aneuploidies, using custom target capture sequences (TACS) for target enrichment via hybridization, followed by downstream DNA analysis (entire document).
Regarding claim 1, Koumbaris2 teaches a pool of TArget Capture Sequences (TACS),
wherein the pool of TACS comprises a plurality of TACS families (page 849, last paragraph; page 850, first paragraph; supplemental data),
wherein each TACS family comprises a plurality of member sequences (supplemental data),
wherein each member sequence binds to the same genomic sequence of interest but has different start and stop positions with respect to a reference coordinate system for the genomic sequence of interest (supplemental data).
As can be seen from the supplemental data, Koumbaris2 teaches a plurality of TAC families comprising various member sequences that target the same chromosome but has different start and stop positions, for example, a TAC family which binds to chromosome 13, another which binds to chromosome 18, etc.
Koumbaris2 further teaches (i) each member sequence within each TACS family is between 100-500 base pairs in length, each member sequence having a 5' end and a 3' end (page 849, last paragraph; page 850, first paragraph; supplementary data, Custom target capture sequences (TACS) of approximately 250 bp);
(ii) each member sequence binds to the same genomic sequence of interest at least 50 base pairs away (supplementary data), on both the 5' end and the 3' end, from regions harboring repetitive DNA elements (Supplemental data, see TACS for chr 13 for example, which bind to genomic sequences at least 50 bases away from the region chr13:19521707-19521779, harboring repetitive DNA elements, see UCSC Genome Browser; genome.ucsc.edu, specific page attached).
Koumbaris2 also teaches that the targeted regions avoid copy number variations and other complex genomic architectural elements (page 852, third paragraph; page 849, right-hand col, para 2). Thus it would have been obvious for a skilled artisan to design and prepare TACS that targets loci that are away from regions harboring Copy Number Variations (CNVs).
Finally, regarding the GC content of the TACs sequences, Koumbaris2 teaches TACs sequences having GC content between 19% and 80% in its supplemental data. For examples, chr13: 19520254-19520499 has GC content of 29.4 %; chr13: 19523790-19524042 has GC content of 39.7%.
>ref|NC_000013.10|:19520254-19520499 Homo sapiens chromosome 13, GRCh37.p13 Primary Assembly
GC content: 29.4 %
ACTGTTGGCAACTCTTAGATATTCTCTACTGGATACATGCATATATATCACATAGAA ATGTGACTAACCCATAAGGAAAAGAACTGGAGAATAACTTAGTAACAGCATTATTATTATGCTCAGAGGCTCAGTAAAATACATATACATAGAACTATAACTCAAATTTAAAGTTTACATGTATAAATGTATTACTGTAAATATACATCCACTGATACATGAAACAATCACAACAGTCTGATTATATT
>ref|NC_000013.10|:19523790-19524042 Homo sapiens chromosome 13, GRCh37.p13 Primary Assembly
GC content: 39.7%
GCTGGCGAATCAATGAGCAACGTCTAACTAGTTGGCATGAAAAATAATACATTAATCCCCC
AATTATCATACCCAAATCCTCTCTTTTTCCCCCAGCTGTAAACACTGAACAAACTACCCATGACAAATTAACATATTTTCCTCCATTTTCTTCAGCTGTTTTTCCAAGCAGTCCATACTTAAAACAGAACAAATGGACCATCAAAAACTGACCTACGCTCCAAATGGGAGATTTTGGGAGAGGAACTGCCT
Since the TACs sequences are designed to hybridize to and be complementary to their target sequences, their GC content corresponds to that of the target. As evidenced by Dunham, Human chromosome 13 has a GC content of is 38.5% (Table 2). And the overall human genome has a GC content of 46.1 % (see Romiguier, Table 1). Both are well within the claimed range.
While Koumbaris2 teaches an assay using TACs sequences as claimed, it does not explicitly teach a kit comprising such sequences. However, including assay reagents in a kit is an insignificant extra-solution activity that does not impose a meaningful limitation on a product claim. See 2106.05(g).
MPEP 2106.05 states:
“As explained by the Supreme Court, the addition of insignificant extra-solution activity does not amount to an inventive concept, particularly when the activity is well-understood or conventional.”
In this instant case, it is well known in the field of molecular biosciences that assay reagents are routinely provided in kits (see Weiner, entire document, see introduction, para 1, for example).
Koumbaris2 clearly teaches a molecular assay comprising all the recited components of the claimed kit. Therefore, the preamble "a kit comprising a container… " reflects a mere extra-solution activity that does not amount to an inventive concept.
Moreover, assembling assay components into a kit is an obvious design choice for an assay. Weiner teaches the advantages of a kit, such as "ease of use, clear instructions, a good troubleshooting guide, a rapid protocol, and, of course, reliability and reproducibility." (page 701, middle col).
Weiner further provides express motivation for putting assay components in a kit:
"Does every home baker really need to have all of the raw ingredients and an understanding of baking chemistry to make a batch of brownies with nuts and chocolate chips? Or will a prepackaged mix produce sufficient results? Like cake mixes, the use of kits liberated researchers from the mundane tasks of mixing reagents and ensuring their quality, freeing them up for the more significant task of understanding the biology." (page 703)
Accordingly, it would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to place the assay components disclosed in Koumbaris2 in a kit, motivated by the teachings in Weiner.
The person of ordinary skill would have had a reasonable expectation of success, as kitting assay reagents is a well-known practice of combing known elements with known functions for expected use and outcome.
B) Regarding claim 2, Koumbaris2 teaches wherein the start and/or stop positions of the member sequences are staggered by at least 3 base pairs(supplementary data).
Regarding claim 3, Koumbaris2 teaches wherein the pool of TACS comprises at least 2 TACS families(supplementary data).
Regarding claim 5, Koumbaris2 teaches wherein each TACS family comprises at least 2 member sequences (supplementary data).
Regarding claim 11, Koumbaris2 teaches wherein the different member sequences have different % GC content (supplementary data; page 851, third paragraph).
Regarding claim 13, Koumbaris2 teaches component for isolating cell free DNA from a biological sample (page 849, left-hand col, para 5 “SAMPLE COLLECTION AND PREPARATION,” ffDNA was extracted from 4 mL plasma using theQiasymphony DSP Virus/Pathogen Midi Kit (Qiagen). ); ligation enzymes (page 849, right-hand col, para 1, T4 DNA ligase).
Claims 8 and 12 are rejected under 35 U.S.C. 103 as being unpatentable over Koumbaris2, as applied to claim 1 above and further in view of
Majumdar (Majumdar et al. Preimplantation genetic screening for all 24 chromosomes by microarray comparative genomic hybridization significantly increases implantation rates and clinical pregnancy rates in patients undergoing in vitro fertilization with poor prognosis. J Hum Reprod Sci. 2016 Apr-Jun;9(2):94-100. doi: 10.4103/0974-1208.183512. PMID: 27382234; PMCID: PMC4915293).
A) The teachings of Koumbaris2 are recited above and applied as for base claim 1.
Regarding claim 8, while Koumbaris2 teaches an prenatal assay for the detection of fetal aneuploidies of chromosomes 21, 18, and 13 (entire document, see methods for example), via the binding of TACS sequences to target chromosomes ; it does not explicitly teach assaying all chromosomes within the human genome.
Majumdar teaches a need for improved methods for preimplantation genetic screening, noting that methods capable of analyzing all 24 human chromosomes would likely remedy the shortcomings of earlier approaches that screened only a subset of chromosomes (page 95, left-hand col, paras. 1-3).
Accordingly, it would have been prima facie obvious to a person of ordinary skill in the art, in view of Koumbaris2 and Majumdar, before the effective filing date of the claimed invention to expand the TACS library in the assay of Koumbaris2 to include all 24 chromosomes as binding targets. Majumdar provides a clear motivation ꟷ such modification would improve detection of aneuploidies in prenatal assays and also enable broader applications in preimplantation genetic screening.
B) Regarding claim 12, Majumdar teaches in IVF Pre-implantation Genetic Screening (PGS) (entire document).
Double Patenting- Same Invention
A rejection based on double patenting of the “same invention” type finds its support in the language of 35 U.S.C. 101 which states that “whoever invents or discovers any new and useful process... may obtain a patent therefor...” (Emphasis added). Thus, the term “same invention,” in this context, means an invention drawn to identical subject matter. See Miller v. Eagle Mfg. Co., 151 U.S. 186 (1894); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Ockert, 245 F.2d 467, 114 USPQ 330 (CCPA 1957).
A statutory type (35 U.S.C. 101) double patenting rejection can be overcome by canceling or amending the claims that are directed to the same invention so they are no longer coextensive in scope. The filing of a terminal disclaimer cannot overcome a double patenting rejection based upon 35 U.S.C. 101.
Claim 1 is provisionally rejected under 35 U.S.C. 101 as claiming the same invention as that of claim 10 of copending Application No. 18/926,874 (reference application, see claims filed 10/25/2024). This is a provisional statutory double patenting rejection since the claims directed to the same invention have not in fact been patented.
Double Patenting- Obvious Type
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 3, 5 and 11 are rejected on the ground of nonstatutory obviousness-type double patenting as being unpatentable over claims 1, 3 and 13-18 of U.S. Patent No. 11111538B2 in view of Samorodnitsky (Samorodnitsky et al. Evaluation of Hybridization Capture Versus Amplicon-Based Methods for Whole-Exome Sequencing. Hum Mutat. 2015 Sep;36(9):903-14. doi: 10.1002/humu.22825. Epub 2015 Jul 15. PMID: 26110913; PMCID: PMC4832303).
Instant claim 1 recites:
A kit comprising a container comprising a pool of TArget Capture Sequences (TACS),
wherein the pool of TACS comprises a plurality of TACS families (‘538 Patent, claim 1) ,
wherein each TACS family comprises a plurality of member sequences(‘538 Patent, claim 1),
wherein each member sequence binds to the same genomic sequence of interest but has different start and/or stop positions with respect to a reference coordinate system for the genomic sequence of interest, and further
wherein:
(i) each member sequence within each TACS family is between 100-500 base pairs in length, each member sequence having a 5' end and a 3' end(‘538 Patent, claim 1);
(ii) each member sequence binds to the same genomic sequence of interest at least 50 base pairs away, on both the 5' end and the 3' end, from regions harboring Copy Number Variations (CNVs), Segmental duplications or repetitive DNA elements(‘538 Patent, claim 1); and
(iii) the GC content of the pool of TACS is between 19% and 80% (‘538 Patent, claim 1), as determined by calculating the GC content of each member within each family of TACS.
The claims of the ‘538 patent largely overlap with the instant claim 1. While the ‘538 patent discloses TArget Capture Sequences (TACS), it does not specifically claim TACS member sequence binds to the same genomic sequence of interest but has different start and/or stop positions.
Samorodnitsky fills this gap by teaching that staggered probes (i.e., probes having different start and stop binding positions within the same sequence of interest) is well-known in the application of nucleic acid target enrichment via hybridization (entire document, see Fig. 1B for example).
Therefore, it would have been obvious for one of ordinary skill in the art to use staggered probes design as taught by Samorodnitsky in while preparing the TArget Capture Sequences in '538 patent, because both references are in the overlapping field of molecular biology assays, specifically target enrichment via hybridization. The use of a staggered probe design in preparing '538 patent's TArget Capture Sequences represents a predictable use of prior art elements according to known methods to yield predictable results (see MPEP §2143).
Therefore, instant claim1 is obvious over claim 1 of the '538 patent, in view of Samorodnitsky. Instant claims 3, 5 and 11 are obvious over claims 1, 3 and 13-18 of the '538 patent, in view of Samorodnitsky.
Claims 1, 3 and 5 are rejected on the ground of nonstatutory obviousness-type double patenting as being unpatentable over claims 1 and 6-7 of U.S. Patent No. 12421551B2 in view of Samorodnitsky (Samorodnitsky et al. Evaluation of Hybridization Capture Versus Amplicon-Based Methods for Whole-Exome Sequencing. Hum Mutat. 2015 Sep;36(9):903-14. doi: 10.1002/humu.22825. Epub 2015 Jul 15. PMID: 26110913; PMCID: PMC4832303).
Instant claim 1 recites:
A kit comprising a container comprising a pool of TArget Capture Sequences (TACS),
wherein the pool of TACS comprises a plurality of TACS families (‘551 Patent, claim 1),
wherein each TACS family comprises a plurality of member sequences(‘551 Patent, claim 1),
wherein each member sequence binds to the same genomic sequence of interest but has different start and/or stop positions with respect to a reference coordinate system for the genomic sequence of interest, and further
wherein:
(i) each member sequence within each TACS family is between 100-500 base pairs in length, each member sequence having a 5' end and a 3' end;
(ii) each member sequence binds to the same genomic sequence of interest at least 50 base pairs away, on both the 5' end and the 3' end, from regions harboring Copy Number Variations (CNVs), Segmental duplications or repetitive DNA elements(‘551 Patent, claim 1); and
(iii) the GC content of the pool of TACS is between 19% and 80% (‘551 Patent, claim 6), as determined by calculating the GC content of each member within each family of TACS.
The claims of the ‘551 patent largely overlap with the instant claim 1. While the ‘551 patent discloses TArget Capture Sequences (TACS), it does not specifically claim TACS member sequence having length of 100-500 base pairs, and binds to the same genomic sequence of interest but has different start and/or stop positions.
Samorodnitsky fills this gap by teaching that staggered probes (i.e., probes having different start and stop binding positions within the same sequence of interest) is well-known in the application of nucleic acid target enrichment via hybridization (entire document, see Fig. 1B for example). Samorodnitsky further teaches hybridization capture probes having a length range of 55-120 base pairs , which overlaps with the claimed range of 100-500 base pairs, therefore the selection of probe length is subject for routine optimization for those skilled in the art.
Therefore, it would have been obvious for one of ordinary skill in the art to use staggered probes design as taught by Samorodnitsky in while preparing the TArget Capture Sequences in '551 patent, because both references are in the overlapping field of molecular biology assays, specifically target enrichment via hybridization. The use of a staggered probe design in preparing '551 patent's TArget Capture Sequences represents a predictable use of prior art elements according to known methods to yield predictable results (see MPEP §2143).
Therefore, instant claim 1 is obvious over claims 1 and 6 of the '551 patent, in view of Samorodnitsky. Instant claims 3 and 5 are obvious over claims 1 and 7 of the '551 patent, in view of Samorodnitsky.
Claims 1, 3, 5 are rejected on the ground of nonstatutory obviousness-type double patenting as being unpatentable over claims 1, 7-12 of U.S. Patent No. 12480160B2 in view of Samorodnitsky (Samorodnitsky et al. Evaluation of Hybridization Capture Versus Amplicon-Based Methods for Whole-Exome Sequencing. Hum Mutat. 2015 Sep;36(9):903-14. doi: 10.1002/humu.22825. Epub 2015 Jul 15. PMID: 26110913; PMCID: PMC4832303).
Instant claim 1 recites:
A kit comprising a container comprising a pool of TArget Capture Sequences (TACS),
wherein the pool of TACS comprises a plurality of TACS families (‘160 Patent, claim 1) ,
wherein each TACS family comprises a plurality of member sequences (‘160 Patent, claim 1),
wherein each member sequence binds to the same genomic sequence of interest but has different start and/or stop positions with respect to a reference coordinate system for the genomic sequence of interest, and further
wherein:
(i) each member sequence within each TACS family is between 100-500 base pairs in length, each member sequence having a 5' end and a 3' end (‘160 Patent, claim 1);
(ii) each member sequence binds to the same genomic sequence of interest at least 50 base pairs away, on both the 5' end and the 3' end, from regions harboring Copy Number Variations (CNVs), Segmental duplications or repetitive DNA elements (‘160 Patent, claim 1); and
(iii) the GC content of the pool of TACS is between 19% and 80%(‘160 Patent, claim 1), as determined by calculating the GC content of each member within each family of TACS.
The claims of the ‘160 patent largely overlap with the instant claim 1. While the ‘160 patent discloses TArget Capture Sequences (TACS), it does not specifically claim TACS member sequence binds to the same genomic sequence of interest but has different start and/or stop positions.
Samorodnitsky fills this gap by teaching that staggered probes (i.e., probes having different start and stop binding positions within the same sequence of interest) is well-known in the application of nucleic acid target enrichment via hybridization (entire document, see Fig. 1B for example).
Therefore, it would have been obvious for one of ordinary skill in the art to use staggered probes design as taught by Samorodnitsky in while preparing the TArget Capture Sequences in ‘160 patent, because both references are in the overlapping field of molecular biology assays, specifically target enrichment via hybridization. The use of a staggered probe design in preparing ‘160 patent's TArget Capture Sequences represents a predictable use of prior art elements according to known methods to yield predictable results (see MPEP §2143).
Therefore, instant claim1 is obvious over claim 1 of the ‘160 patent, in view of Samorodnitsky. Instant claims 3 and 5 are obvious over claims 1 and 7-12 of the ‘160 patent, in view of Samorodnitsky.
Claims 1-3, 5 and 8 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 2, 4, 9, 13 and 18 of U.S. Patent No. 11879157B2. Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are obvious over claims of the '157 patent.
Instant claim 1 recites:
A kit comprising a container comprising a pool of TArget Capture Sequences (TACS),
wherein the pool of TACS comprises a plurality of TACS families (‘157 patent, claim 18),
wherein each TACS family comprises a plurality of member sequences(‘157 patent, claims 2, 18),
wherein each member sequence binds to the same genomic sequence of interest but has different start and/or stop positions with respect to a reference coordinate system for the genomic sequence of interest(‘157 patent, claims 2, 18), and further
wherein:
(i) each member sequence within each TACS family is between 100-500 base pairs in length, each member sequence having a 5' end and a 3' end (‘157 patent, claims 2, 18);
(ii) each member sequence binds to the same genomic sequence of interest at least 50 base pairs away, on both the 5' end and the 3' end, from regions harboring Copy Number Variations (CNVs), Segmental duplications or repetitive DNA elements (‘157 patent, claims 2, 18); and
(iii) the GC content of the pool of TACS is between 19% and 80%, as determined by calculating the GC content of each member within each family of TACS (‘157 patent, claims 2, 18).
Therefore, instant claim 1 is anticipated by claims 2 or 18 of the '157 patent. Instant claims 2; 3, 5; 8 are anticipated by claims 4; 9; 13 of the '157 patent, respectively.
Claims 1-3, 5, 8 and 12 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2 and 4-5 of U.S. Patent No. 11649500B2. Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are obvious over claims of the '500 patent.
Instant claim 1 recites:
A kit comprising a container comprising a pool of TArget Capture Sequences (TACS),
wherein the pool of TACS comprises a plurality of TACS families (‘500 Patent, claim 1) ,
wherein each TACS family comprises a plurality of member sequences(‘500 Patent, claim 1),
wherein each member sequence binds to the same genomic sequence of interest but has different start and/or stop positions with respect to a reference coordinate system for the genomic sequence of interest(‘500 Patent, claim 1), and further
wherein:
(i) each member sequence within each TACS family is between 100-500 base pairs in length, each member sequence having a 5' end and a 3' end (‘500 Patent, claim 1);
(ii) each member sequence binds to the same genomic sequence of interest at least 50 base pairs away, on both the 5' end and the 3' end, from regions harboring Copy Number Variations (CNVs), Segmental duplications or repetitive DNA elements (‘500 Patent, claim 1); and
(iii) the GC content of the pool of TACS is between 19% and 80%(‘500 Patent, claim 1), as determined by calculating the GC content of each member within each family of TACS.
Therefore, instant claims 1 and 2 are anticipated by claim 1 of the '500 patent. Instant claims 3, 5; 8; 12 are anticipated by claims 5; 4; 2 of the '500 patent, respectively.
Claims 1-3 and 5 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2 of U.S. Patent No. 12435374B2. Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are obvious over claims of the '374 patent.
Instant claim 1 recites:
A kit comprising a container comprising a pool of TArget Capture Sequences (TACS),
wherein the pool of TACS comprises a plurality of TACS families (‘374 Patent, claim 1),
wherein each TACS family comprises a plurality of member sequences (‘374 Patent, claim 1),
wherein each member sequence binds to the same genomic sequence of interest but has different start and/or stop positions with respect to a reference coordinate system for the genomic sequence of interest (‘374 Patent, claim 1), and further
wherein:
(i) each member sequence within each TACS family is between 100-500 base pairs in length, each member sequence having a 5' end and a 3' end (‘374 Patent, claim 1);
(ii) each member sequence binds to the same genomic sequence of interest at least 50 base pairs away, on both the 5' end and the 3' end, from regions harboring Copy Number Variations (CNVs), Segmental duplications or repetitive DNA elements (‘374 Patent, claim 1); and
(iii) the GC content of the pool of TACS is between 19% and 80% (‘374 Patent, claim 1), as determined by calculating the GC content of each member within each family of TACS.
Therefore, instant claims 1 and 2 are anticipated by claim 1 of the '374 patent. Instant claims 3 and 5 are anticipated by claim 2 of the '374 patent, respectively.
Claims 1-3 and 5 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3 of U.S. Patent No. 12270069B2. Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are obvious over claims of the '069 patent.
Instant claim 1 recites:
A kit comprising a container comprising a pool of TArget Capture Sequences (TACS),
wherein the pool of TACS comprises a plurality of TACS families (‘069 Patent, claim 1),
wherein each TACS family comprises a plurality of member sequences (‘069 Patent, claim 1),
wherein each member sequence binds to the same genomic sequence of interest but has different start and/or stop positions with respect to a reference coordinate system for the genomic sequence of interest (‘069 Patent, claim 1), and further
wherein:
(i) each member sequence within each TACS family is between 100-500 base pairs in length, each member sequence having a 5' end and a 3' end (‘069 Patent, claim 1);
(ii) each member sequence binds to the same genomic sequence of interest at least 50 base pairs away, on both the 5' end and the 3' end, from regions harboring Copy Number Variations (CNVs), Segmental duplications or repetitive DNA elements (‘069 Patent, claim 1); and
(iii) the GC content of the pool of TACS is between 19% and 80%, as determined by calculating the GC content of each member within each family of TACS (‘069 Patent, claim 1).
Therefore, instant claims 1-2 are anticipated by claim 1 of the '069 patent. Instant claims 3; 5 are anticipated by claims 3; 2 of the '069 patent, respectively.
Claims 1-3 and 5 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 41-42, 45-47 and 52 of copending Application No. 18/398,421 ('421 application). Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are anticipated by the claims (Amended claims filed on 12/28/2023) of the '421 application.
Instant claim 1 recites:
A kit comprising a container comprising a pool of TArget Capture Sequences (TACS),
wherein the pool of TACS comprises a plurality of TACS families (‘421 Application, claim 41, 52),
wherein each TACS family comprises a plurality of member sequences (‘421 Application, claim 41, 52),
wherein each member sequence binds to the same genomic sequence of interest but has different start and/or stop positions with respect to a reference coordinate system for the genomic sequence of interest(‘421 Application, claim 42, 52), and further
wherein:
(i) each member sequence within each TACS family is between 100-500 base pairs in length, each member sequence having a 5' end and a 3' end (‘421 Application, claim 41, 52);
(ii) each member sequence binds to the same genomic sequence of interest at least 50 base pairs away, on both the 5' end and the 3' end, from regions harboring Copy Number Variations (CNVs), Segmental duplications or repetitive DNA elements (‘421 Application, claim 41, 52); and
(iii) the GC content of the pool of TACS is between 19% and 80% (‘421 Application, claim 41, 52), as determined by calculating the GC content of each member within each family of TACS.
Therefore, instant claim 1 is anticipated by claims 41-42 or 52 of the '421 application. Instant claims 2; 3; 5 are anticipated by claims 47; 45; 46 of the '421 application, respectively.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to TIAN NMN YU whose telephone number is (703)756-4694. The examiner can normally be reached Monday - Friday 8:30 am - 5:30 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at (571) 272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/TIAN NMN YU/Examiner , Art Unit 1681 /AARON A PRIEST/Primary Examiner, Art Unit 1681
1 Claims 4 and 6-7 are withdrawn as being drawn to non-elected species E-F.
2 Claim 9 is withdrawn as being drawn to non-elected species H.
3 Claim 10 is withdrawn as being drawn to non-elected species J-L.
4 see Romiguier, J. et al., Contrasting GC-content dynamics across 33 mammalian genomes: Relationship with life-history traits and chromosome sizes, Genome Res., vol. 20, pp. 1001-1009 ; 2010; the average GC content of human genome is 46.1 % (table 1)
5 Koumbaris1 qualifies as prior art, because its publication date in 2016 precedes the effective filling date in 2017. Additionally, Koumbaris1 includes additional inventor other than the inventors in this present application.