DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
This application 18/316,454 filed on 05/12/2023 claims the benefit of provisional U.S. Patent Application No. 63/341,850, filed on 05/13/2022.
The priority date of claim 1 and its dependent claims 2-15 is determined to be 05/13/2022, the filing date of provisional U.S. Patent Application No. 63/341,850.
Status of Claims
Applicant’s amendments to claims filed 05/13/2026 in response to the Non-Final Rejection mailed 11/18/2025 are acknowledged.
Claims 1, 3-5, 10, and 14 are amended.
Claims 2 and 15 have been canceled.
Claims 1 and 3-14 are pending and under examination.
Response to Remarks filed 05/13/2026
The amendments and arguments presented in the papers filed 05/13/2026 ("Remarks”) have been thoroughly considered. The issues raised in the Office action dated 11/18/2025 listed below have been reconsidered as indicated.
a) The objections to the specification regarding the use of trade names or marks are withdrawn in view of the amendments to the specification.
b) The objection to claims 2, 3, and 5 have been withdrawn in light of applicant’s amendments and cancellation of claims.
c) The 35 USC 112(b) indefiniteness rejections of claims 1-15 have been withdrawn in view of the amendments to claims and the cancellation of claims 2 and 15.
d) The rejections of claims 1 and 6-15 under 35 U.S.C. 102(a)(1) as being anticipated by Karst et al., are withdrawn in view of the amendments to the claims.
e) The rejections of claims 2-4 and 10 under 35 U.S.C. 102(a)(1) as being unpatentable over Karst and claim 5 as being unpatentable over Karst and Kurgan et al. are withdrawn in view of the amendments to the claims.
New and modified grounds of rejection necessitated by amendment are detailed below and this action is made FINAL.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1, 3-4 and 6-14 are rejected under 35 U.S.C. 103 as being unpatentable over Karst et al. (High-accuracy long-read amplicon sequences using unique molecular identifiers with Nanopore or PacBio sequencing. 2021. Nature Methods 18(2): p. 1-11 and Supplementary page S1-S43, on IDS dated 11/10/2023) in view of Kennedy et al. (Detecting ultralow-frequency mutations by Duplex Sequencing. 2014. Nat Protoc 9: 1-32).
These are new rejections necessitated by claim amendments filed on 05/13/2026.
Regarding claim 1, Karst teaches a method of high-throughput amplicon long-read sequencing, the method comprising: (a) performing PCR to amplify an operon and simultaneously tag each template molecule with terminal UMIs (p. 6, col. 1) using tailed primers which include a UMI sequence and a synthetic priming site (universal sequence) (p. 1, col. 2 and p. 2, Fig. 1b) UMI-tagged template molecules; (b) purifying the PCR product (initial products) (p. 6, col. 1); (c) performing a second and third PCR to amplify the first PCR product (p. 6, col. 1) using primers against the UMI-tagged template molecule (p. 1, col. 2 and p. 2, Fig. 1b) that include a second barcode sequence (p. 7, col. 2 and p. S30, Supplementary Table 1, Fig. 1 second barcode/UMI); (d) purifying the second product (p. 6, col. 1); (e) pooling batches of barcoded libraries (p.7, col. 2); and (f) sending for Sequel II (long-read) sequencing (p.7, col. 2) to generate raw fastq sequence data (p. 6, col. 2).
Karst further teaches using pipeline commands (p. 6, col. 2) and GNU parallel (p. 7, col. 1) to analyze sequencing data (i.e. executing on a processor), the analysis comprising (see Fig. 1c): (g) aligning UMI query sequences against reference operons (p. S12, Fig. S1) or the extended ‘Web of Life’ database (p. 7, col. 2); (h) binning and grouping sequences (a plurality of target sequences)0( p. 2, col. 1 and (Fig. 1c, steps 2 and 3); and for each group of sequences, (i)(i) retaining reads based on the concatenation of the two terminal UMIs (p. 1, col. 2) and retaining sequences with UMIs of the correct length (18 bp) in both ends, i. e. discarding sequences lacking UMIs (p. 1, col. 2 and p. 2, Fig. 1c step 1 Quality filtering); (i)(ii) binning sequences containing UMI sequences to generate clustered sequences (p. 2, Fig. 1c, step 3) and identify consensus sequences for clusters (p. 2, Fig. 1c, step 4); (i)(iii) filtering UMI pairs and bins (p. 2, col. 1), and discarding singleton clusters (p. 6, col. 2), which reads on “discarding sequences with less than an elected number of cluster consensus sequences” and (i)(iv) generating an initial consensus sequence (p. 7, col. 2 and p. 2, Fig. 1C, step 4); (j) further performing multiple rounds of polishing to generate a consensus sequence for each UMI bin (p. 2, col. 1), using paired UMIs with a goal of mitigating amplification bias (p. 2, col. 1); and (k) outputting high accuracy consensus sequence data (p. 1, col. 1).
Karst does not teach, from (i)(iii), “downsampling clusters with greater than an elected cluster size to the elected cluster size”.
Kennedy teaches a method for detecting mutations by sequencing. Kennedy teaches the method comprises labeling strands with tags, and grouping sequences with the same tags and genomic coordinates to create sequence ‘families’ (cluster consensus sequences) (Abstract, Fig. 1, p. 4 col. 1-2). Kennedy teaches requiring a minimum of 3 members (sequences) to create a tag family (p. 4, col. 2 and p.25 first full paragraph) and discarding the tag family if the number of reads is below the minimum cutoff (p.25 first full paragraph). Kennedy further teaches setting a maximum membership cutoff that limits the family size (an elected cluster size) and if the family is greater than the maximum cutoff, the number of reads corresponding to the maximum cutoff value are randomly selected from the family. The rest of the reads in the family are ignored (p.25 first full paragraph), which reads on downsampling clusters with greater than an elected cluster size to the elected cluster size. Kennedy states that setting the maximum cutoff reduces the computational time to process large families (p.25 first full paragraph).
It would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Karst and Kennedy to arrive at the instantly claimed invention. The modification would have entailed adding the maximum cluster size limits of Kennedy to the consensus making steps of Karst. One would have been motivated by the benefit of a reduction in computational time and burden for analysis. One could further have substituted the minimum membership cutoff of Kennedy for the minimum threshold. Choosing parameters is considered routine optimizations known in the art. There would have been a reasonable expectation of success given the underlying materials and methods are widely known, successfully demonstrated, and commonly used as evidenced by the prior art.
Regarding claim 3, Karst teaches aligning up to the first 110bp of each terminal end of trimmed and filtered reads (which reads on 5'- and 3'-adapters and UMI-adjacent substrings) and mapping to read terminals (p. 6, col. 2). Karst teaches the output from this step was divided into UMI bins (p. 6, col. 2), i.e. identifying and enabling clustering of the UMI sequences. Karst further teaches discarding sequences lacking UMIs at both ends (Fig. 1c, step 1) and required binned sequences to meet criteria including UMI pairs at both ends and mapping differences of ≤3 bp (p. 6, col. 2).
Regarding claim 4, Kennedy teaches a minimum membership of 3 (p.25 first full paragraph) which reads on the elected number of cluster consensus sequences is between 3 and 10. Kennedy teaches a maximum cutoff value (elected cluster size), but does not teach the elected cluster size is 20 to 80. However, Kennedy teaches determining an optimal family size (reads/family) to maximize the final number of consensus reads (Fig. 4).
Therefore It would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the teachings of Kennedy to arrive at the instantly claimed invention. The modification would have entailed experimentally optimizing the elected number of cluster consensus sequences and the elected cluster size. Choosing parameters based on experimental results is considered routine optimizations known in the art, and Kennedy demonstrates this is a conventional method. One would have been motivated to maximize the final number of consensus reads. There would have been a reasonable expectation of success given the underlying materials and methods are widely known, successfully demonstrated, and commonly used as evidenced by the prior art.
Regarding claim 6, Karst teaches performing SPRI purifications for the first and second PCR products (p. 6, col. 1)
Regarding claim 7, Karst teaches the UMI sequence is 18 nucleotides (p. 6, col. 1).
Regarding claim 8, Karst teaches the UMI sequence is 18 nucleotides (p. 6, col. 1).
Regarding claim 9, Karst teaches the first primer comprises a synthetic priming sequence (universal sequence) and a UMI (p. 6, col. 1). Karst teaches primers in Supplementary Table 1 with synthetic priming sequences that are 24 nucleotides long (p. S30). An example is annotated below, where the universal sequence is in bold and the UMI is italicized:
CAAGCAGAAGACGGCATACGAGAT NNNYRNNNYRNNNYRNNN AGRGTTYGATYMTGGCTCAG
Regarding claim 11, Karst teaches the first PCR amplification is two cycles (p. 6, col. 1).
Regarding claim 12, Karst teaches the first PCR amplification is two cycles (p. 6, col. 1).
Regarding claim 13, Karst teaches the second PCR amplification is 25 cycles (p. 6, col. 1).
Regarding claim 14, Karst teaches performing long-read sequencing on PacBio Sequel II (p. 6, col. 1).
Claim 5 is rejected under 35 U.S.C. 103 as being unpatentable over Karst et al. (High-accuracy long-read amplicon sequences using unique molecular identifiers with Nanopore or PacBio sequencing. 2021. Nature Methods 18(2): p. 1-11 and Supplementary page S1-S43, on IDS dated 11/10/2023) in view of Kennedy et al. (Detecting ultralow-frequency mutations by Duplex Sequencing. 2014. Nat Protoc 9: 1-32) as applied to claims 1, 3-4, and 6-14 above, and further in view of Kurgan et al. (CRISPAltRations: a validated cloud-based approach for interrogation of double-strand break repair mediated by CRISPR genome editing. 2020. bioRxiv.org. p. 1-47. www.biorxiv.org/content/10.1101/2020.11.13.382283v1).
This is a new rejection necessitated by claim amendments filed on 05/13/2026.
Regarding claim 5, Karst teaches analyzing raw sequence data by merging and outputting binned (merged) sequences (Fig. 1c, steps 1 and 2).
Karst does not teach (i) developing target-site sequences containing predicted outcomes of repair events single-stranded or a double-stranded DNA oligonucleotide donor is provided and outputting the target predicted outcomes; (ii) binning the merged sequences with the target-site sequences or the optional target predicted outcomes using a mapper and outputting target-read alignments; (iii) re-aligning the binned target-read alignments to the target-site using an enzyme specific position-specific scoring matrix derived from biological data that is applied based on the position of a guide sequence and a canonical enzyme-specific cut site and producing a final alignment; (iv)
analyzing the final alignment and identifying and quantifying mutations within a pre-defined sequence distance window from the canonical enzyme-specific cut sites; or (v) outputting the final alignment, analysis, and quantification results data as tables or graphics.
Kurgan teaches a method for analyzing double-strand break repair mediated by CRISPR. The method comprises performing multiple rounds of PCR amplification and processing sequencing reads (p. 15, lines 400-406 to p 16) and further comprising
(i) predicting outcomes by reconstructing a hypothetical sequence (p. 16, line 434) based on theoretically perfect HDR events (p. 16, line 431) if an HDR donor is supplied (p. 17, line 450); (ii) collapsing reads based on sequence identities (i.e. binning merged sequences); (iii) aligning using a scoring matrix based on features in specific positions (e.g. position of a guide sequence) and predicted canonical cut sites (p. 17, lines 438-446); (iv) annotating variants by discriminating and quantifying NHEJ, imperfect HDR and perfect HDR (p. 14, lines 355-356) and annotating based on whether a mutation is found within a pre-defined window from the cut site (p. 17, lines 452-453); and (v) outputting data with visualization tools, including alignments, analysis and quantification (p. 35, Fig. 8).
Kurgan states that detection of many larger events requires advances in the use of long read sequencing (p. 14, lines 356-357).
It would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Karst and Kurgan to arrive at the instantly claimed invention. The modification would have entailed adding the downstream analysis of Kurgan to the method of Karst. One would have been motivated to add the analysis in order to take advantage of the ability of the method of Karst to produce high-accuracy long-reads (an outcome desired by Kurgan) to analyze sequences edits by genome editing methods such as CRISPR. There would have been a reasonable expectation of success given the underlying materials and methods are widely known, successfully demonstrated, and commonly used as evidenced by the prior art.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JESSICA GRAY whose telephone number is (571)272-0116. The examiner can normally be reached Monday-Friday 8-5 with second Fridays off.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, WINSTON SHEN can be reached at (571)272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JESSICA GRAY/Examiner, Art Unit 1682
/WU CHENG W SHEN/Supervisory Patent Examiner, Art Unit 1682
Prosecution Insights