Prosecution Insights
Last updated: April 19, 2026
Application No. 18/316,454

USE OF UNIQUE MOLECULAR IDENTIFIERS FOR IMPROVED ACCURACY OF LONG READ SEQUENCING AND CHARACTERIZATION OF CRISPR EDITING

Non-Final OA §102§103§112
Filed
May 12, 2023
Examiner
GRAY, JESSICA
Art Unit
1682
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Integrated Dna Technologies Inc.
OA Round
1 (Non-Final)
0%
Grant Probability
At Risk
1-2
OA Rounds
3y 2m
To Grant
0%
With Interview

Examiner Intelligence

Grants only 0% of cases
0%
Career Allow Rate
0 granted / 5 resolved
-60.0% vs TC avg
Minimal +0% lift
Without
With
+0.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 2m
Avg Prosecution
47 currently pending
Career history
52
Total Applications
across all art units

Statute-Specific Performance

§101
13.8%
-26.2% vs TC avg
§103
29.7%
-10.3% vs TC avg
§102
15.4%
-24.6% vs TC avg
§112
22.9%
-17.1% vs TC avg
Black line = Tech Center average estimate • Based on career data from 5 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claims 1-15 are pending and currently under examination. Priority This application 18/316,454 filed on 05/12/2023 claims the benefit of provisional U.S. Patent Application No. 63/341,850, filed on 05/13/2022. The priority date of claim 1 and its dependent claims 2-15 is determined to be 05/13/2022, the filing date of provisional U.S. Patent Application No. 63/341,850. Specification The use of terms which are trade names or marks used in commerce (including IIlumina® MiSeqTM and PacBio® among others), has been noted in this application. The term should be accompanied by the generic terminology; furthermore, the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM, or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Claim Objections Claim 2 parts (j)(iv) and (k) are objected to because of the following informalities: The claim steps recite the lim. This appears to be a typo intended to be “initial target sequence”. Appropriate correction is required. Claim 3 appears to be missing the phrase “wherein” at the beginning of lines 4 and 6. Appropriate correction is required. Claim 5 recites the limitation “further comprising analyzing the raw nucleotide sequence data from claim 1(f) or the high accuracy consensus sequence data from claim 2(l)”. Claim 5 does not depend from claim 2. Appropriate correction is required. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-15 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 1 step (c) recites the limitation “primers comprising a sequence complementary to the universal sequence and a barcode sequence”. It is unclear if the barcode sequence of 1(c) is intended to be the “unique molecular identifier” of claim 1(a) or a second, different barcode. Claims 2-15 are similarly indefinite because they directly or indirectly depend from claim 1. Claim 3 recites the limitations “nucleotides between the aligned target sequence and adapter sequence on each end identify and enable clustering of the UMI sequences” and “sequences lacking UMIs at both ends and containing less than 3 edit differences to the UMI are discarded”. As written, these limitations are unclear. It is not clear what steps are meant to be limited by these phrases, how these clauses relate to the claimed steps, or if additional steps are intended or necessary. Regarding claim 14, the claim contains the trademark/trade names Oxford Nanopore®Technologies (ONT) MinION® and PacBio®Sequel II . Where a trademark or trade name is used in a claim as a limitation to identify or describe a particular material or product, the claim does not comply with the requirements of 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph. See Ex parte Simpson, 218 USPQ 1020 (Bd. App. 1982). The claim scope is uncertain since the trademark or trade name cannot be used properly to identify any particular material or product. A trademark or trade name is used to identify a source of goods, and not the goods themselves. Thus, a trademark or trade name does not identify or describe the goods associated with the trademark or trade name. In the present case, the trademark/trade name is used to identify sequencing platforms and, accordingly, the identification/description is indefinite. Claim 15 recites the limitation “ the sequencing error rate is reduced by at least 15-fold”. It is unclear what the error rate is reduced relative to, what should be compared to determine a reduction in error rate, how such a reduction would be calculated, or what additional step or elements are required, if any, to achieve the recited result or confer the recited property, beyond that specified in independent claim 1. Claim 15 recites the limitation "the sequencing error rate" in line 1. There is insufficient antecedent basis for this limitation in the claim. Claim 1, which claim 15 depends on, does not include a limitation for a sequencing error rate. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claim(s) 1 and 6-15 is/are rejected under 35 U.S.C. 102(a)(1) and (a)(2) as being anticipated by Karst et al. (High-accuracy long-read amplicon sequences using unique molecular identifiers with Nanopore or PacBio sequencing. 2021. Nature Methods 18(2): p. 1-11 and Supplementary page S1-S43, on IDS dated 11/10/2023). Regarding claim 1, Karst teaches a method of high-throughput amplicon long-read sequencing, the method comprising: (a) performing PCR to amplify an operon and simultaneously tag each template molecule with terminal UMIs (p. 6, col. 1) using tailed primers which include a UMI sequence and a synthetic priming site (universal sequence) (p. 1, col. 2 and p. 2, Fig. 1b) UMI-tagged template molecules; (b) purifying the PCR product (initial products) (p. 6, col. 1); (c) performing a second and third PCR to amplify the first PCR product (p. 6, col. 1) using primers against the UMI-tagged template molecule (p. 1, col. 2 and p. 2, Fig. 1b) that include a barcode sequence (p. 7, col. 2 and p. S30, Supplementary Table 1); (d) purifying the second product (p. 6, col. 1); (e) pooling batches of barcoded libraries (p.7, col. 2); and (f) sending for Sequel II (long-read) sequencing (p.7, col. 2) to generate raw fastq sequence data (p. 6, col. 2). Regarding claim 6, Karst teaches performing SPRI purifications for the first and second PCR products (p. 6, col. 1) Regarding claim 7, Karst teaches the UMI sequence is 18 nucleotides (p. 6, col. 1). Regarding claim 8, Karst teaches the UMI sequence is 18 nucleotides (p. 6, col. 1). Regarding claim 9, Karst teaches the first primer comprises a synthetic priming sequence (universal sequence) and a UMI (p. 6, col. 1). Karst teaches primers in Supplementary Table 1 with synthetic priming sequences that are 24 nucleotides long (p. S30). An example is annotated below, where the universal sequence is in bold and the UMI is italicized: CAAGCAGAAGACGGCATACGAGAT NNNYRNNNYRNNNYRNNN AGRGTTYGATYMTGGCTCAG Regarding claim 11, Karst teaches the first PCR amplification is two cycles (p. 6, col. 1). Regarding claim 12, Karst teaches the first PCR amplification is two cycles (p. 6, col. 1). Regarding claim 13, Karst teaches the second PCR amplification is 25 cycles (p. 6, col. 1). Regarding claim 14, Karst teaches performing long-read sequencing on PacBio Sequel II (p. 6, col. 1). Regarding claim 15, Karst teaches, for example, a raw error rate of 7.91, and a consensus error rate of 0.0042 in ONT R10.3 UMI samples (p. 3, Fig. 2b), satisfying the requirement of an error rate reduced by at least 15-fold between the raw data and the UMI samples. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1-4 and 10 are rejected under 35 U.S.C. 103 as being unpatentable over Karst et al. (High-accuracy long-read amplicon sequences using unique molecular identifiers with Nanopore or PacBio sequencing. 2021. Nature Methods 18(2): p. 1-11 and Supplementary page S1-S43, on IDS dated 11/10/2023). The teachings of Karst as they relate to claim 1 are stated in the 102 rejection above in this office action. Regarding claim 2, Karst teaches using pipeline commands (p. 6, col. 2) and GNU parallel (p. 7, col. 1) to analyze sequencing data (i.e. executing on a processor), the analysis comprising (see Fig. 1c): (g) trimming and filtering raw reads (p. 6, col. 2); (h) aligning UMI query sequences against reference operons (p. S12, Fig. S1) or the extended ‘Web of Life’ database (p. 7, col. 2); grouping sequences (a plurality of target sequences) (Fig. 1c, steps 2 and 3); (j)(i) retaining reads based on the concatenation of the two terminal UMIs (p. 1, col. 2) and retaining sequences with UMIs of the correct length (18 bp) in both ends (p. 1, col. 2 and p. 2, Fig. 1c step 1 Quality filtering); (j)(ii) binning sequences containing UMI sequences to generate clustered sequences (p. 2, Fig. 1c, step 3) and identify consensus sequences for clusters (p. 2, Fig. 1c, step 4); (j)(iii) filtering UMI pairs and bins (p. 2, col. 1), and discarding singleton clusters (p. 6, col. 2), which reads on “discarding sequences with less than an elected number of cluster consensus sequences” and (j)(iv) generating an initial consensus sequence (p. 7, col. 2 and p. 2, Fig. 1C, step 4); (k) further performing multiple rounds of polishing to generate a consensus sequence for each UMI bin (p. 2, col. 1), using paired UMIs with a goal of mitigating amplification bias (p. 2, col. 1); and (l) outputting high accuracy consensus sequence data (p. 1, col. 1). Karst does not teach (j)(iii) discarding sequences with less than an elected number of cluster consensus sequences and downsampling clusters with greater than an elected an elected cluster size to the elected cluster size. Karst does teach determining error rates based on the number of sequences in a bin and the number of bins (see Fig. 2, Supplementary Fig. 15 and Supplementary Table 6). It would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the teachings of Karst to arrive at the instantly claimed invention. Although Karst does not explicitly teach selecting a particular number or size of cluster consensus sequences or cluster sizes, Karst was aware of the effect of these variables on error rate. Decreasing error rate was a stated goal of Karst (p. 1, Abstract). One would have been motivated to modify the method of Karst to limit the number of cluster consensus sequences and cluster sizes to decrease the error rate, which was determined as part of the method. Choosing parameters based on experimental results is considered routine optimizations known in the art. There would have been a reasonable expectation of success given the underlying materials and methods are widely known, successfully demonstrated, and commonly used as evidenced by the prior art. Regarding claim 3, Karst teaches aligning up to the first 110bp of each terminal end of trimmed and filtered reads (which reads on 5'- and 3'-adapters and UMI-adjacent substrings) and mapping to read terminals (p. 6, col. 2). Karst teaches the output from this step was divided into UMI bins (p. 6, col. 2), i.e. identifying and enabling clustering of the UMI sequences. Karst further teaches discarding sequences lacking UMIs at both ends (Fig. 1c, step 1) and required binned sequences to meet criteria including UMI pairs at both ends and mapping differences of ≤3 bp (p. 6, col. 2). Regarding claim 4, Karst teaches error rates for different UMI bin sizes (cluster sizes) (p. 32, Supplementary Table 3), error rates for reads (cluster consensus sequences) (p. 3, Fig. 2), and the number of sequences (cluster consensus sequences) as a function of UMI bin size (cluster size) (p. S26, Supplementary Figure 15). Karst further teaches that for PacBio UMI data, at least three reads per UMI pair are required (p. 2, col. 2). Karst does not teach electing cluster consensus sequences between 3 and 10; and a cluster size between 20 to 80. It would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the teachings of Karst to arrive at the instantly claimed invention. The modification would have entailed electing the number of sequences per bin (cluster consensus sequences) and (bin size) cluster size of the instant invention. One would have been motivated to elect a particular cluster size based on the desired error rate as in Supplementary Table 3 (p. 32). The election would also consider the number of cluster sequences, as shown to be relevant for PacBio reads (p. 2). Choosing parameters based on experimental results is considered routine optimizations known in the art. There would have been a reasonable expectation of success given the underlying materials and methods are widely known, successfully demonstrated, and commonly used as evidenced by the prior art. Regarding claim 10, Karst teaches PCR primers with barcodes 12 nucleotides long. An example is annotated below, where the barcode sequence is in bold: ACGAGACTGATT CAAGCAGAAGACGGCATACGAGAT Karst does not teach barcodes comprising 16-24 nucleotides. It would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the teachings of Karst to arrive at the instantly claimed invention. The modification would have entailed increasing the length of the barcode sequence. Changing primer sequence and barcode sequence length are routine optimizations known in the art. One would have been motivated to modify the barcode sequence length to optimize PCR efficiency and downstream analysis. There would have been a reasonable expectation of success given the underlying materials and methods are widely known, successfully demonstrated, and commonly used as evidenced by the prior art. Claim 5 is rejected under 35 U.S.C. 103 as being unpatentable over Karst et al. (High-accuracy long-read amplicon sequences using unique molecular identifiers with Nanopore or PacBio sequencing. 2021. Nature Methods 18(2): p. 1-11 and Supplementary page S1-S43, on IDS dated 11/10/2023) in view of Kurgan et al. (CRISPAltRations: a validated cloud-based approach for interrogation of double-strand break repair mediated by CRISPR genome editing. 2020. bioRxiv.org. p. 1-47. www.biorxiv.org/content/10.1101/2020.11.13.382283v1). Regarding claim 5, Karst teaches analyzing raw sequence data by merging and outputting binned (merged) sequences (Fig. 1c, steps 1 and 2). Karst does not teach (i) developing target-site sequences containing predicted outcomes of repair events single-stranded or a double-stranded DNA oligonucleotide donor is provided and outputting the target predicted outcomes; (ii) binning the merged sequences with the target-site sequences or the optional target predicted outcomes using a mapper and outputting target-read alignments; (iii) re-aligning the binned target-read alignments to the target-site using an enzyme specific position-specific scoring matrix derived from biological data that is applied based on the position of a guide sequence and a canonical enzyme-specific cut site and producing a final alignment; (iv) analyzing the final alignment and identifying and quantifying mutations within a pre-defined sequence distance window from the canonical enzyme-specific cut sites; or (v) outputting the final alignment, analysis, and quantification results data as tables or graphics. Kurgan teaches a method for analyzing double-strand break repair mediated by CRISPR. The method comprises performing multiple rounds of PCR amplification and processing sequencing reads (p. 15, lines 400-406 to p 16) and further comprising (i) predicting outcomes by reconstructing a hypothetical sequence (p. 16, line 434) based on theoretically perfect HDR events (p. 16, line 431) if an HDR donor is supplied (p. 17, line 450); (ii) collapsing reads based on sequence identities (i.e. binning merged sequences); (iii) aligning using a scoring matrix based on features in specific positions (e.g. position of a guide sequence) and predicted canonical cut sites (p. 17, lines 438-446); (iv) annotating variants by discriminating and quantifying NHEJ, imperfect HDR and perfect HDR (p. 14, lines 355-356) and annotating based on whether a mutation is found within a pre-defined window from the cut site (p. 17, lines 452-453); and (v) outputting data with visualization tools, including alignments, analysis and quantification (p. 35, Fig. 8). Kurgan states that detection of many larger events requires advances in the use of long read sequencing (p. 14, lines 356-357). It would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Karst and Kurgan to arrive at the instantly claimed invention. The modification would have entailed adding the downstream analysis of Kurgan to the method of Karst. One would have been motivated to add the analysis in order to take advantage of the ability of the method of Karst to produce high-accuracy long-reads (an outcome desired by Kurgan) to analyze sequences edits by genome editing methods such as CRISPR. There would have been a reasonable expectation of success given the underlying materials and methods are widely known, successfully demonstrated, and commonly used as evidenced by the prior art. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to JESSICA GRAY whose telephone number is (571)272-0116. The examiner can normally be reached Monday-Friday 8-5 with second Fridays off. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, WINSTON SHEN can be reached at (571)272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /JESSICA GRAY/Examiner, Art Unit 1682 /WU CHENG W SHEN/Supervisory Patent Examiner, Art Unit 1682
Read full office action

Prosecution Timeline

May 12, 2023
Application Filed
Nov 14, 2025
Non-Final Rejection — §102, §103, §112 (current)

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
0%
Grant Probability
0%
With Interview (+0.0%)
3y 2m
Median Time to Grant
Low
PTA Risk
Based on 5 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month