Prosecution Insights
Last updated: July 17, 2026
Application No. 18/316,561

COMPOSITIONS AND METHODS FOR INHIBITING SNCA EXPRESSION

Non-Final OA §103§112
Filed
May 12, 2023
Priority
May 13, 2022 — provisional 63/364,639
Examiner
ZARA, JANE J
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Dicerna Pharmaceuticals Inc.
OA Round
1 (Non-Final)
71%
Grant Probability
Favorable
1-2
OA Rounds
0m
Est. Remaining
87%
With Interview

Examiner Intelligence

Grants 71% — above average
71%
Career Allowance Rate
776 granted / 1096 resolved
+10.8% vs TC avg
Strong +16% interview lift
Without
With
+16.1%
Interview Lift
resolved cases with interview
Typical timeline
2y 10m
Avg Prosecution
47 currently pending
Career history
1139
Total Applications
across all art units

Statute-Specific Performance

§101
2.1%
-37.9% vs TC avg
§103
43.4%
+3.4% vs TC avg
§102
12.0%
-28.0% vs TC avg
§112
19.4%
-20.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1096 resolved cases

Office Action

§103 §112
DETAILED ACTION The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . This Office action is in response to the communication filed 3-2-26. Claims 1, 4, 9, 10, 13, 17, 21, 27, 28, 36, 40, 42, 44, 46, 48, 53, 56, 65-67, 83, 92, 98, 99, 101 are pending in the instant application. Election/Restrictions Claims 83, 99 and 101 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention or species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 3-2-26 Applicant’s election without traverse of Group I, claims 1, 4, 9, 10, 13, 17, 21, 27, 28, 36, 40, 42, 44, 46, 48, 53, 56, 65-67, 83, 92, 98, SEQ ID No. 1846 as the sense strand, sequence, SEQ ID No. 1551 as the target sequence, and SEQ ID No. 1586 as the antisense strand, in the reply filed on 3-2-26 is acknowledged. Claim Objections Claims 44 is objected to because of the following informalities: In lines 4-5 of claim 44, “between positions” is recited twice in a row and is redundant. Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. In claim 67 (o), the claim recites SEQ ID Nos. 1551 and 1586 as being a complementary pair, but these two sequences are not complementary. SEQ ID Nos. 1846 and 1586 appear to be complementary. Appropriate correction is required. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 1, 4, 9, 10, 17, 21, 27, 28, 40, 42, 44, 46, 48, 53, 56, 65, 98 is/are rejected under 35 U.S.C. 103 as being unpatentable over Bennett et al ((USPN 9,663,783 and US 2014/0005252),Tan, P. (US 2009/0176729) and Bentwich, I. (USPN 7,687,616), the combination further in view of Keating et al (WO 2021/207167) and Saxena, U. (US 2021/0380984). SEQ ID NO: 1586 identifies SEQ ID NO: 1551 as being complementary. Nucleotides 1-20 of SEQ ID NO: 1586 are complementary to nucleotides 20-1 of SEQ ID NO: 1551. PNG media_image1.png 682 927 media_image1.png Greyscale The claims are drawn to RNAi oligonucleotides comprising a sense strand between 15-50 nucleotides in length, and an antisense strand of 15-30 nucleotides in length, which antisense strand comprises a region of complementarity to SEQ ID No. 1846, which RNAi oligonucleotide optionally comprise a stem loop at the 3’ end, which oligonucleotides optionally comprise a 3’ blunt end of the sense strand, or a 3’ overhang of one or more nucleotides, and which oligonucleotide optionally further comprises a 2’-O modification, a phosphorothioate internucleotide linkage, or a vinyl phosphonate at the 4’ carbon, and which RNAi oligonucleotide is optionally conjugated to a GalNAc targeting ligand, which sense strand optionally comprises SEQ ID No. 1551, and which antisense strand optionally comprises SEQ ID No. 1586, and optionally comprising a tetraloop comprising GAAA and a 3’ overhang comprising AA, GG, AG or GA.. Bennett et al (US 2014/0005252) teach inhibitory oligonucleotides comprising SEQ ID No.1846 for targeting alpha synuclein optionally comprising modified sugar, internucleotide linkages, and nucleobases (para 0054-0058, 0071, 0076, 0185-0252). Bennett teaches SEQ ID No. 1846 for targeting alpha synuclein and optionally comprising modified sugars, internucleotide linkages, and nucleobases. (see the alignment below of Bennett SEQ ID No. 40 with instantly claimed SEQ ID No. 1846). Align w seq id no. 1846 RESULT 5 US-61-414-848-40/c (NOTE: this sequence has 2 duplicates in the database searched. See complete list at the end of this report) Sequence 40, US/61414848 USPN 9,663,783 GENERAL INFORMATION APPLICANT: C. Frank Bennett APPLICANT: Susan M. Freier APPLICANT: Jyothi Mallajosyula TITLE OF INVENTION: MODULATION OF ALPHA SYNUCLEIN EXPRESSION FILE REFERENCE: BIOL0139US.L CURRENT APPLICATION NUMBER: US/61/414,848 CURRENT FILING DATE: 2010-11-17 NUMBER OF SEQ ID NOS: 136 SEQ ID NO 40 LENGTH: 20 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Oligonucleotide Query Match 100.0%; Score 19; Length 20; Best Local Similarity 100.0%; Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CAGTCATGACATTTCTCAA 19 ||||||||||||||||||| Db 19 CAGTCATGACATTTCTCAA 1 RESULT 5 US-13-988-296-40/c (NOTE: this sequence has 3 duplicates in the database searched. See complete list at the end of this report) Sequence 40, US/13988296 Publication No. US20140005252A1 GENERAL INFORMATION APPLICANT: C. Frank Bennett APPLICANT: Susan M. Freier APPLICANT: Jyothi Mallajosyula TITLE OF INVENTION: MODULATION OF ALPHA SYNUCLEIN EXPRESSION FILE REFERENCE: BIOL0139USA CURRENT APPLICATION NUMBER: US/13/988,296 CURRENT FILING DATE: 2013-05-17 PRIOR APPLICATION NUMBER: 61/414,848 PRIOR FILING DATE: 2010-11-17 PRIOR APPLICATION NUMBER: PCT/US2011/061245 PRIOR FILING DATE: 2011-11-17 NUMBER OF SEQ ID NOS: 143 SEQ ID NO 40 LENGTH: 20 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Oligonucleotide Query Match 100.0%; Score 19; Length 20; Best Local Similarity 100.0%; Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CAGTCATGACATTTCTCAA 19 ||||||||||||||||||| Db 19 CAGTCATGACATTTCTCAA 1 SEQ ID NO: 1586 identifies SEQ ID NO: 1551 as being complementary. Nucleotides 1-20 of SEQ ID NO: 1586 are complementary to nucleotides 20-1 of SEQ ID NO: 1551. PNG media_image1.png 682 927 media_image1.png Greyscale The claims are drawn to RNAi oligonucleotides comprising a sense strand between 15-50 nucleotides in length, and an antisense strand of 15-30 nucleotides in length, which antisense strand comprises a region of complementarity to SEQ ID No. 1846, which RNAi oligonucleotide optionally comprise a stem loop at the 3’ end, which oligonucleotides optionally comprise a 3’ blunt end of the sense strand, or a 3’ overhang of one or more nucleotides, and which oligonucleotide Tan, P. (US 2009/0176729) teaches SEQ ID No. 1846 for targeting ALPHA SYNUCLEIN optionally comprising modified sugars, internucleotide linkages, and nucleobases. Tan teaches inhibitory oligonucleotides comprising phosphorothioate linkages, 2’- O-methyl and 2’-fluoro modified sugars, linkers, and stem loops (see esp. para 0007-0008, 0014, 0084, 0085, 0106-0116, 0226, Table 8, see the alignment below of Tan SEQ ID Nos. 440 and 439 with instantly claimed SEQ ID No. 1846). Align w seq id no. 1846 RESULT 3 US-12-334-080-440/c (NOTE: this sequence has 2 duplicates in the database searched. See complete list at the end of this report) Sequence 440, US/12334080 Publication No. US20090176729A1 GENERAL INFORMATION APPLICANT: TAN, PAMELA TITLE OF INVENTION: METHOD OF TREATING NEURODEGENERATIVE DISEASE FILE REFERENCE: A2038-709410 CURRENT APPLICATION NUMBER: US/12/334,080 CURRENT FILING DATE: 2009-03-05 PRIOR APPLICATION NUMBER: 61/058,468 PRIOR FILING DATE: 2008-06-03 PRIOR APPLICATION NUMBER: 61/013,759 PRIOR FILING DATE: 2007-12-14 NUMBER OF SEQ ID NOS: 854 SEQ ID NO 440 LENGTH: 19 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide Query Match 100.0%; Score 19; Length 19; Best Local Similarity 100.0%; Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CAGTCATGACATTTCTCAA 19 ||||||||||||||||||| Db 19 CAGTCATGACATTTCTCAA 1 RESULT 4 US-12-334-080-439 (NOTE: this sequence has 2 duplicates in the database searched. See complete list at the end of this report) Sequence 439, US/12334080 Publication No. US20090176729A1 GENERAL INFORMATION APPLICANT: TAN, PAMELA TITLE OF INVENTION: METHOD OF TREATING NEURODEGENERATIVE DISEASE FILE REFERENCE: A2038-709410 CURRENT APPLICATION NUMBER: US/12/334,080 CURRENT FILING DATE: 2009-03-05 PRIOR APPLICATION NUMBER: 61/058,468 PRIOR FILING DATE: 2008-06-03 PRIOR APPLICATION NUMBER: 61/013,759 PRIOR FILING DATE: 2007-12-14 NUMBER OF SEQ ID NOS: 854 SEQ ID NO 439 LENGTH: 19 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide Query Match 100.0%; Score 19; Length 19; Best Local Similarity 68.4%; Matches 13; Conservative 6; Mismatches 0; Indels 0; Gaps 0; Qy 1 CAGTCATGACATTTCTCAA 19 |||:||:||||:::|:||| Db 1 CAGUCAUGACAUUUCUCAA 19 Bentwich, I. (USPN 7,687,616) teaches inhibitory oligonucleotides comprising SEQ ID No. 1586 (see alignments below between Bentwich’s SEQ ID Nos. 1936746 and SEQ ID NO 372232 and instantly claimed SEQ ID No. 1586). Align w seq id no 1586 RESULT 4 USPN 7,687,616 US-10-709-577B-1936746/c (NOTE: this sequence has 7 duplicates in the database searched. See complete list at the end of this report) Sequence 1936746, US/10709577B GENERAL INFORMATION APPLICANT: ROSETTA GENOMICS LTD APPLICANT: Bentwich, Itzhak APPLICANT: Daniel, Kfar TITLE OF INVENTION: SMALL MOLECULES MODULATING ACTIVITY OF MICRO RNA TITLE OF INVENTION: OLIGONULEOTIDES AND MICRO RNA TARGETS AND USES THEREOF FILE REFERENCE: 06087.0202.CPUS02 CURRENT APPLICATION NUMBER: US/10/709,577B CURRENT FILING DATE: 2004-05-14 NUMBER OF SEQ ID NOS: 10068177 SEQ ID NO 1936746 LENGTH: 23 TYPE: DNA ORGANISM: Homo sapiens Query Match 100.0%; Score 22; Length 23; Best Local Similarity 100.0%; Matches 22; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 TTTGAGAAATGTCATGACTGGG 22 |||||||||||||||||||||| Db 23 TTTGAGAAATGTCATGACTGGG 2 RESULT 1 US-10-310-914B-372232 Sequence 372232, US/10310914B Patent No. 7250496 GENERAL INFORMATION APPLICANT: Bentwich, Isaac APPLICANT: Shiler, Kvuzat TITLE OF INVENTION: Bioinformatically detectable group of novel regulatory genes and TITLE OF INVENTION: uses thereof FILE REFERENCE: 06087.0200.CPUS01 CURRENT APPLICATION NUMBER: US/10/310,914B CURRENT FILING DATE: 2002-12-06 NUMBER OF SEQ ID NOS: 1388411 SEQ ID NO 372232 LENGTH: 24 TYPE: DNA ORGANISM: Human Query Match 100.0%; Score 22; Length 24; Best Local Similarity 68.2%; Matches 15; Conservative 7; Mismatches 0; Indels 0; Gaps 0; Qy 1 TTTGAGAAATGTCATGACTGGG 22 :::||||||:|:||:|||:||| Db 3 UUUGAGAAAUGUCAUGACUGGG 24 The primary references do not teach siRNA comprising vinyl phosphonate modifications, GalNAc ligands, loops comprising GAAA, or siRNA comprising terminal GG overhangs. Keating et al (WO 2021/207167) teach siRNA comprising phosphorothioate internucleotide linkages, 2’O-methyl sugar modifications, vinyl phosphonate modifications, overhangs, blunt ends, hydrocarbon chains, and stem loops (see e.g., pages 6-12, 19, 24, 26, 27, 37-39, 41-42). Saxena, U. (US 2021/0380984) teach siRNA comprising terminal overhangs comprising GG, and loops comprising GAAA (see para 0009, 0059, 0063). It would have been obvious to design the modified siRNA instantly claimed because the prior art of Bennett, Tan, and Bentwich had taught the sense and antisense sequences comprising SEQ ID Nos. 1551 and 1586, and the modifications instantly claimed were all well-known and routinely used in the prior art, as taught previously Keating and Saxena. One of ordinary skill in the art would have reasonably expected that the instantly claimed siRNA duplexes, and the modifications, loops, and overhangs claimed would provide enhanced targeting and inhibition of the target gene encoding alpha synuclein. For these reasons, the instant invention would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. Double Patenting Claim 92 is provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 115 of copending Application No. 19/383,234 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because both claims are drawn to RNAi oligonucleotides for reducing SNCA comprising SEQ ID No. 1621 and SEQ ID No. 1656, and the structure: PNG media_image2.png 281 419 media_image2.png Greyscale This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Allowable Subject Matter Claim 36 is objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. SEQ ID No. 1680 appears free of the prior art searched and of record. Conclusion Certain papers related to this application may be submitted to Art Unit 1637 by facsimile transmission. The faxing of such papers must conform with the notices published in the Official Gazette, 1156 OG 61 (November 16, 1993) and 1157 OG 94 (December 28, 1993) (see 37 C.F.R. ' 1.6(d)). The official fax telephone number for the Group is 571-273-8300. NOTE: If Applicant does submit a paper by fax, the original signed copy should be retained by applicant or applicant's representative. NO DUPLICATE COPIES SHOULD BE SUBMITTED so as to avoid the processing of duplicate papers in the Office. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Jane Zara whose telephone number is (571) 272-0765. The examiner’s office hours are generally Monday-Friday, 10:30am - 7pm. If attempts to reach the examiner by telephone are unsuccessful, the examiner's supervisor, Jennifer Dunston, can be reached on (571)-272-2916. Any inquiry of a general nature or relating to the status of this application should be directed to the Group receptionist whose telephone number is (703) 308-0196. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). Jane Zara 5-4-26 /JANE J ZARA/Primary Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

May 12, 2023
Application Filed
Sep 19, 2023
Response after Non-Final Action
May 29, 2026
Non-Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12655430
HUMAN CHROMOSOME 9 OPEN READING FRAME 72 (C9ORF72) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
4y 0m to grant Granted Jun 16, 2026
Patent 12655436
IMPORT OF UNNATURAL OR MODIFIED NUCLEOSIDE TRIPHOSPHATES INTO CELLS VIA NUCLEIC ACID TRIPHOSPHATE TRANSPORTERS
3y 10m to grant Granted Jun 16, 2026
Patent 12644120
NUCLEIC ACID MOLECULE TARGETING MUTATION SITE OF CYP4V2 GENE AND USE THEREOF
3y 2m to grant Granted Jun 02, 2026
Patent 12618071
MULTIMERIC OLIGONUCLEOTIDES WITH DIVIDED STRANDS
3y 5m to grant Granted May 05, 2026
Patent 12612629
DUCHENNE MUSCULAR DYSTROPHY-RELATED EXONIC SPLICING ENHANCER, sgRNA AND GENE EDITING TOOL, AND APPLICATIONS
3y 1m to grant Granted Apr 28, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
71%
Grant Probability
87%
With Interview (+16.1%)
2y 10m (~0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 1096 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month