DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Information Disclosure Statement
The information disclosure statements (IDS) submitted on 05/16/2023, 11/15/2024 are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Status of Claims
This office action is in response to Applicant's Amendment filed on February 02, 2026.
Claims 1-19 were previously pending. Applicant amended claims 4 and 7.
Claims 1-19 are currently pending, with claims 2, 5-6, 11-12 and 14-19 withdrawn.
Claims 1, 3-4, 7-10 and 13 are under examination. This is the first action on the merits.
Election/Restrictions
Applicant’s election without traverse of Group I (claims 1-13) in the reply filed on February 2, 2026 is acknowledged 1.
Applicant’s election without traverse of the following species in the reply filed on February 2, 2026 is acknowledged:
Species of primers : 1H) wherein each of the plurality of primers includes one or more cleavable groups (claim 3, 4) 2;
Species of V gene primers directed to a majority of different V genes of TCR beta coding sequence: SEQ ID No: 201 ;
Species of J gene primers directed to at least a portion of a majority of different J genes of the TCR beta coding sequence: SEQ ID No: 323;
Species of V gene primers directed to a majority of different V genes of TCR gamma coding sequence: SEQ ID No: 16;
Species of J gene primers directed to at least a portion of a majority of different J genes of the TCR gamma coding sequence: SEQ ID No: 156;
Species of sample: 1V) a blood sample (claim 13)3.
Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
Claims 2, 5-6, 11-12 and 14-19 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention.
Examination on the merits commences on claims 1, 3-4, 7-10 and 13.
Priority
The priority date of the instant claims 1, 3-4, 7-10 and 13 is 11/17/2020, filling date of the US provisional application NO.63/198,852.
Claim Interpretation
In evaluating the patentability of the claims presented in this application, claim terms have been given their broadest reasonable interpretation (BRI) consistent with the specification, as understood by one of ordinary skill in the art, as outlined in MPEP§ 2111.
For the purposes of applying prior art, claim 1 recites two sets of primers i) and ii), each comprise "a plurality of V gene primers" and "a plurality of J gene primers," without specifying their sequences. Accordingly, the terms are interpreted to encompass primers that may comprise the same or different sequences, either within or across the recited "plurality" groups or sets.
For the purposes of applying prior art, claim 1 recites an amplification step, it further recites:
"wherein performing the amplification using the set of i) and ii) primers results in amplicon molecules representing the target TCR repertoire in the sample; thereby generating target TCR amplicon molecules comprising the target TCR repertoire."
This wherein clause is interpreted as intended results that do not distinguish the claimed method from prior art methods that disclose all the claimed steps.
Per MPEP 2111.04, a wherein clause can limit a method claim if it contributes meaning and purpose to the manipulative steps. In the instant claim, however, the wherein clause describes an intended result. It does not incorporate any additional step into the method claim nor does it modify any existing method step in the claim. In other words, it merely states the intended outcome of the amplification step and makes no manipulative difference.
Therefore, this descriptive claim language in the wherein clause above is interpreted as intended results that does not further limit the scope of the claimed method.
Claim Objections
Claim 7 is objected to because of the following informalities:
In claim 7, "wherein the at least one set of i) and ii)" should read "wherein at least one set of i) and ii)," as base claim 1 recites performing amplification using each of a set of i) and ii), but does not recite "at least one set of i) and ii)."
Claim 8 depends from claim 1, it is objected to because of the following informalities:
In claim 8, line 3, "a single multiplex amplification reaction" should read "the single multiplex amplification reaction," as base claim 1 already introduces this term.
In claim 8, line 4, "a sample" should read "the sample," as base claim 1 already introduces this term.
In claim 8, lines 5-6, "determining the sequence of the molecules" should read "determining the sequence of the target TCR amplicon molecules" for consistency.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
Claims 1, 3-4, 7-10 and 13 are rejected under 35 U.S.C. 112(b), as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
A) Regarding claim 1, it recites a method "for amplification of rearranged genomic DNA (gDNA) sequences" in the preamble, including a single step to "amplify expressed target TCR nucleic acid template molecules."
This claim language is indefinite. The term "expressed target TCR nucleic acid template molecules" is not clearly defined in the specification and lacks clear metes and bounds.
First, it is unclear whether this term refers to a template for an expressed nucleic acid ꟷ implying that the molecules themselves are not yet expressed (e.g. genomic DNA); or whether it refers to a another molecule that has been expressed from a nucleic acid template (e.g., mRNA).
Second, it is also ambiguous whether "nucleic acid" modifies the template or the expressed product. For example, if a protein is expressed from an mRNA template, it is unclear whether the protein, the mRNA, or both are encompassed by the term "expressed target TCR nucleic acid template molecule."
Third, the recitation of "genomic DNA" in the preamble further confounds the scope of the claim, as the relationship between the genomic DNA and the "expressed target TCR nucleic acid template molecules" is undefined.
Therefore, as written, the scope of the claim is unclear ꟷ does it amplify genomic DNA, RNA, protein, or all of the above?
For the purpose of compact prosecution and applying prior art under 35 USC§ 102 and 103, this term "expressed target TCR nucleic acid template molecules" is interpreted under BRI to encompass any nucleic acid or protein.
B) Regarding claim 1, it further recites primers accompanied by descriptive langue that is indefinite. Specifically, the claim recites primers "directed to" a majority of different V/J genes of beta/gamma sequences as follows:
"i)
(a) a plurality of V gene primers directed to a majority of different V genes of TCR beta coding sequence comprising at least a portion of framework region 3 (FR3) within the V gene,
(b) a plurality of J gene primers directed to at least a portion of a majority of different J genes of the TCR beta coding sequence; and
ii)
(a) a plurality of V gene primers directed to a majority of different V genes of TCR gamma coding sequence comprising at least a portion of framework region 3 (FR3) within the V gene,
(b) a plurality of J gene primers directed to at least a portion of a majority of different J genes of the TCR gamma coding sequence;
wherein each set of i) and ii) primers is directed to coding sequences of the same target TCR gene selected from an TCRb and TCRg gene, respectively.”
First, the phrase "directed to," as used in reference to primers, is unclear. It is ambiguous whether this language imposes a structural limitation on the primer sequences (e.g., requiring a certain degree of sequence identify to the recited V/J gene regions; or requiring a modification that is specific to the recited V/J gene regions), or a functional limitation (e.g., capable of binding to or amplifying such sequence regions).
For instance, it is unclear whether this means the primers are required to have a certain degree of percent sequence identity to the majority of different V/J genes, or whether it merely requires that the primers are capable of amplifying those regions, regardless of sequence identity. If latter, the primers could encompass sequences located upstream, downstream, or even within these regions in a genome.
Second, the phrase "majority of " different V/J genes of beta/gamma sequences lacks clear metes and bounds. The specification does not disclose the referenced sequences, nor does it provide guidance or description on how to determine what qualifies as a "majority." It is unclear whether this refers to a numerical threshold (e.g. sequence abundance), a particular number of subsets (e.g., gene variants), or whether it depends on other context-specific criteria.
For example, in a hypothetical population with sequences A, B, C, D, and E, having relative abundances of 50%, 19%, 1%, 10%, and 20%, respectively:
- A and C may represent a majority by abundance (51%) but only two of five variants.
- C, D and E may present a majority of sequence variants (3 vs. 2) but only 31% of the total abundance.
Thus, without clarification, it is unclear how "majority" is to be determined.
For the purpose of compact prosecution and applying prior art under 35 USC§ 102 and 103, the primers in claim 1 are interpreted to encompass any sequences capable of amplifying the V and/or J regions within TCR beta or TCR gamma genes. As random primers can amplify the entire genome, the claim also encompass such primers 4.
C) Claim 1 is also indefinite for reciting "the target TCR repertoire," which lacks antecedent basis.
Claims 3-4, 7-10 and 13 are rejected for depending from claim 1 and not remedying the indefiniteness.
D) Regarding claim 8, it recites "the determined target TCR sequences," which lacks antecedent basis. It is unclear if this refers to the "rescued productive sequence reads" in the prior recitation, or something else.
Claims 9-10 and 13 are rejected for depending from claim 8 and not remedying the indefiniteness.
E) Regarding claim 10, it recites "wherein the target TCR gene is TCR beta and TCR gamma." However, the term "target TCR gene" is not introduced or recited in the base claims and therefore lacks antecedent basis. While claim 1 includes the phrase "the same target TCR gene selected from an TCRb and TCRg gene," as part of the description for the primer set, it does not specify any target TCR gene required in any of the steps. Additionally, the recitation in claim 10 does not appear to align with the use of "the same target TCR gene" in claim 1's context. It is unclear what the "target" refers to ꟷ whether the target of sequencing, amplification, or biomarker identification, to give a few examples. As such, the scope of this claim is indefinite.
Claim Rejections - 35 USC § 112(d)
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 10 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Regarding claim 10, it recites "wherein the target TCR gene is TCR beta and TCR gamma."
This dependent claim is improper because it does not add any limitation to the subject matter of claim 8/1, which does not require "target TCR gene" in any of its steps. Therefore, claim 10 merely describes a term that lacks antecedent basis and does not further limit or meaningfully modify the method recited therein.
Therefore, claim 10 fails to further limit the subject matter of claim 8/1, from which it depends.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1, 3-4, 7-10 and 13 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea) without significantly more.
Claim 1 recites a method for amplification of rearranged genomic DNA (gDNA) sequences of a T cell receptor (TCR) repertoire in a sample, comprising performing an amplification reaction using primers with unspecified structure.
Following the analysis below the claims are not patent eligible under 35 U.S.C. 101.
Step 1 - Whether the Claim is to a Statutory Category : YES. The claims are drawn to a method, therefore to one of the four statutory categories.
Step 2A Prong 1 - Whether the Claim Recite an Abstract idea, Law of Nature, or Natural Phenomenon: Yes. The claim relies on the natural phenomenon of somatic rearrangement of T-cell receptor genes and broadly recites an amplification step to observe this phenomenon.
T-cell receptor gene rearrangement and the resulting T-cell clonality are natural phenomena that have long been widely utilized as biomarkers for disease diagnosis (see Davies, Kate et al. ; Advances in the assessment of T-cell clonality Diagnostic Histopathology, Volume 26, Issue 9, 388 – 397; September 2020; in abstract ; see also "T-Cell Receptor Gene Rearrangements Profile, γ and β" www .labcorp.com/tests/481080/t-cell-receptor-gene-rearrangements-profile-y-and-b#test-details ).
T-cell Receptor gene rearrangements occur naturally during T-cell development, acting as a unique barcode for each cell: in neoplastic proliferations subsets of these barcodes become expanded and can therefore be detected as clonal populations.
The marked diversity of somatic TCR-gene rearrangements is important for normal immune functions but also serves as a valuable marker to distinguish abnormal T-cell proliferations from reactive processes. A monoclonal expansion of a T-cell population will result in the predominance of a single TCR-gene rearrangement pattern. In contrast, reactive T-cell expansions are polyclonal (or multiclonal), with no single clonotypic population predominating in the population of T cells.
Thus, the presence of a monoclonal gene rearrangement could reflect the presence of a T-lymphocytic neoplasm, while polyclonal gene rearrangement patterns are found in benign reactive conditions.
As stated in MPEP 2106.04(b)(I), laws of nature and natural phenomena, as identified by the courts, include naturally occurring principles/relations and nature-based products that are naturally occurring or that do not have markedly different characteristics compared to what occurs in nature. A sample comprising genomic DNA (gDNA) sequences of a T cell receptor (TCR) repertoire, which naturally possesses T-cell receptor gene rearrangement is classified as naturally occurring principles/relations.
In conclusion, the claims recite laws of nature and natural phenomena.
Step 2A Prong 2- Whether the Claim Recite Additional Elements that Integrate the Judicial Exception into a Practical Application: No. The claim does not integrate the judicial exception into a practical application. For a claim reciting a judicial exception to be eligible, the additional elements (if any) in the claim must “transform the nature of the claim” into a patent-eligible application of the judicial exception, Alice Corp., 573 U.S. at 217, 110 USPQ2d at 1981.
Here, claim 1 recites performing a "single multiplex amplification reaction." However, this specified technique does not transform the judicial exception into a practical application; it merely describes observing the judicial exception of a natural phenomenon of somatic rearrangement of T-cell receptor genes, using a specific means. Whether a single or more than one multiplex amplification(s) reaction is/are used, the process still involves observing the natural phenomenon. The claimed multiplex lacks specificity; instead it is a general statement to apply a multiplex to a natural phenomenon. Nor does a generic multiplex amplification of a natural phenomenon meet any of the known practical applications in MPEP § 2106.04(d). The claim does not include any additional steps or actions based on the outcome of the amplification that extend beyond merely observing the naturally occurring gene rearrangement. Thus, the method step merely observes the judicial exception and do not integrate it into a practical application.
It is now well settled under Federal Circuit case law that the use of conventional techniques in a standard way to observe nucleic acids in a biological sample is not eligible for patentability under 35 U.S.C. § 101. CareDx, Inc. v. Natera, Inc., 40 F.4th 1371, 1377 (Fed. Cir. 2022). Therefore, to impose a meaningful limit, a claim must do more than simply apply the natural law with methods/approaches that are known in the art.
Step 2B- Whether a Claim Amounts to Significantly More: No. In this instant case, the claims, when considered as a whole, do not recite any inventive concept with additional elements that amount to significantly more than the judicial exception.
Claim 1 does not further recite any additional elements that amount to significantly more. While the claim recites a single multiplex amplifying step using primers with unspecified structure and function, single multiplex amplification is well-known and conventional approach in the art of immune repertoire analysis. See in Langerak (Langerak et al., EuroClonality/BIOMED-2 guidelines for interpretation and reporting of Ig/TCR clonality testing in suspected lymphoproliferations. Leukemia. 2012 Oct;26(10):2159-71. doi: 10.1038/leu.2012.246. Epub 2012 Aug 24. PMID: 22918122; PMCID: PMC3469789) for example, which describes individual multiplex PCR reactions have been well standardized for nearly all TCR targets, and have now become the world standard for PCR-based Ig/TCR clonality testing (Abstract; introduction). Dependent claim 8 further recites sequencing step, but determining the marker level through PCR amplification and sequencing represents well-understood, routine, conventional activity in the life science arts, as recognized by the courts. See University of Utah Research Foundation v. Ambry Genetics, 774 F.3d 755, 764, 113 USPQ2d 1241, 1247 (Fed. Cir. 2014). And as recognized by the courts, "determining the level of a biomarker in blood by any means" is a well-understood, routine, conventional activity in the life science arts, see MPEP 2106.05.
Applicant elects SEQ ID Nos: 201; 323; 16; and 156 as primers in sets i) and ii). However, all of these primer sequences are found in nature.
DEFINITION Homo sapiens clone PSA.S.20 T-cell receptor beta chain mRNA, partial cds.
Qy 1 AATCTTCACATCAATTCCCTGGAG 24 (SEQ ID No: 201)
||||||||||||||||||||||||
Db 21 AATCTTCACATCAATTCCCTGGAG 44 (GenBank #AY190093)
DEFINITION Callithrix jacchus TRBJ2-5 mRNA for T-cell receptor beta chain, partial cds.
Qy 1 CAGGAGCCGCGTGCCTG 17 (SEQ ID No: 323)
|||||||||||||||||
Db 40 CAGGAGCCGCGTGCCTG 24 (GenBank #AB504517)
DEFINITION Homo sapiens isolate T715A truncated T cell receptor gamma (TRG\@)
Qy 1 TTGAGAATGATACTGCGAAATCTTATTGAAAA 32 (SEQ ID No: 16)
||||||||||||||||||||||||||||||||
Db 139 TTGAGAATGATACTGCGAAATCTTATTGAAAA 170 (GenBank #DQ865441)
DEFINITION H.sapiens T-cell receptor mRNA
Qy 1 ACAAGTGTTGTTCCACTGCCAAA 23 (SEQ ID No: 156)
|||||||||||||||||||||||
Db 51 ACAAGTGTTGTTCCACTGCCAAA 29 (GenBank #Z22676)
Therefore, the claims do not appear to add markedly different characteristics that significantly modify or use the naturally occurring principle in a manner that is not naturally occurring. The dependent claims 3-4, 7-10 and 13 do not recite additional elements that amount to significantly more than the judicial exception, as they either further describe the judicial exception or represent mere general linkage of the judicial exception to the additional elements in the claims (MPEP § 2106.05(h)).
In conclusion, the claims are not patent eligible under 35 U.S.C. 101.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims1, 3-4, 7-10 and 13 are rejected under 35 U.S.C. 103 as being unpatentable over
Lowman( Lowman et al.; US20190085374A1 - Compositions and methods for immune repertoire sequencing; published 2019-03-21).
Claim 1 recites a method comprising performing a single multiplex amplification reaction using each of a set of primer sets i) and ii). This method is interpreted to require performing a single amplification reaction that includes both primer sets. The primers in claim 1 are interpreted to encompass any sequences capable of amplifying the V and/or J regions within TCR beta or TCR gamma genes.
A) Lowman discloses methods for immune repertoire sequencing using target-specific primer panels designed for efficient amplification and improved sequencing performance (abstract).
Regarding claim 1, Lowman teaches performing a single multiplex amplification reaction comprising multiple primers that promote amplification of different rearranged target nucleic acid molecules ([0244]). Lowman further teaches that the multiplex amplification reaction is used to amplify rearranged TCR genomic DNA, including TCR beta and TCR gamma ([0037]; and that such amplification uses (i) a set of primers each of which anneals to at least a portion of the V gene FR3 region and (ii) a set of primers which anneal to a portion of the J gene to amplify TCR gDNA ([0038]).
Although Lowman does not explicitly disclose in a single embodiment performing a multiplex amplification reaction with primers that simultaneously amplify both the V and J regions of TCR beta and TCR gamma, it provides ample teachings, as discussed above, that would render such a method obvious. A person of ordinary skill in the art, in view of Lowman, would understand that its teachings encompass a method involving a single multiplex amplification reaction comprising multiple primers to amplify different arranged TCR genomic DNA targets ꟷ including both TCR beta and TCR gamma ꟷ using (i) a set of primers for amplifying V genes and (ii) a set of primers for amplifying J genes for each TCR target.
This combination would have been obvious as it represents the KSR principle of predictable use of prior art elements according to a known method to yield predictable results. (See MPEP §2143).
A skilled artisan would have been motivated to perform such a method because Lowman already teaches using multiplex amplification reaction to amplify rearranged TCR genomic DNA, including both TCR beta and TCR gamma, thus identifying both as targets of interest. While Lowman does not explicitly state that primers for TCR beta and gamma are combined into a single amplification reaction, one of ordinary skill in the art would have been motivated to do so in order to simultaneously amplify multiple targets of interest from the same sample, as suggested by Lowman (page 32, right-hand col, lines 4-7), thereby improve assay throughput.
B) Regarding claim 3, Lowman teaches each of the plurality of primers includes one or more cleavable groups ([0056]).
Regarding claim 4, Lowman teaches primers includes two or more modified nucleotides having a cleavable group selected from a methylguanine, 8-oxo-guanine, xanthine, hypoxanthine, 5,6-dihydrouracil, uracil, 5-methylcytosine, thymine-dimer, 7-methylguanosine, 8-oxo- deoxyguanosine, xanthosine, inosine, dihydrouridine, bromodeoxyuridine, uridine or 5-methylcytidine ([0056]).
Regarding claim 7, Lowman teaches primers comprising SEQ ID NO: 201 (SEQ ID 185) and SEQ ID NO: 323 (SEQ ID 330), thus meeting the limitation of "at least one set" of primer selected from Tables 2-5.
Regarding claim 8, Lowman teaches performing a single multiplex amplification reaction to amplify target TCR nucleic acid template molecules from a sample from the subject according to claim 1 ([0244]; [0037]-[0038]; [0041-0042] ; [0044]);
performing sequencing of the target TCR amplicon molecules and determining the sequence of the molecules ([0013] “sequencing of the immune receptor amplicon molecules is carried out using next generation sequence analysis to determine sequence of the immune receptor amplicons”; [0023] “a multiplex next generation sequencing workflow for effective detection and analysis of the immune repertoire in a sample” using PCR amplification to “ enrich rearranged target immune cell receptor gene sequences from gDNA for subsequent sequencing”; [0025]; ,
wherein determining the sequence includes obtaining initial sequence reads, aligning the initial sequence read to a reference sequence, identifying productive reads, and correcting one or more indel errors to generate rescued productive sequence reads ([0013]; [0025] lines 17-27; [0112]; [0117] lines 20-26; [0135]);
identifying TCR repertoire clonal populations from the determined target TCR sequences ([0134]-[00135] “ identifying and/or characterizing immune repertoire clonal populations in a sample from a subject, comprising performing one or more multiplex amplification reactions…”); and
identifying the sequence of at least one TCR clone for use as a biomarker for the disease or condition in the subject ([0134] lines 18-25).
Regarding claim 9, Lowman teaches cancer ([0134] lines 18-25).
Regarding claim 10, it is obvious in view of the combined teachings of Lowman because it does not further limit the claimed method. See Claim Rejections - 35 USC § 112(d) for detailed discussion.
Regarding claim 13, Lowman teaches blood sample ([0063] line 6; [0147]; [0261]).
Prior Art
Other prior art also teach amplifying and sequencing TCR beta and TCR gamma gene for analyzing T cell receptor (TCR) repertoire:
WO2015134787A2 - Methods using randomer-containing synthetic molecules; Figure 1B;
US20180208984A1 -Compositions and methods for immune repertoire sequencing;
WO2019046817A1 - Compositions and methods for immune repertoire sequencing.
Double Patenting- Obvious Type
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 3 and 7 are rejected on the ground of nonstatutory obviousness-type double patenting as being unpatentable over claims 1 and 5 of U.S. Patent No. 11008609B2, in view of Lowman (Lowman et al.; US20190085374A1 - Compositions and methods for immune repertoire sequencing; published 2019-03-21).
Instant claim 1 recites:
A method for amplification of rearranged genomic DNA (gDNA) sequences of a T cell receptor (TCR) repertoire in a sample, comprising:
performing a single multiplex amplification reaction (‘ 609 Patent, claim 1) to amplify expressed target TCR nucleic acid template molecules using each of a set of:
i) (a) a plurality of V gene primers (‘ 609 Patent, claim 1) directed to a majority of different V genes of TCR beta coding sequence comprising at least a portion of framework region 3 (FR3) within the V gene,
(b) a plurality of J gene primers (‘ 609 Patent, claim 1) directed to at least a portion of a majority of different J genes of the TCR beta coding sequence; and
ii) (a) a plurality of V gene primers(‘ 609 Patent, claim 1) directed to a majority of different V genes of TCR gamma coding sequence comprising at least a portion of framework region 3 (FR3) within the V gene,
(b) a plurality of J gene primers (‘ 609 Patent, claim 1) directed to at least a portion of a majority of different J genes of the TCR gamma coding sequence;
wherein each set of i) and ii) primers is directed to coding sequences of the same target TCR gene (‘ 609 Patent, claim 1) selected from an TCRb and TCRg gene, respectively, and
wherein performing the amplification using the set of i) and ii) primers results in amplicon molecules representing the target TCR repertoire in the sample; thereby generating target TCR amplicon molecules comprising the target TCR repertoire.
The '609 Patent in claim 1 claims a method for amplifying rearranged genomic DNA sequences of T cell receptors in a sample, comprising performing a single multiplex amplification reaction using V gene and J gene primers. While the '609 Patent does not explicitly claim primers capable of amplifying T-cell receptor gamma and beta genes, this aspect is encompassed by the claim in light of the general knowledge in the art.
Lowman in paragraph [0033] discloses that T-cell receptor rearrangement involves both the beta and gamma genes within their V and J gene segments. Therefore, a skilled artisan would have found it obvious to include the use of primers that amplify the beta and gamma genes while applying the method claimed in the '609 Patent for the detection of T-cell receptor gene rearrangements. The use of such primers for amplifying known T-cell receptor gene regions where gene rearrangements occur, in a method for amplifying rearranged genomic DNA sequences of T cell receptors represents a predictable use of prior art elements according to known methods to yield predictable results (see MPEP §2143).
Therefore, the instant claim 1 lacks patentable distinction over the '609 patent in view of Lowman.
Therefore, instant claims 1 and 3 are obvious over claim 1 of the '609 patent, in view of Lowman. Instant claim 7 is obvious over claim 5 of the '609 patent, in view of Lowman.
Claim 1 is provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 6 of copending Application No. 19/009,681(reference application, amended claims filed on 02/10/2025), in view of Lowman( Lowman et al.; US20190085374A1 - Compositions and methods for immune repertoire sequencing; published 2019-03-21).
Instant claim 1 recites:
A method for amplification of rearranged genomic DNA (gDNA) sequences of a T cell receptor (TCR) repertoire in a sample, comprising:
performing a single multiplex amplification reaction (‘ 681 Application, claim 6) to amplify expressed target TCR nucleic acid template molecules using each of a set of:
i) (a) a plurality of V gene primers (‘ 681 Application, claim 6) directed to a majority of different V genes of TCR beta coding sequence comprising at least a portion of framework region 3 (FR3) within the V gene,
(b) a plurality of J gene primers (‘ 681 Application, claim 6) directed to at least a portion of a majority of different J genes of the TCR beta coding sequence; and
ii) (a) a plurality of V gene primers (‘ 681 Application, claim 6) directed to a majority of different V genes of TCR gamma coding sequence comprising at least a portion of framework region 3 (FR3) within the V gene,
(b) a plurality of J gene primers (‘ 681 Application, claim 6) directed to at least a portion of a majority of different J genes of the TCR gamma coding sequence;
wherein each set of i) and ii) primers is directed to coding sequences of the same target TCR gene (‘ 681 Application, claim 6) selected from an TCRb and TCRg gene, respectively, and
wherein performing the amplification using the set of i) and ii) primers results in amplicon molecules representing the target TCR repertoire in the sample; thereby generating target TCR amplicon molecules comprising the target TCR repertoire.
The ‘681 Application in claim 6 claims a method for amplifying rearranged genomic DNA sequences of T cell receptors in a sample, comprising performing a multiplex amplification reaction using V gene and J gene primers. While the ‘681 Application does not explicitly claim primers capable of amplifying T-cell receptor gamma and beta genes, this aspect is encompassed by the claim in light of the general knowledge in the art.
Lowman in paragraph [0033] discloses that T-cell receptor rearrangement involves both the beta and gamma genes within their V and J gene segments. Therefore, a skilled artisan would have found it obvious to include the use of primers that amplify the beta and gamma genes while applying the method claimed in the ‘681 Application for the detection of T-cell receptor gene rearrangements. The use of such primers for amplifying known T-cell receptor gene regions where gene rearrangements occur, in a method for amplifying rearranged genomic DNA sequences of T cell receptors represents a predictable use of prior art elements according to known methods to yield predictable results (see MPEP §2143).
Therefore, the instant claim 1 lacks patentable distinction over the ‘681 Application in view of Lowman.
Therefore, instant claim 1 is obvious over claim 6 of the ‘681 Application , in view of Lowman.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 1, 3 and 7 are rejected on the ground of nonstatutory obviousness-type double patenting as being unpatentable over claims 1 and 4 of U.S. Patent No. 10920273B2, in view of Lowman( Lowman et al.; US20190085374A1 - Compositions and methods for immune repertoire sequencing; published 2019-03-21).
Instant claim 1 recites:
A method for amplification of rearranged genomic DNA (gDNA) sequences of a T cell receptor (TCR) repertoire in a sample, comprising:
performing a single multiplex amplification reaction (‘273 Patent, claim 1) to amplify expressed target TCR nucleic acid template molecules using each of a set of:
i) (a) a plurality of V gene primers(‘273 Patent, claim 1) directed to a majority of different V genes of TCR beta coding sequence comprising at least a portion of framework region 3 (FR3) within the V gene,
(b) a plurality of J gene primers(‘273 Patent, claim 1) directed to at least a portion of a majority of different J genes of the TCR beta coding sequence; and
ii) (a) a plurality of V gene primers(‘273 Patent, claim 1) directed to a majority of different V genes of TCR gamma coding sequence comprising at least a portion of framework region 3 (FR3) within the V gene,
(b) a plurality of J gene primers (‘273 Patent, claim 1) directed to at least a portion of a majority of different J genes of the TCR gamma coding sequence;
wherein each set of i) and ii) primers is directed to coding sequences of the same target TCR gene (‘273 Patent, claim 1) selected from an TCRb and TCRg gene, respectively, and
wherein performing the amplification using the set of i) and ii) primers results in amplicon molecules representing the target TCR repertoire in the sample; thereby generating target TCR amplicon molecules comprising the target TCR repertoire.
The ‘273 Patent in claim 1 claims a method for amplifying nucleic acid sequences of an immune receptor repertoire of T cell receptors in a sample, comprising performing a single multiplex amplification reaction using V gene and J gene primers. While the ‘273 Patent does not explicitly claim primers capable of amplifying T-cell receptor gamma and beta genes, this aspect is encompassed by the claim in light of the general knowledge in the art.
Lowman in paragraph [0033] discloses the diverse immune repertoire of T-cell receptor is due to the process of TCR gene rearrangement, which involves both the beta and gamma genes within their V and J gene segments. Therefore, a skilled artisan would have found it obvious to include the use of primers that amplify the beta and gamma genes while applying the method claimed in the ‘273 Patent for the detection of T-cell receptor gene rearrangements. The use of such primers for amplifying known T-cell receptor gene regions where gene rearrangements occur, in a method for amplifying rearranged genomic DNA sequences of T cell receptors represents a predictable use of prior art elements according to known methods to yield predictable results (see MPEP §2143).
Therefore, the instant claim 1 lacks patentable distinction over the ‘273 Patent in view of Lowman.
Therefore, instant claims 1 and 3 are obvious over claim 1 of the ‘273 Patent, in view of Lowman. Instant claim 7 is obvious over claim 4 of the ‘273 Patent, in view of Lowman.
Claims 1, 3 and 7 are rejected on the ground of nonstatutory obviousness-type double patenting as being unpatentable over claims 1 and 12 of U.S. Patent No. 11970787B2, in view of Lowman( Lowman et al.; US20190085374A1 - Compositions and methods for immune repertoire sequencing; published 2019-03-21).
Instant claim 1 recites:
A method for amplification of rearranged genomic DNA (gDNA) sequences of a T cell receptor (TCR) repertoire in a sample, comprising:
performing a single multiplex amplification reaction (‘787 Patent, claim 1)to amplify expressed target TCR nucleic acid template molecules using each of a set of:
i) (a) a plurality of V gene primers(‘787 Patent, claim 1) directed to a majority of different V genes of TCR beta coding sequence comprising at least a portion of framework region 3 (FR3) within the V gene,
(b) a plurality of J gene primers(‘787 Patent, claim 1) directed to at least a portion of a majority of different J genes of the TCR beta coding sequence; and
ii) (a) a plurality of V gene primers(‘787 Patent, claim 1) directed to a majority of different V genes of TCR gamma coding sequence comprising at least a portion of framework region 3 (FR3) within the V gene,
(b) a plurality of J gene primers (‘787 Patent, claim 1) directed to at least a portion of a majority of different J genes of the TCR gamma coding sequence;
wherein each set of i) and ii) primers is directed to coding sequences of the same target TCR gene(‘787 Patent, claim 1) selected from an TCRb and TCRg gene, respectively, and
wherein performing the amplification using the set of i) and ii) primers results in amplicon molecules representing the target TCR repertoire in the sample; thereby generating target TCR amplicon molecules comprising the target TCR repertoire.
The ‘787 Patent in claim 1 claims a method for preparing a T-cell immune receptor repertoire library, comprising performing a single multiplex amplification reaction using V gene and J gene primers. While the ‘787 Patent does not explicitly claim primers capable of amplifying T-cell receptor gamma and beta genes, this aspect is encompassed by the claim in light of the general knowledge in the art.
Lowman in paragraph [0033] discloses the diverse immune repertoire of T-cell receptor is due to the process of TCR gene rearrangement, which involves both the beta and gamma genes within their V and J gene segments. Therefore, a skilled artisan would have found it obvious to include the use of primers that amplify the beta and gamma genes while applying the method claimed in the ‘787 Patent for the detection of T-cell receptor gene rearrangements. The use of such primers for amplifying known T-cell receptor gene regions where gene rearrangements occur, in a method for amplifying rearranged genomic DNA sequences of T cell receptors represents a predictable use of prior art elements according to known methods to yield predictable results (see MPEP §2143).
Therefore, the instant claim 1 lacks patentable distinction over the ‘787 Patent in view of Lowman.
Therefore, instant claims 1 and 3 are obvious over claim 1 of the ‘787 Patent, in view of Lowman. Instant claim 7 is obvious over claim 12 of the ‘787 Patent, in view of Lowman.
Claims 1 and 3 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1 of copending Application No.18/606,205 (reference application, amended claims filed on 08/23/2024), in view of Lowman( Lowman et al.; US20190085374A1 - Compositions and methods for immune repertoire sequencing; published 2019-03-21).
Instant claim 1 recites:
A method for amplification of rearranged genomic DNA (gDNA) sequences of a T cell receptor (TCR) repertoire in a sample, comprising:
performing a single multiplex amplification reaction (‘205 Application, claim 1) to amplify expressed target TCR nucleic acid template molecules using each of a set of:
i) (a) a plurality of V gene primers(‘205 Application, claim 1) directed to a majority of different V genes of TCR beta coding sequence comprising at least a portion of framework region 3 (FR3) within the V gene,
(b) a plurality of J gene primers(‘205 Application, claim 1) directed to at least a portion of a majority of different J genes of the TCR beta coding sequence; and
ii) (a) a plurality of V gene primers(‘205 Application, claim 1) directed to a majority of different V genes of TCR gamma coding sequence comprising at least a portion of framework region 3 (FR3) within the V gene,
(b) a plurality of J gene primers (‘205 Application, claim 1) directed to at least a portion of a majority of different J genes of the TCR gamma coding sequence;
wherein each set of i) and ii) primers is directed to coding sequences of the same target TCR gene(‘205 Application, claim 1) selected from an TCRb and TCRg gene, respectively, and
wherein performing the amplification using the set of i) and ii) primers results in amplicon molecules representing the target TCR repertoire in the sample; thereby generating target TCR amplicon molecules comprising the target TCR repertoire.
The ‘205 Application in claim 1 claims a method for providing sequence of a T-cell immune receptor repertoire , comprising performing a single multiplex amplification reaction using V gene and J gene primers. While the ‘205 Application does not explicitly claim primers capable of amplifying T-cell receptor gamma and beta genes, this aspect is encompassed by the claim in light of the general knowledge in the art.
Lowman in paragraph [0033] discloses the diverse immune repertoire of T-cell receptor is due to the process of TCR gene rearrangement, which involves both the beta and gamma genes within their V and J gene segments. Therefore, a skilled artisan would have found it obvious to include the use of primers that amplify the beta and gamma genes while applying the method claimed in the ‘205 Application for the detection of T-cell receptor gene rearrangements. The use of such primers for amplifying known T-cell receptor gene regions where gene rearrangements occur, in a method for amplifying rearranged genomic DNA sequences of T cell receptors represents a predictable use of prior art elements according to known methods to yield predictable results (see MPEP §2143).
Therefore, the instant claim 1 lacks patentable distinction over the ‘205 Application in view of Lowman. Instant claims 1 and 3 are obvious over claim 1 of the ‘205 Application, in view of Lowman.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 1, 3, 8-9 and 13 are rejected on the ground of nonstatutory obviousness-type double patenting as being unpatentable over claims 1, 10-11 and 15 of U.S. Patent No. 12473663B2, in view of Lowman (Lowman et al.; US20190085374A1 - Compositions and methods for immune repertoire sequencing; published 2019-03-21).
Instant claim 1 recites:
A method for amplification of rearranged genomic DNA (gDNA) sequences of a T cell receptor (TCR) repertoire in a sample, comprising:
performing a single multiplex amplification reaction (‘663 Patent, claim 1) to amplify expressed target TCR nucleic acid template molecules using each of a set of:
i) (a) a plurality of V gene primers(‘663 Patent, claim 1) directed to a majority of different V genes of TCR beta coding sequence comprising at least a portion of framework region 3 (FR3) within the V gene,
(b) a plurality of J gene primers(‘663 Patent, claim 1) directed to at least a portion of a majority of different J genes of the TCR beta coding sequence; and
ii) (a) a plurality of V gene primers(‘663 Patent, claim 1) directed to a majority of different V genes of TCR gamma coding sequence comprising at least a portion of framework region 3 (FR3) within the V gene,
(b) a plurality of J gene primers(‘663 Patent, claim 1) directed to at least a portion of a majority of different J genes of the TCR gamma coding sequence;
wherein each set of i) and ii) primers is directed to coding sequences of the same target TCR gene(‘663 Patent, claim 1) selected from an TCRb and TCRg gene, respectively, and
wherein performing the amplification using the set of i) and ii) primers results in amplicon molecules representing the target TCR repertoire in the sample; thereby generating target TCR amplicon molecules comprising the target TCR repertoire.
The ‘663 Patent in claim 1 claims a method for amplifying nucleic acid sequences of an immune receptor repertoire of T cell receptors in a sample, comprising performing a single multiplex amplification reaction using V gene and J gene primers. While the ‘663 Patent does not explicitly claim primers capable of amplifying T-cell receptor gamma and beta genes, this aspect is encompassed by the claim in light of the general knowledge in the art.
Lowman in paragraph [0033] discloses the diverse immune repertoire of T-cell receptor is due to the process of TCR gene rearrangement, which involves both the beta and gamma genes within their V and J gene segments. Therefore, a skilled artisan would have found it obvious to include the use of primers that amplify the beta and gamma genes while applying the method claimed in the ‘663 Patent for the detection of T-cell receptor gene rearrangements. The use of such primers for amplifying known T-cell receptor gene regions where gene rearrangements occur, in a method for amplifying rearranged genomic DNA sequences of T cell receptors represents a predictable use of prior art elements according to known methods to yield predictable results (see MPEP §2143).
Therefore, the instant claim 1 lacks patentable distinction over the ‘663 Patent in view of Lowman.
Therefore, instant claims 1 and 3 are obvious over claim 1 of the ‘663 Patent, in view of Lowman. Instant claims 8-9 and 13 are obvious over claims 10-11 and 15 of the ‘663 Patent in view of Lowman.
Conclusion
Claims 7-8 are objected to; claims 1, 3, 8-9 and 13 are rejected. No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to TIAN NMN YU whose telephone number is (703)756-4694. The examiner can normally be reached Monday - Friday 8:30 am - 5:30 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at (571) 272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/TIAN NMN YU/Examiner , Art Unit 1681 /AARON A PRIEST/Primary Examiner, Art Unit 1681
1 Claims 14-19 are withdrawn as being drawn to non-elected group II.
2 Claims 2 and 5-6 are withdrawn as being drawn to non-elected species 1A-1G and 1J.
3 Claims 11-12 are withdrawn as being drawn to non-elected species 1K-1R.
4 See "Whole Genome Amplification & Multiple Displacement Amplification"; www .neb.com/en-us/applications/dna-amplification-pcr-and-qpcr/isothermal-amplification/whole-genome-amplification-and-multiple-displacement-amplification;
See also Nelson JR. Random-primed, Phi29 DNA polymerase-based whole genome amplification. Curr Protoc Mol Biol. 2014 Jan 6;105:Unit 15.13.. doi: 10.1002/0471142727.mb1513s105. PMID: 24510438.