Prosecution Insights
Last updated: April 19, 2026
Application No. 18/320,355

COMPOSITIONS AND METHODS OF NUCLEIC ACID-TARGETING NUCLEIC ACIDS

Final Rejection §103§112§DP
Filed
May 19, 2023
Examiner
KONOPKA, CATHERINE ANNE
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Caribou Biosciences Inc.
OA Round
4 (Final)
59%
Grant Probability
Moderate
5-6
OA Rounds
3y 10m
To Grant
99%
With Interview

Examiner Intelligence

Grants 59% of resolved cases
59%
Career Allow Rate
104 granted / 177 resolved
-1.2% vs TC avg
Strong +63% interview lift
Without
With
+62.6%
Interview Lift
resolved cases with interview
Typical timeline
3y 10m
Avg Prosecution
56 currently pending
Career history
233
Total Applications
across all art units

Statute-Specific Performance

§101
5.3%
-34.7% vs TC avg
§103
32.4%
-7.6% vs TC avg
§102
14.3%
-25.7% vs TC avg
§112
29.4%
-10.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 177 resolved cases

Office Action

§103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status and Withdrawn Rejections Applicant’s amendments filed December 16, 2025, amending claim 52 and adding new claims 56-59 is acknowledged. Claims 52-54 and 56-59 are pending and under examination. The amendments to claim 52 requiring specific features of the first and second guide RNA overcome the §103 rejections in the previous office action. The previous §103 rejections are withdrawn. New §103 rejections, necessitated by amendment, are included below. The claims in copending application 19/020523 have been amended to only include methods of modifying target nucleic acids with a Cas9-effector fusion protein, which are patentably distinct from the instantly claimed methods for enriching and sequence target nucleic acids. The nonstatutory double patenting rejection over claims in the 19/020523 application is withdrawn Priority As indicated in the office action mailed December 12, 2024, the first disclosure of methods for excising, purifying and sequencing a cleaved target nucleic acid is in US provisional application 61/818,382, filed May 1, 2013. However, the first disclosure of single guide RNAs having a tracrRNA with at least two or three hairpin/stems in addition to the hybridized tracrRNA/crRNA segment (see interpretation in paragraph 7 below) is in US provisional application 61/903232 (FIG 5), filed November 12, 2013. Therefore, the effective filing date of the claims 52-54 and 56-57 is November 12, 2013. A thorough search of the 16 provisional applications the present application claims priority to found no disclosure of single guide RNAs comprising the sequence of SEQ ID NOs 1469, 1470, 1471 or 1474. Additionally, the provisional applications do not appear to disclose a single guide RNA wherein the minimum crRNA and tracrRNA sequences comprise at region of hybridized nucleotides and a bulge region, but not a second region of hybridized nucleotides as recited in claim 58. The closest disclosure is in application 61/903232, FIG 7, v14-v16. The v14-v16 guide RNAs do comprise a duplex region and no “first stem”, but do not comprise a “bulge” region. The first disclosure of the single guide RNAs with the above SEQ ID NOs, which have the claimed guide structure recited in claim 58, is in application PCT/US2014/023828, filed March 12, 2014. Therefore, the effective filing date of claims 58-59 is March 12, 2014. Claim Interpretation PNG media_image1.png 524 1431 media_image1.png Greyscale Claim 52 recites a single guide with 1) a 5’ spacer sequence, 2) a minimum CRISPR repeat sequence, 3) a minimum tracrRNA sequence, 4) a single guide connector sequence connecting the minimum CRISPR repeat sequence and the minimum tracrRNA sequence, and 5) a 3’ tracrRNA having at least a hairpin region and a second stem. FIG. 1B and paragraph [00285] of the Specification, which are reproduced below, are used to interpret the structure of the claimed single guide RNA. The Specification doesn’t define “duplex”, “hairpin” or “stem” and it appears that they are used interchangeably. Accordingly, “hairpin” and “stem” are interpreted as being substantially the same. Thus, the claimed single guide RNA (sgRNA) in claim 52 must include 1) a spacer sequence, 2) minimum crRNA and tracrRNA sequences, which can optionally hybridize, connected by a linker, and 3) tracrRNA sequences that form at least two hairpins/stems in addition to the tracrRNA sequence that forms a duplex with the crRNA-derived sequence. Claim 58 recites an sgRNA wherein the minimum crRNA and tracrRNA sequence comprise a first duplex and bulge, but do not have a “first stem”. Claim 58 is interpreted as the duplexed region in element 155 above is not present, but the linker region of element 155 is present. Claim Rejections - 35 USC § 112(a) – New Matter The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claim 57 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a NEW MATTER rejection. MPEP 2163.II.A.3.(b) states, “when filing an amendment an applicant should show support in the original disclosure for new or amended claims” and “[i]f the originally filed disclosure does not provide support for each claim limitation, or if an element which applicant describes as essential or critical is not claimed, a new or amended claim must be rejected under 35 U.S.C. 112a, as lacking adequate written description". According to MPEP § 2163.I.B, "While there is no in haec verba requirement, newly added claim limitations must be supported in the specification through express, implicit, or inherent disclosure" and "The fundamental factual inquiry is whether the specification conveys with reasonable clarity to those skilled in the art that, as of the filing date sought, applicant was in possession of the invention as now claimed. See, e.g., Vas-Cath, Inc., 935 F.2d at 1563-64, 19 USPQ2d at 1117". In the instantly rejected claims, the new limitation of “wherein the tracrRNA consists of the hairpin region and the second stem in claim57 appears to represent new matter. “Consists” is interpreted as closed language that restricts the tracrRNA portion of the single guide RNA from comprising any additional nucleotides other than nucleotides that form a hairpin and stem. No specific basis for this limitation was identified in the specification, nor did a review of the specification by the examiner find any basis for the limitation. There is no recitation in the Specification of a tracrRNA “consisting” of only specific structures. Additionally, all of the depictions of sgRNA backbone secondary structures in FIGs 22, 24, 25 and 26 have at least one unpaired or non-hybridized nucleotides outside of the minimum crRNA/tracrRNA region. Applicant argues that support for claim 57 is in paragraph [00285] of the Specification (see Remarks, page 4). However, there is no disclosure specifically in [00285] or elsewhere in the Specification or Drawings of a tracrRNA sequence “consisting” of only specific RNA secondary structures or having no unpaired or unhybridized nucleotides. Since no basis has been identified, claim 57 is rejected as incorporating new matter. Claim Rejections - 35 USC § 103 – Zhou1 in view of Cong, Zhang1, Gasiunas and Illumina The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 52-54 and 56 are rejected under 35 U.S.C. 103 as being unpatentable over Zhou1 (US 20140038241, priority to August 5, 2012; of record), in view of Cong (Cong et al., Science (2013), 339:819-823, published online January 3, 2013; of record), Zhang1 (US 8697359 B1, effectively filed October 15, 2013), Gasiunas (Gasiunas et al., PNAS (2012), 109(39): E2579-E2586; of record), and Illumina (“Preparing Samples for Sequencing Genomic DNA", published March 2008; of record). Claim 56 is evidenced by IDT (https://www.idtdna.com/calc/analyzer, [utilized February 5, 2026]). This is a new rejection necessitated by amendment. As indicated above in paragraph 5, the effective filing date of claims 52-54 and 56 is November 12, 2013. Therefore, all the cited references above are prior art under either §102(a)(1) or §102(a)(2). Regarding claims 52 and 54, Zhou1 teaches a method for excising and sequencing a target nucleic acid from genomic DNA ([0002]). Zhou1 teaches contacting the genomic DNA (i.e., a parent nucleic acid) with a pair of target DNA-engineered sequence specific DNA nuclease complexes, which cut the DNA at a pair of cleavage points within or near the binding sites ([0007]). Accordingly, Zhou1 teaches contacting a first and second target site in a parent/genomic DNA with a first and second sequence specific DNA nuclease complexes, whereby the first sequence specific DNA nuclease cleaves the first target site and the second sequence specific DNA nuclease cleaves the second target site ([0007], Figs 1-2). Zhou1 teaches that the sequence-specific DNA nuclease can comprise RecA, Ref and targeting oligonucleotides ([0019], Fig 1), or alternatively can comprise a pair of Transcription Activator Like Effector Nucleases (TALENs) ([0033], Fig 2) or Zinc finger nucleases ([0036]). Zhou1 teaches that after the target DNA is cut, the DNA fragment (i.e., excised DNA fragment) between the two cutting sites is purified and isolated (i.e., purified from the parent nucleic acid) and sequenced ([0007], [0009]). Zhou1 teaches a working example in which a target sequence is cleaved from the bacteriophage M13mp18 genome using an oligonucleotide-targeted RecA/Ref nuclease, removed from the nucleases by incubation with proteinase K, and purified by electrophoresis ([0039]). Zhou also teaches that the excised DNA fragment can be separated (i.e., purified from the parent) by denaturing conditions, protease digestion, and/or separation size exclusion, filtration or electrophoresis ([0026], [0035]). Zhou1 does not teach wherein the first and second sequence specific DNA nuclease is comprised of a Cas9 and a guide RNA (gRNA). Zhou1 also does not teach ligating adaptors to the ends of the excised fragment before sequencing. Cong teaches that CRISPR Cas9 nucleases can be directed by short gRNAs to induce precise cleavage at endogenous genomic loci in human and mouse cells (abstract). Cong teaches that multiple guide sequences can be encoded into a single CRISPR array to enable simultaneous editing of several sites within the mammalian genome, demonstrating easy programmability and wide applicability of the RNA-guided nuclease technology (abstract). Cong further teaches specifically using a pair of Cas9-gRNA targeted to a first and second site within a target genomic double stranded DNA sequence to specifically excise a deletion fragment (Fig. 4G). Cong teaches that mature versions of crRNA and tracrRNA can be expressed in vivo and facilitate target DNA cleavage (Fig S8). Finally, Cong teaches that nuclease-mediated genome editing in vivo is more efficient using a single Cas9-guide RNA than using a single TALEN (Fig. 3D). Zhang1 teaches that CRISPR Cas9 nucleases can be directed by short chimeric gRNAs (i.e., single guide RNAs) to induce precise cleavage at endogenous genomic loci in human and mouse cells (Abstract, Fig 1, Fig 11B, Fig 16A). Zhang1 teaches that sgRNAs having longer portions of the tracrRNA sequence are more efficient than having fewer tracrRNA nucleotides (Fig 16B; column 52, lines 42-48). Zhang teaches that sgRNAs with the “+85” tracrRNA sequence results in the highest DNA cleavage rate (Fig 16B, column 52, lines 42-48). Zhang teaches the secondary structure of the +85 sgRNA, which comprises 1) a guide sequence (i.e., a spacer sequence), 2) a hybridized region between a crRNA and a tracrRNA sequence (i.e., the minimum crRNA and tracrRNA sequences), 3) a GAAA loop between the hybridized crRNA and tracrRNA sequence, and a tracrRNA sequence having two regions of hybridized nucleotides forming a hairpin/stem (i.e., a hairpin and a second stem) (FIG. 16A). Gasiunas teaches site-specific DNA cleavage reactions with S. thermophilus Cas9-crRNA (Abstract, Figs S5 and S11). Gasiunas teaches that cleavage products can be purified by denaturing and non-denaturing electrophoresis (page E28585, ¶6, 8) or by PCR purification kits (page E2585, ¶7). Gasiunas teaches upon cleavage of the target DNA, some of the Cas9-crRNA remains bound to the cleavage product without the PAM sequence, some of the Cas9-crRNA complex remains bound to the cleavage product with the PAM sequence, and some of the cleaved products are not bound to the Cas9-crRNA complex (Fig. S11). Gasiunas teaches sequencing Cas9 cleavage products after purification (Fig 2D; page E2585, ¶9). Illumina provides guidance for preparing samples for sequencing and analysis of genomic DNA on an Illumina Genome Analyzer (Figure 1). Illumina teaches ligating adapters at a 5' and 3' end prior to sequencing (Figures 1-2). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the method of Zhou1 by replacing the sequence-specific DNA nucleases with Cas9-guide RNA complexes comprising single guide RNAs having the +85 guide RNA structure taught in Zhang1 and ligating adaptors to the cleaved target. It would have merely amounted to a simple substitution of one known sequence-specific DNA nuclease for another followed by a simple combination of elements by known means to yield predictable results. Regarding the substitution of the sequence-specific nucleases, one would have been motivated to have done so because Cong teaches that the Cas9-guide RNA system has easy programmability and wide applicability and is more efficient at cleaving genomic targets than TALENs. It would have been entirely predictable to have done so because Cong already teaches simultaneously using two different Cas9-guide RNA complexes to target two different sites in genomic DNA to specifically excise a DNA fragment, which is the objective of Zhou1's method. The skilled artisan would have been particularly motivated to use the +85 sgRNA architecture presented in Zhang1 because of its superior cleavage activity compared to sgRNAs with shorter tracrRNA sequences. Additionally, based on Gasiunas’s in vitro data, at least some of the Cas9 cleavage product is not bound to the Cas9 complex, and what is bound can be removed under denaturing conditions. Regarding the ligation of adapters, Illumina describes known methods of manipulating DNA fragments for the common purpose of sequencing the DNA fragment. Accordingly, one of ordinary skill in the art could have further manipulated the excised DNA fragment according to the teachings of Illumina and it would have been entirely predictable that this would have been useful for obtaining the sequence information of the cleaved DNA fragment. Regarding claim 53, Cong teaches the Cas9 protein is Streptococcus pyogenes Cas9 protein (page 819, column 3). Zhang1 teaches the Cas9 protein is Streptococcus pyogenes Cas9 (FIG. 16A). The obviousness of using the S. pyogenes Cas9-guide RNA complex of Cong with the longer tracrRNA sequence in the sgRNA as the sequence specific nuclease in the method of Zhou1 is discussed above as applied to claim 52. Regarding claim 56, Zhang1 teaches the sequence and secondary structure of the +85 single guide RNA (FIG 16A). Zhang1 is silent whether the region between the hybridized minimum crRNA and tracrRNA sequences and the nucleotide labeled +54 of the +85 sgRNA can form a hairpin (i.e., a third stem) (FIG 16A). The sequence is 5’ – UAAGGCUAGUCCGUUAUCA. Using a publicly available structure prediction from Integrated DNA Technologies (IDT), it is evident that the sequence can form a hairpin/stem, which is encompassed by the claimed “third stem” (IDT reference, page 3). Claims 58-59 are rejected under 35 U.S.C. 103 as being unpatentable over Zhou1 (US 20140038241, priority to August 5, 2012; of record), Cong (Cong et al., Science (2013), 339:819-823, published online January 3, 2013; of record), Zhang1 (US 8697359 B1, effectively filed October 15, 2013), Gasiunas (Gasiunas et al., PNAS (2012), 109(39): E2579-E2586; of record), and Illumina (“Preparing Samples for Sequencing Genomic DNA", published March 2008; of record) as applied to claims 52-54 and 56 above, and further in view of Zhang2 (US 20160340660 A1, priority to December 12, 2013). Claim 58 is evidenced by IDT (https://www.idtdna.com/calc/analyzer, [utilized February 5, 2026]). This is a new rejection necessitated by amendment. As indicated above in paragraph 6, the effective filing date of claims 58-59 is March 12, 2014. Therefore, all the cited references above are prior art under either §102(a)(1) or §102(a)(2). The cited elements from Zhang2 are fully supported in the US provisional application 61/915251, filed December 12, 2013. The teachings of Zhou1, Cong, Zhang1, Gasiunas and Illumina are recited above and applied as for claims 52-54 and 56. Zhou1, Cong, Zhang1, Gasiunas and Illumina do not teach wherein the crRNA and tracrRNA duplex region does not comprise a second hybridized region in addition to a first hybridized region and a bulge region. Regarding claim 59, Zhang2 teaches the formation, crystal structure, and activity of Cas9/sgRNAs complexes (Abstract, FIG 1, FIG 4A-B). Zhang2 teaches sgRNAs with modified sequences compared to wild type (FIGs 4A-B). Zhang2 teaches an sgRNA with truncated distal CUA (FIG, 4A, fourth from top), which comprises a sequence that is 100% identical to SEQ ID NO 1469: seq 1469: gttttagaggaaacaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgct Zhang2: gttttagaggaaacaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttt Zhang2 also teaches an sgRNA with truncated distal CUA and Loop 1 (FIG, 4A, fifth from top), which comprises a sequence that is 100% identical to SEQ ID NO 1470: seq 1470: gttttagagacaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgct Zhang2: gttttagagacaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttt Zhang2 teaches that the sgRNAs above cleave the target DNA with the same or slightly higher frequency than a SpCas9 guide RNA with the wild type tracrRNA sequence (compare indel % of 4th and 5th sgRNA in FIG 4A to the “WT” sgRNA 4th from the bottom in FIG 4B). It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have substituted the wild type minimum crRNA/tracrRNA sequence and remaining tracrRNA sequence (herein called the “scaffold”) of Zhang1 with an sgRNA having a scaffold sequence with either SEQ ID NOs 1469 or 1470 in the method rendered obvious for claim 52. It would have amounted to the simple substitution of one sgRNA scaffold sequence for another by known means to yield predictable results. The skilled artisan would have predicted that Zhang2’s modified sgRNA scaffold sequences could be used in the obvious method because Zhang2 teaches sgRNA with SEQ ID NOs 1469 and 1470 form complexes with Cas9 and can mediate DNA cleavage. Because the prior art recognizes the equivalence of an sgRNA scaffold with the wild type SpCas9 tracrRNA sequence and the modified sgRNAs of Zhang2 for the purpose of mediated SpCas9 target DNA cleavage, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. MPEP 2144.06.II. Regarding claim 58, Zhang2 does not disclose the secondary structure of the modified sgRNAs. However, using IDT’s publicly available secondary structure prediction tool, it is evident that Zhang2’s two sgRNA scaffolds with the modified tracrRNA sequences recited above forms a secondary structure in which the minimum crRNA sequence and the minimum tracrRNA sequence does not form a second hybridized stem after the bulge area (IDT reference, pages 7 and 11). Claim Rejections - 35 USC § 103 – Zhou2 in view of Liu, Gasiunas and Zhang1 Claims 52-54 and 56 are rejected under 35 U.S.C. 103 as being unpatentable over Zhou2 (US 20140127752 A1, priority to November 7, 2012; of record), in view of Liu (US 20140234289 A1, priority to at least July 22, 2012; of record), Gasiunas (Gasiunas et al., PNAS (2012), 109(39): E2579-E2586; of record) and Zhang1 (US 8697359 B1, filed October 15, 2013). Claim 56 is evidenced by IDT (https://www.idtdna.com/calc/analyzer, [utilized February 5, 2026]). This is a new rejection necessitated by amendment. As indicated above in paragraph 5 the effective filing date of claims 52-54 and 56 is November 12, 2013. Therefore, all the cited references above are prior art under either §102(a)(1) or §102(a)(2). Regarding claims 52 and 54, Zhou2 teaches cleaving and isolating a target dsDNA sequence from a larger DNA piece of genomic DNA (i.e., a parent nucleic acid) for the purpose of sequencing ([0002]). Zhou2 teaches one embodiment of the method uses a S. pyogenes Cas9 directed by a “targeting ON” RNA (i.e., a guide RNA) as the DNA nuclease to cleave the target DNA as described in Jinek et al., ([0028]-[0030]). Zhou2 teaches that multiple pairs of the DNA nucleases (i.e., a first and second Cas9/gRNA complex) are employed in one reaction to cut out the DNA sequence of interest ([0038]). Zhou2 teaches an embodiment using “non-stable” binding of the Cas9/gRNA to the target DNA (i.e., Cas9/gRNA complex does not remain bound to the cleaved target nucleic acid) ([0035]). Zhou2 teaches when a non-stable-binding sequence specific DNA nuclease is used, the DNA fragment of interest may be attached to one or more affinity tags using DNA ligase, polymerase ([0035]). Zhou2 teaches sequencing methods known in the art involve sequence specific ligation followed by universal PCR. Zhou2 teaches that another type of sequence-specific DNA binding protein are zinc finger proteins ([0034]). Zhou2 does not teach that the “sequence specific ligation” is ligating adapters to a 5’ end and a 3’ end of the cleaved target nucleic acid or demonstrate Cas9/sgRNA cleavage of a target DNA. Zhou2 does not disclose the structure of the “targeting ON” guide RNA. Liu teaches methods for cleaving and sequencing DNA cleavage products after site-specific nuclease DNA cleavage by Zinc Finger Nucleases (ZFN) (Fig 1, [[0121]-[0122]). Liu teaches prior to sequencing, adapters are ligated onto the 5’ and 3’ ends of the cleaved DNA (Fig 1, [0122]). Liu teaches the adapters allow PCR amplification followed by high throughput DNA sequencing ([0123]). Liu also teaches gel electrophoresis can be used to purify PCR-amplified cleaved target DNA prior to sequencing ([0122]). Gasiunas teaches site-specific DNA cleavage reactions with S. thermophilus Cas9-crRNA (Abstract, Figs S5 and S11). Gasiunas teaches that cleavage products can be purified by denaturing and non-denaturing electrophoresis (page E28585, ¶6, 8) or by PCR purification kits (page E2585, ¶7). Gasiunas teaches upon cleavage of the target DNA, some of the Cas9-crRNA remains bound to the cleavage product without the PAM sequence, some of the Cas9-crRNA complex remains bound to the cleavage product with the PAM sequence, and some of the cleaved products are not bound to the Cas9-crRNA complex (Fig. S11). Gasiunas teaches sequencing Cas9 cleavage products after purification (Fig 2D; page E2585, ¶9). Zhang1 teaches that S. pyogenes CRISPR Cas9 nucleases can be directed by short chimeric gRNAs (i.e., single guide RNAs) to induce precise cleavage at endogenous genomic loci in human and mouse cells (Abstract, Fig 1, Fig 11B, Fig 16A). Zhang1 teaches that sgRNAs having longer portions of the tracrRNA sequence are more efficient than having fewer tracrRNA nucleotides (Fig 16B; column 52, lines 42-48). Zhang1 teaches that sgRNAs with the “+85” tracrRNA sequence results in the highest DNA cleavage rate (Fig 16B, column 52, lines 42-48). Zhang1 teaches the secondary structure of the +85 sgRNA, which comprises 1) a guide sequence (i.e., a spacer sequence), 2) a hybridized region between a crRNA and a tracrRNA sequence (i.e., the minimum crRNA and tracrRNA sequences), 3) a GAAA loop between the hybridized crRNA and tracrRNA sequence (i.e., single guide connector), and a tracrRNA sequence having two regions of hybridized nucleotides forming a hairpin/stem (i.e., a hairpin and a second stem) (FIG. 16A). It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have 1) ligated sequencing adapters onto the 5’ and 3’ ends of the Cas9/gRNA-cleaved target DNA in Zhou2’s method of “non-stable-binding” Cas9 cleavage, and 2) used the single guide RNA structure of Zhang1. It would have amounted to the simple combination of elements by known means to yield predictable results. Zhou2, Gasiunas and Liu are directed to sequencing the products resulting from sequence-specific nuclease cleavage. As such, one of ordinary skill in the art could have manipulated Zhou’s Cas9/gRNA-excised DNA fragment by ligating adapters according to the teachings of Liu and it would have been entirely predictable that this would have been useful for obtaining the sequence information of the cleaved DNA fragment. The skilled artisan would have predicted that Zhou2’s target DNA fragments could be purified from the parent nucleic acid because Gasiunas provides two methods for doing so – electrophoresis and PCR purification kits. Furthermore, Gasiunas demonstrates that “at least a fraction” of each cleavage product is not bound to the Cas9 protein. The skilled artisan would have been motivated to ligate the adapters to the 5’ and 3’ ends for the purpose of using high-throughput sequencing methods. Regarding the single guide RNA structure, the skilled artisan would have been particularly motivated to use the +85 sgRNA architecture presented in Zhang1 because of its superior cleavage activity compared to sgRNAs with shorter tracrRNA sequences. Regarding claim 53, Zhou2 teaches the Cas9 is Streptococcus pyogenes Cas9 ([0029]). Zhang1 teaches that S. pyogenes CRISPR Cas9 nucleases can be directed by short chimeric gRNAs (i.e., single guide RNAs) to induce precise cleavage at endogenous genomic loci in human and mouse cells (Abstract, Fig 1, Fig 11B, Fig 16A). Regarding claim 56, Zhang1 teaches the sequence and secondary structure of the +85 single guide RNA (FIG 16A). It is evident from the sequence of the +85 sgRNA that the region between the hybridized minimum crRNA and tracrRNA sequences and the nucleotide labeled +54, that the region can form a hairpin (i.e., a third stem) (FIG 16A). The sequence is 5’ – UAAGGCUAGUCCGUUAUCA. Using a publicly available secondary structure prediction from Integrated DNA Technologies, it is evident that the sequence can form the secondary structure below, which is encompassed by the claimed “third stem” (IDT reference, page 3). Claims 58-59 are rejected under 35 U.S.C. 103 as being unpatentable over Zhou2 (US 20140127752 A1, priority to November 7, 2012; of record), Liu (US 20140234289 A1, priority to at least July 22, 2012; of record), Gasiunas (Gasiunas et al., PNAS (2012), 109(39): E2579-E2586; of record) and Zhang1 (US 8697359 B1, filed October 15, 2013), as applied to claims 52-54 and 56 above, and further in view of Zhang2 (US 20160340660 A1, priority to December 12, 2013). Claim 58 is evidenced by IDT (https://www.idtdna.com/calc/analyzer, [utilized February 5, 2026]). This is a new rejection necessitated by amendment. As indicated above in paragraph 6, the effective filing date of claims 58-59 is March 12, 2014. Therefore, all the cited references above are prior art under either §102(a)(1) or §102(a)(2). The cited elements from Zhang2 are fully supported in the US provisional application 61/915251, filed December 12, 2013. The teachings of Zhou2, Liu, Gasiunas, and Zhang1 are recited above and applied as for claims 52-54 and 56. Zhou2, Liu, Gasiunas, and Zhang1 do not teach wherein the crRNA and tracrRNA duplex region does not comprise a second hybridized region in addition to a first hybridized region and a bulge region. Regarding claim 59, Zhang2 teaches the formation, crystal structure, and activity of Cas9/sgRNAs complexes (Abstract, FIG 1, FIG 4A-B). Zhang2 teaches sgRNAs with modified sequences compared to wild type (FIGs 4A-B). Zhang2 teaches an sgRNA with truncated distal CUA (FIG, 4A, fourth from top), which comprises a sequence that is 100% identical to SEQ ID NO 1469: seq 1469: gttttagaggaaacaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgct Zhang2: gttttagaggaaacaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttt Zhang2 also teaches an sgRNA with truncated distal CUA and Loop 1 (FIG, 4A, fifth from top), which comprises a sequence that is 100% identical to SEQ ID NO 1470: seq 1470: gttttagagacaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgct Zhang2: gttttagagacaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttt Zhang2 teaches that the sgRNAs above cleave the target DNA with the same or slightly higher frequency than a SpCas9 guide RNA with the wild type tracrRNA sequence (compare indel % of 4th and 5th sgRNA in FIG 4A to the “WT” sgRNA 4th from the bottom in FIG 4B). It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have substituted the wild type minimum crRNA/tracrRNA sequence and remaining tracrRNA sequence (herein called the “scaffold”) of Zhang1 with an sgRNA having a scaffold sequence with either SEQ ID NOs 1469 or 1470 in the method rendered obvious for claim 52. It would have amounted to the simple substitution of one sgRNA scaffold sequence for another by known means to yield predictable results. The skilled artisan would have predicted that Zhang2’s modified sgRNA scaffold sequences could be used in the obvious method because Zhang2 teaches sgRNA with SEQ ID NOs 1469 and 1470 form complexes with Cas9 and can mediate DNA cleavage. Because the prior art recognizes the equivalence of an sgRNA scaffold with the wild type SpCas9 tracrRNA sequence and the modified sgRNAs of Zhang2 for the purpose of mediated SpCas9 target DNA cleavage, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. MPEP 2144.06.II. Regarding claim 58, Zhang2 does not disclose the secondary structure of the modified sgRNAs. However, using IDT’s publicly available secondary structure prediction tool, it is evident that Zhang2’s two sgRNA scaffolds with the modified tracrRNA sequences recited above forms a secondary structure in which the minimum crRNA sequence and the minimum tracrRNA sequence does not form a second hybridized stem after the bulge area (IDT reference, pages 7 and 11). Response to Arguments - §103 Applicant argues that none of the references cited in the previous office action teach the claimed structures of the guide RNAs (Remarks, pages 4-5). This argument has been fully considered and is persuasive. The previous rejections have been withdrawn. However, new rejections that include the Zhang1 and Zhang2 references that teach the claimed single guide RNA structures are provided above. Conclusion No claims are allowable. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /CATHERINE KONOPKA/Primary Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

May 19, 2023
Application Filed
Dec 09, 2024
Non-Final Rejection — §103, §112, §DP
Mar 12, 2025
Response after Non-Final Action
Mar 12, 2025
Response Filed
Apr 14, 2025
Final Rejection — §103, §112, §DP
Jul 09, 2025
Request for Continued Examination
Jul 15, 2025
Response after Non-Final Action
Sep 12, 2025
Non-Final Rejection — §103, §112, §DP
Dec 16, 2025
Response Filed
Feb 06, 2026
Final Rejection — §103, §112, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12454686
In Vitro Cleavage of DNA Using Argonaute
2y 5m to grant Granted Oct 28, 2025
Patent 12448630
CRISPR-CAS SYSTEMS AND USES THEREOF
2y 5m to grant Granted Oct 21, 2025
Patent 12442052
ANALYSIS OF POLYNUCLEOTIDES
2y 5m to grant Granted Oct 14, 2025
Patent 12435321
CRISPR/CAS12J ENZYME AND SYSTEM
2y 5m to grant Granted Oct 07, 2025
Patent 12416011
BIOCONTAINMENT/BIOCONTROL SYSTEM AND METHODS
2y 5m to grant Granted Sep 16, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

5-6
Expected OA Rounds
59%
Grant Probability
99%
With Interview (+62.6%)
3y 10m
Median Time to Grant
High
PTA Risk
Based on 177 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month