Prosecution Insights
Last updated: April 19, 2026
Application No. 18/320,895

METHOD FOR REPAIRING SERTOLI CELL INJURY IN TESTES

Non-Final OA §101§103§112
Filed
May 19, 2023
Examiner
BROWN, DALIYAH MONYHE
Art Unit
1654
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Second Affiliated Hospital and Yuying Children's Hospital of Wenzhou Medical University
OA Round
1 (Non-Final)
100%
Grant Probability
Favorable
1-2
OA Rounds
3y 2m
To Grant
99%
With Interview

Examiner Intelligence

Grants 100% — above average
100%
Career Allow Rate
1 granted / 1 resolved
+40.0% vs TC avg
Strong +100% interview lift
Without
With
+100.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 2m
Avg Prosecution
9 currently pending
Career history
10
Total Applications
across all art units

Statute-Specific Performance

§101
6.1%
-33.9% vs TC avg
§103
33.3%
-6.7% vs TC avg
§102
15.2%
-24.8% vs TC avg
§112
33.3%
-6.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1 resolved cases

Office Action

§101 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Status of Claims The claim listing filed 19 May 2023 is pending. Claims 6-9 have been cancelled. Claims 1-5 are being examined on the merits in this office action. Priority Acknowledgment is made of applicant’s claim for foreign priority under 35 U.S.C. 119 (a)-(d). The certified copy has been filed in parent Application No. 17/541,211, filed on 02 December 2021. Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: Specific deficiency - Sequences appearing in the specification are not identified by sequence identifiers (i.e., “SEQ ID NO:X” or the like) in accordance with 37 CFR 1.831(c). Throughout the specification, the sequence identifier is preceded by “SEQ ID NO.” rather than “SEQ ID NO:” as set forth in 37 CFR 1.821(d). The colon must be used in place of the period in all occurrences. Required response – Applicant must provide: A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required sequence identifiers, consisting of: • A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); • A copy of the amended specification without markings (clean version); and • A statement that the substitute specification contains no new matter. Specification The substitute specification filed 19 July 2023 has been entered. The disclosure is objected to due to the following informalities: On page 5 in the second paragraph after section 2, the specification states, “The sequencing result shows a homology of 100% with a DEP domain-coding gene in the reference rat laminin α2-coding gene sequence NM_001107081.2.” In the second paragraph of Example 1 on the same page, the specification states, “Cloning primers of the DEP functional region were designed using SD rat testis cDNA with reference to a rat Dvl3-coding gene sequence NM_001107081.2.” GenBank Accession No. NM_001107081.2, publicly available April 2019, printed as pages 1/3-3/3 is directed to Rattus norvegicus disheveled segment polarity protein 3 (Dvl3), mRNA. Thus, one would have recognized that the recitation of “rat laminin α2-coding gene sequence” is a clear typographical error and should be “rat Dvl3-coding gene sequence.” Appropriate correction is required. The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code (on page 4). Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. The use of the terms “Matrigel” (on pages 6 and 7), “Millicell-ERS” (on page 6), and “Lipoject (on page 6 and 9), which is a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore, the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Claim Objections Claim 1 is objected to because of the following informalities: The comma after the word “wherein” should be deleted to improve the grammar of the claim. The claim recites the abbreviation “Dvl3-DEP”. The abbreviation should be spelled out in the first appearance of the claims and should be followed by the abbreviation in parentheses. The claim recites “SEQ ID NO.” instead of “SEQ ID NO:” as set forth in 37 CFR 1.821(d). The colon must be used in place of the period in the instant claim. Appropriate correction is required. Claim 2 is objected to because of the following informalities: The comma after the word “wherein” should be deleted to improve the grammar of the claim. The claim recites “SEQ ID NO.” instead of “SEQ ID NO:” as set forth in 37 CFR 1.821(d). The colon must be used in place of the period in the instant claim. Appropriate correction is required. Claim 3 is objected to because of the following informalities: The comma after the word “wherein” should be deleted to improve the grammar of the claim. Appropriate correction is required. Claim 4 is objected to because of the following informalities: The comma after the word “wherein” should be deleted to improve the grammar of the claim. Appropriate correction is required. Claim 5 is objected to because of the following informalities: The comma after the word “wherein” should be deleted to improve the grammar of the claim. The claim recites “SEQ ID NO.” instead of “SEQ ID NO:” as set forth in 37 CFR 1.821(d). The colon must be used in place of the period in the instant claim. Appropriate correction is required. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-5 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 1 recites the limitation “Use of a Dvl3-DEP peptide in the preparation of a medicament for repairing Sertoli cell injury in testes, wherein, the Dvl3-DEP peptide has an amino acid sequence shown in SEQ ID NO. 1.” The claim is indefinite because it is unclear how the Dvl3-DEP peptide is to be used without any active, positive steps delaminating how this use is actually practiced. See Ex parte Erlich, 3 USPQ2d 1011 (Bd. Pat. App. & Inter. 1986). See MPEP § 2173.05(q). Claims 2-5, which depend from claim 1, are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as these claims incorporate, by dependency, the indefiniteness of claim 1. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 1-5 are rejected under 35 U.S.C. 101 because the claimed invention is directed to non-statutory subject matter. The claim(s) does/do not fall within at least one of the four categories of patent eligible subject matter because the claims are drawn to the use of a Dvl3-DEP peptide in the preparation of a medicament for repairing Sertoli cell injury in testes, while failing to recite steps. See MPEP §2173.05 (q). Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claim(s) 1-3 is/are rejected under 35 U.S.C. 103 as being unpatentable over Li et al., hereafter “Li (2019)”, (“Planar cell polarity protein Disheveled 3 (Dvl3) regulates ectoplasmic specialization (ES) dynamics in the testis through changes in cytoskeletal organization.” Cell Death Dis 10, 194 (2019). doi: 10.1038/s41419-019-1394-7), in view of Paclíková et al., hereafter “Paclíková”, (“The N-Terminal Part of the Disheveled DEP Domain Is Required for Wnt/β-Catenin Signaling in Mammalian Cells.” Mol Cell Biol. (2017) doi: 10.1128/MCB.00145-17). Claim 1 is drawn to the use of a Dvl3-DEP peptide in the preparation of a medicament for repairing Sertoli cell injury in testes, wherein, the Dvl3-DEP peptide has an amino acid sequence shown in SEQ ID NO. 1. Li (2019) teaches Disheveled 3 (Dvl3) as having a key role in supporting the permeability of Sertoli cell tight junctions ([Abstract] “… Dvl3 played a crucial role of support Sertoli cell tight junction (TJ)-permeability barrier function through changes in the organization of actin- and microtubule (MT)-based cytoskeletons.”). Li (2019) shows that impact of Dvl3 in regard to supporting Sertoli cells in the testes, the role of sperm cell planar cell polarity (PCP), as well as the fact that Dvl3 is a Sertoli cell blood-testis barrier ([Abstract] “More important, Dvl1/2/3 triple knockdown in the testis also impeded the organization of actin- and MT-based cytoskeletons owing to disruptive spatial expression of actin- and MT-regulatory proteins. In summary, PCP Dishevelled proteins, in particular, Dvl3 is a regulator of Sertoli cell blood–testis barrier (BTB) and also spermatid PCP function through its effects on the actin- and MT-based cytoskeletons in Sertoli cells.”). Li (2019) also teaches Dvl3 knockdown disrupting the distribution of β-Catenin adhesion (Pages 14-15; “As shown in Fig. 5, distribution of the TJ (CAR/ZO-1) and basal ES (N-cadherin/β-catenin) adhesion protein complexes at the Sertoli cell–cell interface following Dvl3 knockdown was considerably disrupted, in which these proteins no longer tightly distributed at the cell cortical zone, but internalized (Fig. 5, right panel)”). Li (2019) does not teach the DEP domain of Dvl3-DEP, let alone Dvl3-DEP having the amnio acid sequence shown in SEQ ID NO: 1. Paclíková teaches disheveled proteins being key mediators of the Wnt/β-catenin signaling pathway, that all Dvl proteins contain three conserved domains, one being DEP and that the Dvl-DEP domain is essential for Wnt/β-catenin signaling ([Abstract] “Disheveled (DVL) proteins are key mediators of the Wnt/β-catenin signaling pathway. All DVL proteins contain three conserved domains: DIX, PDZ, and DEP. … This study provides conclusive evidence that the DVL DEP domain is essential for Wnt/β-catenin signaling in mammalian cells and establishes an experimental system suitable for further functional testing of DVL.”). Paclíková also teaches the hDVL3 protein with a DEP domain sequence that is identical to the sequence of instant SEQ ID NO: 1 (Fig. 5A). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to take the teachings of Li (2019) and combine them with the teachings of Paclíková due to both references teaching the use of Dvl3 in β-Catenin mediation. One would have recognized from Li (2019) that Dvl3 supporting the Sertoli cells in the testes and disrupting β-Catenin adhesion. Paclíková teaches that the DEP domain of Dvl is essential in β-catenin signaling the Dvl3-DEP protein described in SEQ ID NO: 1 of the instant specification as being a key mediator of Wnt/β-catenin signaling pathways. One would have been motivated to add the DEP domain from Paclíková as it is taught that the domain is essential in Wnt/β-catenin signaling in mammalian cells, as described by Paclíková. Li (2019) teaches that Dvl3 supporting the Sertoli cells in the testes and disrupting β-Catenin adhesion. Hence the combination of references would have been readily apparent and deemed to be supported by KSR Rationale (D) Applying a known technique to a known device (method, or product) ready for improvement to yield predictable results (see MPEP 2143(I)). Claim 2 is drawn to the use of claim 1, wherein a coding sequence of the Dvl3- DEP peptide has a nucleotide sequence shown in SEQ ID NO: 2. The teachings of Li (2019) and Paclíková are described above and applied as before. Li (2019) discloses “Rattus norvegicus dishevelled segment polarity protein 3 (Dvl3)”, a sequence NM_001107081.2 (e.g., page 5/9; GenBank Accession No. NM_001107081.2, publicly available April 2019, printed as pages 1/3-3/3), which comprises the nucleotide sequence described in SEQ ID NO: 2 of the instant invention. With regard to the limitation of “repairing Sertoli cell injury in testes”, the peptide disclosed in Li (2019) comprises the amino acid sequence that is claimed to repair Sertoli cell injury and because a chemical composition and its properties are inseparable, a person of ordinary skill in the art would reasonably expect the protein of Li (2019) to also repair Sertoli cell injury in testes. MPEP §2112.01 (II) Claim 3 is drawn to the use according to claim 1, wherein, the Sertoli cell injury in testes comprises destruction to a tight junction function among Sertoli cells, injury to a tight junction structure among Sertoli cells, and reduction in a level of cytoskeleton protein polymerization in Sertoli cells. A recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the claimed invention from the prior art. If the prior art structure is capable of performing the intended use, then it meets the claim. The peptide as described in Paclíková contains the same structure as the peptide as described in SEQ ID NO: 2 of the instant claim, thus it is interpreted as being sufficient in the treatment of the Sertoli cell injury symptoms as described in the instant claim. Claim(s) 4 is/are rejected under 35 U.S.C. 103 as being unpatentable over Li et al., hereafter “Li (2019)”, (“Planar cell polarity protein Disheveled 3 (Dvl3) regulates ectoplasmic specialization (ES) dynamics in the testis through changes in cytoskeletal organization.” Cell Death Dis 10, 194 (2019). doi.org/10.1038/s41419-019-1394-7), in view of Paclíková et al. (“The N-Terminal Part of the Disheveled DEP Domain Is Required for Wnt/β-Catenin Signaling in Mammalian Cells.” Mol Cell Biol. (2017) doi: 10.1128/MCB.00145-17), as applied to claim 1 above, and further in view of Li et al, hereafter “Li (2016)”, (Rescue of perfluorooctanesulfonate (PFOS)-mediated Sertoli cell injury by overexpression of gap junction protein connexin 43. Sci Rep. 2016 Jul 20;6:29667. doi: 10.1038/srep29667. PMID: 27436542; PMCID: PMC4951654). Claim 4 is drawn to the use of claim 1, wherein the Sertoli cell injury in testes is caused by perfluorooctane sulphonate (PFOS). The teachings of Li (2019) and Paclíková are described above and applied as before. Li (2019) and Paclíková do not teach the use of Dvl3-DEP in the treatment of Sertoli cell injuries caused by PFOS. Li (2016) teaches Perfluorooctane sulfonate (PFOS) being an environmental toxin used in developing countries as a stain repellent for fabrics ([Abstract] “Perfluorooctanesulfonate (PFOS) is an environmental toxicant used in developing countries, including China, as a stain repellent for clothing, carpets and draperies”) and that PFOS disturbs the Sertoli cell tight junction-permeability barrier, causing changes to the Sertoli cell blood-testis barrier (BTB) stability, and perturbing the localization of cell junction proteins, like N-cadherin-β-catenin ([Abstract] “ PFOS perturbed the Sertoli cell tight junction (TJ)-permeability barrier, causing disruption of actin microfilaments in cell cytosol, perturbing the localization of cell junction proteins (e.g., occluden-ZO-1, N-cadherin-ß-catenin). These changes destabilized Sertoli cell blood-testis barrier (BTB) integrity.”). Li (2016) also teaches PFOS also disrupt F-actin organization in Sertoli cells (page 2, para. 3, “It was shown that PFOS exerted its effects in Sertoli cells by perturbing F-actin organization in Sertoli cells…”). The teachings of Li (2016) show that it was known in the art prior to 02 December 2021, the effective filing date of the parent application (18/541,211), that PFOS causes Sertoli cell injury in testes. It would have been obvious to one of ordinary skill in the art to apply the teachings of Li (2019) and Paclíková, the use of Dvl3-DEP in the treatment of Sertoli cell injury, to a patient population where the Sertoli cell injury is caused by PFOS. The teachings of Li (2019) and Li (2016) show that the generic Sertoli cell injury and Sertoli cell injury cause by PFOS have the same symptoms (disrupted tight junction permeability, irregular BTB and perturbed actin organization), and therefor would have yielded a predictable, and successful, result if treated with the same peptide. Claim(s) 5 is/are rejected under 35 U.S.C. 103 as being unpatentable over Li et al., hereafter “Li (2019)”, (“Planar cell polarity protein Disheveled 3 (Dvl3) regulates ectoplasmic specialization (ES) dynamics in the testis through changes in cytoskeletal organization.” Cell Death Dis 10, 194 (2019). doi.org/10.1038/s41419-019-1394-7), in view of Paclíková et al. (“The N-Terminal Part of the Disheveled DEP Domain Is Required for Wnt/β-Catenin Signaling in Mammalian Cells.” Mol Cell Biol. (2017) doi: 10.1128/MCB.00145-17), as applied to claim 1 above and further in view of Elkins, (“Primer Design for PCR Reactions in Forensic Biology” PCR Primer Design: Chhandak Basu (ed.), Methods in Molecular Biology, vol. 1275, Springer Protocols, 2015, Pages 17-30). Claim 5 is drawn to the invention of claim 1, with the added limitation of a pair of amplification primers for the coding sequence of the DVL3-DEP peptide are shown in SEQ ID NOs: 3 and 4. The teachings of Li (2019) and Paclíková are described above and applied as before. Paclíková teaches the use of PCR and using DreamTaq polymerase (ThermoFisher Scientific) to amplify an isolated portion of the genomic DNA, creating a primer out of the fragments (pg. 13; “Genomic DNA was isolated by use of the DirectPCR lysis reagent (catalog number 301-C; Viagen Biotech), and then the fragment of genomic DNA was amplified by PCR using DreamTaq DNA polymerase (Thermo Fisher Scientific), forward primer CCTCCTTCAGCAGCATAACC, and reverse primer CGGCATCGTCATTGCTC.”). Li (2019) and Paclíková do not teach the amplification primers being shown in SEQ ID NOs: 3 and 4. SEQ ID NOs: 3 and 4 are seen in the nucleic acid sequence of the DEP peptide (SEQ ID NO: 2). Designing an amplification primer using the nucleic acid sequence you want to amplify is a routine technique in the art. SEQ ID NO: 3 is identical to nucleotides 1-22 of the instant SEQ ID NO: 2, while SEQ ID NO: 4 is identical to nucleotides 138-168 of the instant SEQ ID NO: 2. Elkins states that in PCR, DNA primers are much more stable than RNA primers and that a primer is required to bracket the DNA region of interest in the form of an upstream and a downstream primer (Page 18, “The DNA primers are much more stable and less susceptible to chemical degradation than RNA primers. PCR can be used to amplify any locus in any genome, including those composed of DNA or RNA. A process called reverse transcriptase-PCR (RT-PCR) which substitutes the reverse transcriptase enzyme for DNA polymerase reverse-transcribes the RNA into cDNA. PCR primers are required to copy DNA and bracket the DNA region of interest. In designing PCR primers, it is important to define the desired region and design primers upstream and downstream of the locus of interest. For the shortest amplicon, primers are designed from the 5′ DNA region directly upstream from the locus (e.g., a STR, SNP, or other locus) and the 3′ region directly downstream for the 5′ and 3′ primers, respectively.”) It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to take the nucleotides flanking the region in need of amplification and create a primer. One would have recognized that Paclíková teaches creating a primer from DNA fragments found in the DVL1, DVL2 and DVL3 genes and the primer made being able to amplify said DNA fragments and would have combined it with the teachings of Elkins (DNA primers being more stable and that primers bracketing the area of interest will amplify the area) to arrive at the instant invention with a reasonable expectation of success. Hence the combination of references would have been readily apparent and deemed to be supported by KSR Rationale (E) “Obvious to try”. See MPEP 2143 (I)(E) Status of Claims Claims 1-5 are objected to. Claims 1-5 are rejected under 35 U.S.C. 112(b). Claims 1-5 are rejected under 35 U.S.C. 101. Claims 1-5 are rejected under 35 U.S.C. 103. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to Daliyah M. Brown whose telephone number is (571)272-0136. The examiner can normally be reached Monday-Thursday 9:00 am - 4:30 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Lianko Garyu can be reached at (571) 270-7367. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /Daliyah M. Brown/Examiner, Art Unit 1654 /LIANKO G GARYU/Supervisory Patent Examiner, Art Unit 1654
Read full office action

Prosecution Timeline

May 19, 2023
Application Filed
Dec 19, 2025
Non-Final Rejection — §101, §103, §112 (current)

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
100%
Grant Probability
99%
With Interview (+100.0%)
3y 2m
Median Time to Grant
Low
PTA Risk
Based on 1 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month