Prosecution Insights
Last updated: July 17, 2026
Application No. 18/321,971

OPTIMIZED ANTI-FLT1 OLIGONUCLEOTIDE COMPOUNDS FOR TREATMENT OF PREECLAMPSIA AND OTHER ANGIOGENIC DISORDERS

Non-Final OA §112
Filed
May 23, 2023
Priority
Jun 23, 2021 — provisional 63/214,224 +1 more
Examiner
CHONG, KIMBERLY
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Beth Israel Deaconess Medical Center Inc.
OA Round
3 (Non-Final)
72%
Grant Probability
Favorable
3-4
OA Rounds
0m
Est. Remaining
85%
With Interview

Examiner Intelligence

Grants 72% — above average
72%
Career Allowance Rate
1078 granted / 1488 resolved
+12.4% vs TC avg
Moderate +13% lift
Without
With
+12.6%
Interview Lift
resolved cases with interview
Typical timeline
2y 6m
Avg Prosecution
65 currently pending
Career history
1551
Total Applications
across all art units

Statute-Specific Performance

§101
1.4%
-38.6% vs TC avg
§103
41.8%
+1.8% vs TC avg
§102
9.1%
-30.9% vs TC avg
§112
26.4%
-13.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1488 resolved cases

Office Action

§112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Request for Continued Examination A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 04/09/2026 has been entered. Status of Application/Amendment/Claims Applicant's response filed 04/09/2026 has been considered. Rejections and/or objections not reiterated from the previous office action mailed 10/09/2025 are hereby withdrawn. The following rejections and/or objections are either newly applied or are reiterated and are the only rejections and/or objections presently applied to the instant application. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. With entry of the amendment filed on 04/09/2026 claims 82-112 are pending and are currently under examination. The 112(a) enablement rejection has been withdrawn in response to claim amendments. Claims 86-100 and 106-112 are free of the prior art. New Claim Rejections Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 82-84 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention. Claims 82 and 84 are indefinite for the following reasons: the claim recites the nucleotides at any one or more of positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 20 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides in (4) and the nucleotides at any one of more of positions 4, 6, 8, 10, and 14 from the 5' end of the sense strand are not 2'-methoxy-ribonucleotides in (9) and is indefinite because they recite some of the same positions. The claim is written such that the antisense has all of the conditions of 1-10 so in (4), position 4 is not a 2’-O-methyl modification and then it (9) this position is repeated. Condition (9) appears to limit (4) but this is improper within a claim and thus is indefinite. The claims also recites in (5) the nucleotides at positions 1-2 to 1-7 from the 3' end of the antisense strand are connected to each other via phosphorothioate internucleotide linkages. It is unclear what is meant by 1-2 to 1-7. Is 1-2 or 1-7 intended to be in the alternative such that nucleotides at positions 1-2 or 1-7 from the 3’ end are connected to each other? Or does not mean any of positions 1-7 (which includes 1-2) are connected to each other? The claims also recites in (6) a portion of the antisense strand is complementary to a portion of the sense strand and is indefinite because the metes and bounds of “portion” are not defined in the claims or specification. It is unclear how many nucleotides of the antisense strand is complementary to the sense strand. A portion could be considered as 2 complementary nucleotides or up to 14 of the 15 nucleotides of the sense strand. Claim 83 is indefinite because it depends from claim 82. Closet prior art and Allowable Subject Matter The closest prior art for dsRNA targeted to SEQ ID No. 1 and SEQ ID No. 2 are taught by US20160319278 (see alignments below). The prior art teach dsRNA (siRNA) targeted to SEQ ID Nos. 1 and 2 but do not teach the claimed sequences or modifications a positions of modified nucleotides as in claims 82, 83, 85, 86, 97, 98 or Formulas I-IV, for example. A review of the sequence results do not reveal any sequence that comprises any of the claimed sequences with the specific modification patterns. The instant specification describes SEQ ID Nos. 1 and 2 as target sites of Flt-1 The prior art does not teach using any of the claimed sequences in methods of treating or managing pre-eclampsia or Hemolysis, Elevated Liver enzymes and Low Platelets (HELLP). Regarding modified claims 82 and 84, the prior art does not teach a dsRNA comprising the lengths and modifications in in methods of treating or managing pre-eclampsia or Hemolysis, Elevated Liver enzymes and Low Platelets (HELLP). The gene sequence of Flt-1 is known as NC_000013.11 and methods of making siRNA sequences to a known target are known however, Sciabola et al. ("PFRED: A computational platform for siRNA and antisense oligonucleotides design." PLoS One 16.1 (2021)) teach designing antisense oligonucleotides can be logistically challenging given there are many design criteria that can be incorporated into the selection tool or therapeutic sequences and describes numerous different computational tools to address different aspects of the design process (page 2). Thus nothing in Sciabola et al. would lead one of skill in the art to a predictable computational tool to make it obvious to design sequences targeted to Flt-1 comprising the claimed structure and modifications. SEQ ID No. 1 Sequence 324, US/15089423 Publication No. US20160319278A1 GENERAL INFORMATION APPLICANT: UNIVERSITY OF MASSACHUSETTS TITLE OF INVENTION: FULLY STABILIZED ASYMMETRIC SIRNA FILE REFERENCE: 580035: UM9-209 CURRENT APPLICATION NUMBER: US/15/089,423 CURRENT FILING DATE: 2016-04-01 PRIOR APPLICATION NUMBER: 62/287,255 PRIOR FILING DATE: 2016-01-26 PRIOR APPLICATION NUMBER: 62/205,218 PRIOR FILING DATE: 2015-08-14 PRIOR APPLICATION NUMBER: 62/142,786 PRIOR FILING DATE: 2015-04-03 NUMBER OF SEQ ID NOS: 893 SEQ ID NO 324 LENGTH: 19 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide Query Match 95.0%; Score 19; Length 19; Score over Length 100.0%; Best Local Similarity 100.0%; Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 2 TCTCGGATCTCCAAATTTA 20 Db 19 TCTCGGATCTCCAAATTTA 1 SEQ ID No. 2 Sequence 232, US/15089423 Publication No. US20160319278A1 GENERAL INFORMATION APPLICANT: UNIVERSITY OF MASSACHUSETTS TITLE OF INVENTION: FULLY STABILIZED ASYMMETRIC SIRNA FILE REFERENCE: 580035: UM9-209 CURRENT APPLICATION NUMBER: US/15/089,423 CURRENT FILING DATE: 2016-04-01 PRIOR APPLICATION NUMBER: 62/287,255 PRIOR FILING DATE: 2016-01-26 PRIOR APPLICATION NUMBER: 62/205,218 PRIOR FILING DATE: 2015-08-14 PRIOR APPLICATION NUMBER: 62/142,786 PRIOR FILING DATE: 2015-04-03 NUMBER OF SEQ ID NOS: 893 SEQ ID NO 232 LENGTH: 20 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide Query Match 100.0%; Score 20; Length 20; Score over Length 100.0%; Best Local Similarity 100.0%; Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CATCATAGCTACCATTTATT 20 Db 20 CATCATAGCTACCATTTATT 1 Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to Kimberly Chong at (571)272-3111. The examiner can normally be reached Monday thru Friday between M-F 8:00am-4:30pm. If attempts to reach the examiner by telephone are unsuccessful please contact the SPE for 1636 Neil Hammell at 571-272-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. For more information about the PAIR system, see http://pair-direct.uspto.gov. For all other customer support, please call the USPTO Call Center (UCC) at 800-786-9199. /KIMBERLY CHONG/ Primary Examiner Art Unit 1636
Read full office action

Prosecution Timeline

May 23, 2023
Application Filed
Apr 22, 2025
Non-Final Rejection mailed — §112
Jul 22, 2025
Response Filed
Oct 09, 2025
Final Rejection mailed — §112
Jan 09, 2026
Notice of Allowance
Apr 09, 2026
Request for Continued Examination
Apr 13, 2026
Response after Non-Final Action
May 07, 2026
Non-Final Rejection mailed — §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12673108
CELL-PENETRATING PEPTIDE CONJUGATES AND METHODS OF THEIR USE
1y 4m to grant Granted Jul 07, 2026
Patent 12668799
NON-LIPOSOMAL SYSTEMS FOR NUCLEIC ACID DELIVERY
1y 9m to grant Granted Jun 30, 2026
Patent 12662672
A Method Of Promoting Survival And/Or Function Of A Motor Neuron And Related Agents, Uses And Methods
4y 4m to grant Granted Jun 23, 2026
Patent 12662669
RAAV-BASED COMPOSITIONS AND METHODS FOR TREATING AMYOTROPHIC LATERAL SCLEROSIS
2y 10m to grant Granted Jun 23, 2026
Patent 12637673
COMPOSITIONS AND METHODS FOR SPLICING MODULATION OF UNC13A
11m to grant Granted May 26, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
72%
Grant Probability
85%
With Interview (+12.6%)
2y 6m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 1488 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month