Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Applicant’s amendments and remarks filed on April 2, 2026 are acknowledged. Claims 1-19, 21-85, 89, 91, and 95-130 have been canceled. Claims 20, 86, 90, and 92-94 were amended. Claims 20, 86-88, 90, 92-94, and 131-139 are pending and are examined on the merits herein.
Withdrawn Objections
In view of Applicant’s amendments and response, the objections to the specification are withdrawn.
In view of Applicant’s amendments and response, the claim objections are withdrawn.
Withdrawn Rejections
In view of Applicant’s amendments and response, the 35 U.S.C. 112(b) rejections are withdrawn.
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 119(e) as follows:
The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994).
The disclosure of the prior-filed application, Application No. 63/120,150 and 63/182,608, fails to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application. Application No. 63/120,150 and 63/182,608 do not provide support for dosing regimen based on body weight. Therefore, the effective filing date of the claims under examination is December 1, 2021.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on April 2, 2026 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner.
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Drawings
The drawings were received on April 2, 2026. These drawings are unacceptable because the top margin of FIGS. 19 and 20 are not labeled “Replacement Sheet”.
The drawings received on May 26, 2023 are objected to because it is difficult to decipher the difference in the “monthly” and “quarterly” solid lines in FIGS. 19 and 20. In addition, the brief description of the drawings section for FIG. 20 refers to a dotted light line and a dotted dark line; however, it is difficult to distinguish between the light line and the dark line that is referred to.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Response to Arguments
Applicant's arguments filed April 2, 2026 have been fully considered but they are not persuasive.
The drawings received on April 2, 2026 are unacceptable because the top margin of FIGS. 19 and 20 are not labeled “Replacement Sheet”. In addition, it is noted that the y axis of FIG. 19 should read “from Baseline” not “form Baseline” (emphasis added).
Therefore, the Examiner is maintaining the objections to the drawings filed on May 26, 2023.
Specification
The abstract of the disclosure does not commence on a separate sheet in accordance with 37 CFR 1.52(b)(4) and 1.72(b). A new abstract of the disclosure is required and must be presented on a separate sheet, apart from any other text.
It is noted that although Applicant amended the abstract to overcome the objections made in the Office Action dated January 6, 2026, the amended abstract is objected to because the amended abstract is not on a separate sheet apart from any other text.
Claim Objections
Claims 20 and 139 are objected to because of the following informalities:
Claim 20 parts (b) and (c): there is an extra space between the words “or” and “a” in the first instance of the phrase “or a salt thereof”.
Claim 20 should include “(SEQ ID NO: 14)” (as indicated by dotted arrow below) and “(SEQ ID NO: 15)” (as indicated by solid arrow below):
PNG
media_image1.png
80
654
media_image1.png
Greyscale
Claim 139 should include “(SEQ ID NO: 14)” (as indicated by dotted arrow below) and “(SEQ ID NO: 15)” (as indicated by solid arrow below):
PNG
media_image2.png
88
656
media_image2.png
Greyscale
Appropriate correction is required.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 20, 86, 87, 90, 92, 93, 94, 131-135, 137, 138, and 139 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Hulton, S. A. (2021). Lumasiran: expanding the treatment options for patients with primary hyperoxaluria type 1. Expert Opinion on Orphan Drugs, 9(7-10), 189-198, as evidenced by Al Musaimi, O., Al Shaer, D., Albericio, F., & de la Torre, B. G. (2021). 2020 FDA TIDES (peptides and oligonucleotides) harvest. Pharmaceuticals, 14(2), 145.
Regarding claims 20 and 139, the sense strand is SEQ ID NO: 14 and the antisense strand is SEQ ID NO: 15.
Regarding claims 20, 87, and 139, Hulton teaches that Primary hyperoxaluria type 1 (PH1) is an inborn error of glyoxylate metabolism whereby excessive endogenous oxalate production can result in kidney failure, systemic oxalosis and early death. The approval of the first therapeutic agent to alter the treatment pathway for PH1 – lumasiran, a novel RNA interference-based drug – represents a new era in the management of patients with PH1 [abstract]. Hulton teaches in Table 2 (reproduced below) the recommended dosing regimen based on body weight:
PNG
media_image3.png
156
410
media_image3.png
Greyscale
[page 195]. Al Musaimi et al. teaches the chemical structure of lumasiran in Figure 3 (reproduced below):
PNG
media_image4.png
396
966
media_image4.png
Greyscale
Al Musaimi et al. also teaches that lumasiran is a double-stranded small interference RNA (siRNA) consisting of the sodium salt of a sense and an antisense strand containing some chemically modified units. Moreover, an N-acetyl galactosamine-bearing dendrimer is covalently attached to the 3’ terminus of the sense strand [page 4, last paragraph].
Regarding claims 86 and 94, Hulton teaches that lumasiran is a subcutaneously administered RNAi therapeutic targeting glycolate oxidase and is transforming the management of patients with PH1 [page 190, left column].
Regarding claim 90, Hulton teaches that the clinical presentation of PH1 is heterogeneous. Some patients present with a severe, early-onset form in infancy that is often characterized by a failure to thrive because of end-stage renal disease. Some individuals remain asymptomatic or minimally symptomatic into their sixth decade of life and beyond, although more than half of these patients present with end-stage renal failure at the time of diagnosis [page 191, left column, first paragraph].
Regarding claims 92, 93, and 132, Hulton teaches that top-line results released
thus far showed that, at month 6, lumasiran treatment resulted in a substantial reduction in plasma oxalate in both dialysis-dependent and -independent patients [page 195, left column, first paragraph].
Regarding claim 131, Hulton teaches that for adequate preservation of renal function, early diagnosis and prompt initiation of such therapies are critical [page 191, left column, last full paragraph]. Hulton also teaches that although patients may benefit in the short term, conservative therapy cannot stop progression to end-stage renal disease over time [page 191, right column, first paragraph].
Regarding claims 133-135 and 138, the outcomes recited in the claims are inherent in the method of claim 20 absent evidence to the contrary.
Regarding claim 137, Hulton teaches that most recently lumasiran has been evaluated in patients with PH1 of all ages with severe renal impairment (eGFR ≤45 mL/min/1.73 m2 or elevated serum creatinine for patients <12 months of age) [page 194, right column, last paragraph bridging to page 195, left column].
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim 88 is rejected under 35 U.S.C. 103 as being unpatentable over Hulton, S. A. (2021). Lumasiran: expanding the treatment options for patients with primary hyperoxaluria type 1. Expert Opinion on Orphan Drugs, 9(7-10), 189-198, as evidenced by Al Musaimi, O., Al Shaer, D., Albericio, F., & de la Torre, B. G. (2021). 2020 FDA TIDES (peptides and oligonucleotides) harvest. Pharmaceuticals, 14(2), 145 as applied to claims 20, 86, 87, 90, 92, 93, 94, 131-135, 137, 138, and 139 above, and further in view of Brown et al. (US 10,351,854; reference previously cited by the Examiner).
Regarding claim 88, the teachings of Hulton are discussed above.
However, Hulton does not teach administering an additional therapeutic agent such as vitamin B6 (pyridoxine). The instant specification discloses that the additional therapeutic agent for the treatment of primary hyperoxaluria may be, for example, vitamin B6 (pyridoxine) [page 37, lines 25-26].
Brown et al. teaches that primary hyperoxaluria results in increased excretion of oxalate [column 40, lines 51-52]. Further, in a proportion of patients with primary hyperoxaluria type 1, pyridoxine treatment (vitamin B6) may also decrease oxalate excretion and prevent kidney stone formation [column 41, fourth paragraph].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the method of Hulton wherein the method further comprises administering a therapeutic agent such as vitamin B6 (pyridoxine) because Hulton taught a method for reducing cardiac oxalosis in a human subject having PH1, Brown et al. taught that primary hyperoxaluria results in increased excretion of oxalate, and Brown et al. taught that pyridoxine treatment (vitamin B6) may also decrease oxalate excretion and prevent kidney stone formation in patients with primary hyperoxaluria type 1. One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results.
Claim 136 is rejected under 35 U.S.C. 103 as being unpatentable over Hulton, S. A. (2021). Lumasiran: expanding the treatment options for patients with primary hyperoxaluria type 1. Expert Opinion on Orphan Drugs, 9(7-10), 189-198, as evidenced by Al Musaimi, O., Al Shaer, D., Albericio, F., & de la Torre, B. G. (2021). 2020 FDA TIDES (peptides and oligonucleotides) harvest. Pharmaceuticals, 14(2), 145 as applied to claims 20, 86, 87, 90, 92, 93, 94, 131-135, 137, 138, and 139 above, and further in view of Palka, P., Duhig, E., Carey, L., & Galbraith, A. (2001). Primary oxalosis with cardiac involvement: echocardiographic features of an unusual form of cardiomyopathy. Circulation, 103(24), e122-e123.
Regarding claim 136, the teachings of Hulton are discussed above.
However, Hulton does not teach wherein reduction in cardiac oxalosis is determined by an echocardiogram.
Palka et al. teaches that primary oxalosis is a rare hereditary metabolic disorder
in which an enhanced production of oxalic acid leads to hyperoxalemia and a deposition of calcium oxalate in different body organs (eg, kidney, heart). Palka et al. described the echocardiographic features of cardiac oxalosis manifesting as a form of infiltrative cardiomyopathy with restrictive physiology [page 1, right column, last paragraph].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the method of Hulton wherein reduction in cardiac oxalosis is determined by an echocardiogram because Hulton taught a method for reducing cardiac oxalosis in a human subject having PH1 and Palka et al. described the echocardiographic features of cardiac oxalosis manifesting as a form of infiltrative cardiomyopathy with restrictive physiology. One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 20, 86-88, 90, 92-94, and 131-139 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-14 and 17-19 of U.S. Patent No. 10,478,500. Although the claims at issue are not identical, they are not patentably distinct from each other because the patent claims are directed to a double stranded RNAi agent capable of inhibiting expression of HAO1 in a cell wherein the sense strand nucleotide sequence consists of SEQ ID NO: 589 and the antisense strand nucleotide sequence consists of SEQ ID NO: 706. The patent claims are also directed to a method of inhibiting HAO1 expression in a cell. Claim 19 of patent ‘500 is drawn to the double stranded RNAi agent of claim 1 wherein the sense strand consists of SEQ ID NO: 213 and the antisense strand consists of SEQ ID NO: 330. A person of ordinary skill in the art would recognize that the instant claims are an obvious variation of the patent claims because SEQ ID NO: 213 of patent ‘500 has a 100% match to instant SEQ ID NO: 14 as shown in the sequence search results below.
Query Match 100.0%; Score 21; DB 1; Length 21;
Best Local Similarity 66.7%;
Matches 14; Conservative 7; Mismatches 0; Indels 0; Gaps 0;
SEQ ID NO: 14 1 GACTTTCATCCTGGAAATATA 21
|||:::||:||:|||||:|:|
‘500 SEQ ID NO: 213 1 GACUUUCAUCCUGGAAAUAUA 21
Regarding the patent 10,478,500 claims limited only to compositions, the instant method claims are considered obvious over these claims in view of the findings of the court in Sun Pharmaceutical Industries, Ltd. v. Eli Lilly & Co., No. 10-1105 (Fed. Cir. July 28, 2010) in which the court indicated that obviousness-type double patenting encompasses any use for a compound where that use is disclosed in the specification of an earlier patent claiming the compound and is later claimed as a method of using that compound.
Claims 20, 86-88, 90, 92-94, and 131-139 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 2, 4, 5, and 7-16 of U.S. Patent No. 11,446,380. Although the claims at issue are not identical, they are not patentably distinct from each other because the patent claims are directed to a double stranded RNAi agent that inhibits expression of HAO1 in a cell wherein the sense strand comprises the nucleotide sequence SEQ ID NO: 213 and the antisense strand comprises the nucleotide sequence SEQ ID NO: 330. The specification of patent ‘380 indicates that the invention provides compositions comprising RNAi agents targeting HAO1 and methods of using the compositions for inhibiting HAO1 expression and for treating HAO1 associated disorders (e.g., PH1) [column 2, first paragraph]. A person of ordinary skill in the art would recognize that the instant claims are an obvious variation of the patent claims because SEQ ID NO: 213 of patent ‘380 has a 100% match to instant SEQ ID NO: 14 as shown in the sequence search results below.
Query Match 100.0%; Score 21; DB 1; Length 21;
Best Local Similarity 66.7%;
Matches 14; Conservative 7; Mismatches 0; Indels 0; Gaps 0;
SEQ ID NO: 14 1 GACTTTCATCCTGGAAATATA 21
|||:::||:||:|||||:|:|
‘380 SEQ ID NO: 213 1 GACUUUCAUCCUGGAAAUAUA 21
Regarding the 11,446,380 claims limited only to compositions comprising the recited oligonucleotides, the instant method claims are considered obvious over these claims in view of the findings of the court in Sun Pharmaceutical Industries, Ltd. v. Eli Lilly & Co., No. 10-1105 (Fed. Cir. July 28, 2010) in which the court indicated that obviousness-type double patenting encompasses any use for a compound where that use is disclosed in the specification of an earlier patent claiming the compound and is later claimed as a method of using that compound.
Claims 20, 86-88, 90, 92-94, and 131-139 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-23 of U.S. Patent No. 12,723,247 in view of Hulton, S. A. (2021). Lumasiran: expanding the treatment options for patients with primary hyperoxaluria type 1. Expert Opinion on Orphan Drugs, 9(7-10), 189-198.
The patent claims are directed to a method of treating a human subject having PH1 comprising administering to the subject 3.0 mg per kg bodyweight or 6.0 mg per kg bodyweight of a dsRNA agent which inhibits the expression of HAO1, or a salt thereof, wherein the dsRNA agent, or a salt thereof, comprises the nucleotide sequence of SEQ ID NO: 14 (sense strand) and SEQ ID NO: 15 (antisense strand). SEQ ID NOS: 14 and 15 of patent ‘247 has a 100% match to instant SEQ ID NOS: 14 and 15, respectively as shown in the alignment below.
Query Match 100.0%; Score 21; DB 1; Length 21;
Best Local Similarity 66.7%;
Matches 14; Conservative 7; Mismatches 0; Indels 0; Gaps 0;
SEQ ID NO: 14 1 GACTTTCATCCTGGAAATATA 21
|||:::||:||:|||||:|:|
‘247 SEQ ID NO: 14 1 GACUUUCAUCCUGGAAAUAUA 21
Query Match 100.0%; Score 23; DB 1; Length 23;
Best Local Similarity 69.6%;
Matches 16; Conservative 7; Mismatches 0; Indels 0; Gaps 0;
SEQ ID NO: 15 1 TATATTTCCAGGATGAAAGTCCA 23
:|:|:::||||||:|||||:|||
‘247 SEQ ID NO: 15 1 UAUAUUUCCAGGAUGAAAGUCCA 23
However, patent ‘247 does not teach the doses for the loading phase and the maintenance phase based on the subject’s body weight as recited in instant claim 20.
Hulton teaches that Primary hyperoxaluria type 1 (PH1) is an inborn error of glyoxylate metabolism whereby excessive endogenous oxalate production can result in kidney failure, systemic oxalosis and early death. The approval of the first therapeutic agent to alter the treatment pathway for PH1 – lumasiran, a novel RNA interference-based drug – represents a new era in the management of patients with PH1 [abstract]. Hulton teaches in Table 2 (reproduced below) the recommended dosing regimen based on body weight:
PNG
media_image5.png
156
410
media_image5.png
Greyscale
[page 195].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the method of patent ‘247 wherein the double stranded RNAi agent is administered in a dosing regimen comprising a loading phase followed by a maintenance phase according to the subject’s body weight as recited in claim 20 thereby reducing cardiac oxalosis because patent ‘247 taught a method of treating a human subject having PH1 comprising administering to the subject 3.0 mg per kg bodyweight or 6.0 mg per kg bodyweight of a dsRNA agent which inhibits the expression of HAO1, or a salt thereof, wherein the dsRNA agent, or a salt thereof, comprises the nucleotide sequence of SEQ ID NO: 14 (sense strand) and SEQ ID NO: 15 (antisense strand), Hulton taught that Primary hyperoxaluria type 1 (PH1) is an inborn error of glyoxylate metabolism whereby excessive endogenous oxalate production can result in kidney failure, systemic oxalosis and early death, Hulton taught that lumasiran, an RNAi based drug, is the first therapeutic agent to alter the treatment pathway for PH1, and Hulton explicitly taught the dosing regimen based on body weight according to the instant claim. One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results.
Response to Arguments
Applicant's arguments filed April 2, 2026 have been fully considered but they are not persuasive.
Applicant asserts that the claims of patent ‘500 and patent ‘380 do not teach or suggest the dosing regimen according to the subject’s body weight as required by instant claim 20. Applicant further asserts that there is no teaching or suggestion in the claims of patent ‘500 and patent ‘380 that would provide one of ordinary skill in the art with a reasonable expectation of success that administration to a PH1 subject of the claimed doses of the specific double stranded RNAi agents in the specific dosing regimen would reduce cardiac oxalosis in human subjects having PH1.
These arguments are not found persuasive. Regarding the patent ‘500 and patent ‘380 claims limited only to compositions, the instant method claims are considered obvious over these claims in view of the findings of the court in Sun Pharmaceutical Industries, Ltd. v. Eli Lilly & Co., No. 10-1105 (Fed. Cir. July 28, 2010) in which the court indicated that obviousness-type double patenting encompasses any use for a compound where that use is disclosed in the specification of an earlier patent claiming the compound and is later claimed as a method of using that compound.
Applicant asserts that the claims of copending Application No. 17/579,655 do not teach or suggest the dosing regimen according to the subject’s body weight as required by instant claim 20. Applicant further asserts that there is no teaching or suggestion in the claims of copending ‘655 that would provide one of ordinary skill in the art with a reasonable expectation of success that administration to a PH1 subject of the claimed doses of the specific double stranded RNAi agents in the specific dosing regimen would reduce cardiac oxalosis in human subjects having PH1.
It is noted that copending Application No. 17/579,655 has now been patented (U.S. Patent No. 12,723,247). Instant claims 20, 86-88, 90, 92-94, and 131-139 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-23 of U.S. Patent No. 12,723,247 in view of Hulton, S. A. (2021). Lumasiran: expanding the treatment options for patients with primary hyperoxaluria type 1. Expert Opinion on Orphan Drugs, 9(7-10), 189-198 as discussed above.
Conclusion
No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA TRAN whose telephone number is (571)270-0550. The examiner can normally be reached M-F 7:30 - 5:00pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/C.T./
Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
