Prosecution Insights
Last updated: April 19, 2026
Application No. 18/328,561

COMPOSITIONS AND METHODS FOR PRODUCING OREXIN NEUROPEPTIDE USING NANOCAPSULE-BASED DRUG DELIVERY SYSTEM

Non-Final OA §103§112
Filed
Jun 02, 2023
Examiner
ZAHORIK, AMANDA MARY
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Vl Biotech Inc.
OA Round
1 (Non-Final)
61%
Grant Probability
Moderate
1-2
OA Rounds
2y 5m
To Grant
99%
With Interview

Examiner Intelligence

Grants 61% of resolved cases
61%
Career Allow Rate
36 granted / 59 resolved
+1.0% vs TC avg
Strong +53% interview lift
Without
With
+53.1%
Interview Lift
resolved cases with interview
Typical timeline
2y 5m
Avg Prosecution
48 currently pending
Career history
107
Total Applications
across all art units

Statute-Specific Performance

§101
5.8%
-34.2% vs TC avg
§103
31.2%
-8.8% vs TC avg
§102
17.4%
-22.6% vs TC avg
§112
32.4%
-7.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 59 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA. Application Status This action is written in response to applicant’s correspondence received 06/02/2023 . Claims 1-9 are currently pending and are examined herein. Claim Objections Claim 1 is objected because of the following informalities: T he claim recites, “a first vector comprising nucleotide sequences as denoted by SEQ ID NO: 1 and SEQ ID NO: 2…wherein the first vector encodes mRNAs encoding a peptide with orexin activity” . As discussed in the rejection of the claim under 35 U.S.C. § 103, SEQ ID NOs: 1 and 2 are codon-optimized portions of the human orexin coding sequence. The way the claim is phrased, it is not entirely clear whether or not SEQ ID NOs: 1 and 2 are part of the recited mRNAs labeled with capsid protein tags, or whether the mRNAs encode additional orexin peptides using different sequences from SEQ ID NOs: 1 and 2. Appropriate correction is required. Claim Rejections - 35 USC § 112 (b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-4 and 6-9 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claims 1-2, 4 and 6-9 all recite vectors comprising “nucleotide sequences” or “a nucleotide sequence” or “one or more nucleotide sequences” “as denoted by” the recited sequence identifiers. This language renders the claims indefinite because it is not clear exactly what “denoted by” encompasse s , based on the plain meaning of the term . As a consequence, the scope of the sequences required by the claims is not clear. The word “denote” has several possible definitions, such as, “represent” or “indicate” (please see the attached OA.appendix ). However, those definitions do not clearly and unambiguously resolve the scope of the claims. One interpretation of “represent” encompasses any and all sequences of two or more nucleotides shown or represented in the sequence identifiers. However, the sequence identifiers may also be interpreted as “representing” certain sequences in their entirety with 100% identity. Because the exact meaning of the term is not clear, the metes and bounds of the claim cannot be determined with any certainty. Amending the claim language to, e.g., recite vectors comprising, “the nucleotide sequence(s) as set forth in”, or “the nucleotide sequence(s) of”, or simply, “SEQ ID NO(s):” followed by the appropriate number(s), thus removing the ambiguous “as denoted by” language and substituting it with clearer language, would obviate this rejection. For example, Applicant might amend claim 1 as follows: “ a first vector, comprising nucleotide sequences as denoted by SEQ ID NO: 1 and SEQ ID NO: 2 ”. Claim 2 is further rejected because it recites a vector comprising, “one or more nucleotide sequences as denoted by SEQ ID NO: 4 and SEQ ID NO: 5”. It is not clear wh ether this is intended to be a group of alternatives, i.e., one or more sequences selected from SEQ ID NOs: 4 and 5, or if it means any one or more of any 2+ nucleotide sequence shown in SEQ ID NO: 4 or SEQ ID NO: 5, or if it means that the vector may comprise multiple occurrences SEQ ID NOs: 4 and/or 5. In the interests of customer service and compact prosecution, the limitation will be interpreted as a list of alternatives, i.e., the claim requires one or more of SEQ ID NO: 4 and/or SEQ ID NO: 5. Claims 4, 7 and 9 recite similar “one or more nucleotide sequences as denoted by” language, and are rejected under the same rationale described above. Claim 7 will be interpreted the same way as claim 2. Claims 4 and 9 will be interpreted as encompassing either any one or more of any 2+ nucleotide sequences present in SEQ ID NO: 10, or multiple occurrences of SEQ ID NO: 10. Those claims identified in the statement of rejection but not explicitly referenced in the rejection are also rejected for depending from a rejected claim but failing to remedy the indefiniteness therein. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: Determining the scope and contents of the prior art. Ascertaining the differences between the prior art and the claims at issue. Resolving the level of ordinary skill in the pertinent art. Considering objective evidence present in the application indicating obviousness or nonobviousness . This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim s 1 and 5-6 are rejected under 35 U.S.C. 103 as being unpatentable over U.S. PGPUB 2016 / 0194613 to Williams (hereinafter ‘Williams) in view of NCBI Reference Sequence: NM_001524.1 ( Homo sapiens hypocretin neuropeptide precursor (HCRT), mRNA 23-MAY-2023 ; hereinafter ‘NM_001524.1), Wang (Wang et al. The Orexin/Receptor System: Molecular Mechanism and Therapeutic Potential for Neurological Diseases . Front. Mol. Neurosci . 11:220. 27 June 2018 .), Inouye ( Codon optimization of genes for efficient protein expression in mammalian cells by selection of only preferred human codons . Protein Expression and Purification, Volume 109, 2015, Pages 47-54 . ) , Anand (T ailored delivery of analgesic ziconotide across a blood brain barrier model using viral nanocontainers . Sci Rep 5, 12497 (2015). ) and Sun ( Sun et al. Establishment of MicroRNA delivery system by PP7 bacteriophage-like particles carrying cell-penetrating peptide . Journal of Bioscience and Bioengineering,Volume 124, Issue 2, 2017, Pages 242-249 . ). Regarding claim 1, Williams teaches a composition comprising a first vector comprising nucleotide sequences encoding mRNAs and a capsid protein recognition sequence, wherein the mRNAs are labeled with one or more capsid protein tags: [0014] Methods for the in vivo expression and packaging of RNA within VLPs are also included. Typically the methods include engineering a recombinant host cell, for example a bacterial cell, to express one or more genes encoding one or more RNAs of a target gene or a complement RNA thereof. The one or more RNAs are engineered to contain a high affinity tag for a bacteriophage or virus coat protein. The recombinant host cell is engineered to also express one or more genes encoding the coat protein of a bacteriophage corresponding to the recognition tag within the RNA. The methods also include expressing the RNA and coat protein constructs in the cells as well as purifying the resulting VLPs containing RNA. [0060] RNA that is designed for incorporation within VLPs contains a sequence that is a recognition tag for the bacteriophage or virus coat protein of the VLP. Typically the recognition tag facilitates efficient packaging of the RNA into the VLP …t he recognition tag is a 54-nucleotide RNA containing two hairpin structures specific for the enterobacteria bacteriophage q beta coat protein A note on claim interpretation: the specification states that, “ the one or more capsid protein tags formed by the capsid protein recognition sequence has a hairpin structure ” (p. 7 ln 6 -8). Based on this disclosure, and on Williams’ disclosure that the “recognition tag facilitates efficient packaging of the RNA into the VLP” and it comprises “two hairpin structures” , the claim term “capsid protein recognition sequence” is interpreted as equivalent to Williams’ recognition tag, and the claim term “capsid protein tags” is interpreted to refer to one or more of the hairpin structures comprised within the recognition tag sequence. Therefore, Williams teaches a composition m RNAs labeled with a capsid protein recognition sequence (recognition tag), which contains the capsid protein tags (hairpins). Williams further teaches a second vector comprising one or more nucleotide sequences encoding one or more capsid proteins, wherein the one or more capsid proteins are capable of self-assembling into one or more virus-like particles that encapsulated the mRNAs: [0072] Typically, the gene(s) encoding RNA and genes encoding bacteriophage or viral coat proteins are cloned into an expression system for the expression of VLPs containing RNA in vivo. Suitable expression systems are known in the art (see, for example, Studier, Protein Expr Purif , 41: 207-234. (2005)). The coat protein is expressed in the pCDF-1b expression vector. The RNA is expressed in either pET-28b or pUC-19. [0008] A combined packing and assembly method that efficiently packs ribonucleic acid (RNA) into virus like particles (VLPs) has been developed. In an exemplary method VLPs spontaneously assemble and efficiently load specifically designed RNA in vivo. Williams does not teach sequences as denoted by SEQ ID NOs: 1 and 2. However, Williams teaches that any gene encoding RNA may be cloned into the expression system, and Wang teaches that orexin has therapeutic potential for various neurological diseases (Title, Abstract), thus providing a teaching, suggestion or motivation to adapt Williams’ system to express orexin in place of a generic RNA . Wang does not teach SEQ ID NOs: 1 or 2. NM_001524.1 teaches the human hypocretin mRNA transcript. It has 83.3% local identity to the full length of SEQ ID NO: 1: RESULT 1 NM_001524_1 Query Match 73.3%; Score 74.8; DB 1; Length 577; Best Local Similarity 83.3%; Matches 85; Conservative 0; Mismatches 17; Indels 0; Gaps 0; Qy 1 GCCCAGCCCCTGCCCGACTGCTGCAGGCAGAAGACCTGCAGCTGCAGGCTGTACGAGCTG 60 || |||||||||||||||||||| | || ||||| ||| ||| | || ||||||||| Db 184 GCACAGCCCCTGCCCGACTGCTGTCGTCAAAAGACTTGCTCTTGCCGCCTCTACGAGCTG 243 Qy 61 CTGCACGGCGCCGGCAACCACGCCGCCGGCATCCTGACCCTG 102 ||||||||||| ||||| ||||| ||||||||||| || ||| Db 244 CTGCACGGCGCGGGCAATCACGCGGCCGGCATCCTCACGCTG 285 NM_001524.1 further teaches that positions 88-483 are the HCRT coding sequence, and inspection of the alignment between NM_001524.1 and SEQ ID NO: 1 shows that the positions of NM_001524.1 which align with SEQ ID NO: 1 are an in-frame segment of the HCRT mRNA encoding orexin A . NM_001524.1 does not comprise SEQ ID NO: 1 with 100% identity. However, Inoue teaches the preferred human codons for optimizing protein expression of genes in mammalian cells (see Table 2, pp. 50-51). Applying Inou y e’s guidelines to positions 184-285 of NM_001524.1 yields the following sequence (preferred codons are underlined): 5’- GCCCAGCCCCTGCCCGACTGC TGCAGGCAG AAG ACC TGC AGCTGCAGGCTG TACGAGCTGCTGCACGGC GCC GGC AAC CAC GCC GCCGGCATC CTGACC CTG-3’ Aligning the codon-optimized version of NM_001524.1 with SEQ ID NO: 1 shows that the two sequences share 100% identity: RESULT 1 NASEQ2_02252026_094647 Query Match 100.0%; Score 102; DB 1; Length 102; Best Local Similarity 100.0%; Matches 102; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GCCCAGCCCCTGCCCGACTGCTGCAGGCAGAAGACCTGCAGCTGCAGGCTGTACGAGCTG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GCCCAGCCCCTGCCCGACTGCTGCAGGCAGAAGACCTGCAGCTGCAGGCTGTACGAGCTG 60 Qy 61 CTGCACGGCGCCGGCAACCACGCCGCCGGCATCCTGACCCTG 102 |||||||||||||||||||||||||||||||||||||||||| Db 61 CTGCACGGCGCCGGCAACCACGCCGCCGGCATCCTGACCCTG 102 Therefore, merely applying Inou y e’s teachings to NM_001524. 1 , as suggested by Inouye, predictably results in a sequence comprising SEQ ID NO: 1. Likewise, positions 293-375 of NM_001524. 1 match SEQ ID NO: 2 with 86.7% local identity, which is within the region encoding orexin B (and when Inouye’s approach is applied to the coding region of orexin B (positions 292-375; see the NCBI listing): RESULT 1 NASEQ2_02272026_113219 Query Match 77.9%; Score 65.4; DB 1; Length 577; Best Local Similarity 86.7%; Matches 72; Conservative 0; Mismatches 11; Indels 0; Gaps 0; Qy 2 GGAGGAGCGGCCCCCCCGGCCTGCAGGGCAGGCTGCAGAGGCTGCTGCAGGCCAGCGGCA 61 ||||| ||| ||||| ||||| ||||| |||||||| | || |||||||||||||||| Db 293 GGAGGTCCGGGCCCCCGGGCCTCCAGGGTCGGCTGCAGCGCCTCCTGCAGGCCAGCGGCA 352 Qy 62 ACCACGCCGCCGGCATCCTGACC 84 |||||||||| |||||||||||| Db 353 ACCACGCCGCGGGCATCCTGACC 375 When Inouye’s approach is applied to the above region of NM_001524. 1, it likewise yields a sequence comprising SEQ ID NO: 2 with 100% identity: RESULT 1 NASEQ2_02272026_113119 Query Match 100.0%; Score 84; DB 1; Length 84; Best Local Similarity 100.0%; Matches 84; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AGGAGGAGCGGCCCCCCCGGCCTGCAGGGCAGGCTGCAGAGGCTGCTGCAGGCCAGCGGC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 AGGAGGAGCGGCCCCCCCGGCCTGCAGGGCAGGCTGCAGAGGCTGCTGCAGGCCAGCGGC 60 Qy 61 AACCACGCCGCCGGCATCCTGACC 84 |||||||||||||||||||||||| Db 61 AACCACGCCGCCGGCATCCTGACC 84 Williams and NM_001524. 1 do not teach the composition comprising BBB-penetrating peptides. Anand teaches a VLP delivery system with a BBB -penetrating peptide (HIV-Tat) conjugated to the capsid protein (Abstract). While Anand does not teach a sequence encoding the capsid protein and BBB-penetrating peptide, Sun teaches that TAT can readily be expressed as part of a VLP rather than conjugated (“ We analyzed the expression of PP7 VLPs carrying the TAT peptide and microRNA in Escherichia coli ”, p. 242) . It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have modified the VLP as taught by Williams to incorporate mRNA expressing orexin for therapeutic applications. The ordinary artisan would have turned to the wild-type orexin coding sequence, as taught by NM_001524. 1, to design the mRNA. Given orexin’s known role in human neurological disease, the ordinary artisan would further have searched for ways to improve expression of the mRNA, and followed Inouye’s guidance regarding codon optimization to enhance protein expression in mammalian cells, resulting in SEQ ID NOs: 1 and 2 (orexin A and B). Lastly, the ordinary artisan, in searching for ways to optimize delivery of the VLP expressing orexin to the brain, would have been motivated by the teachings of Anand and Sun to express a TAT-capsid fusion protein to facilitate uptake of the VLP across the BBB. Combined, these elements amount to a known gene therapy delivery vehicle adapted to express a known gene with a known role in neurological disease, and further optimizing the vehicle for expression and delivery using Claim s 2 , 4, 7 and 9 are rejected under 35 U.S.C. 103 as being unpatentable over Williams, NM_001524.1 , Wang, Inouye, Anand and Sun , as applied to claims 1 and 5-6 above, further in view of Witherell ( Specific RNA Binding by Q ß Coat Protein . Biochemistry 1989, 28, 71-7 6. ) , W IPO Publication 2022 / 218928 to Saiba Ag. (hereinafter ‘ Saiba ’ ), U.S. Patent No. 10,781,241 B2 to Cellivery Therapeutics, Inc. (hereinafter ‘ Cellivery ’), Van den Worm ( Cryo Electron Microscopy Reconstructions of the Leviviridae Unveil the Densest Icosahedral RNA Packing Possible . J. Mol. Biol. (2006) 363, 858–865 .) , and Georgakopoulos -Soares ( Secondary structures in RNA synthesis, splicing and translation . Computational and Structural Biotechnology Journal 20 (2022) 2871–2884 .) Williams, NM_001524.1 , Wang, Inouye, Anand and Sun teach the composition and method of using it of claims 1 and 5-6, wherein the first vector comprises sequences as denoted by SEQ ID NOs: 1 and 2. Williams, NM_001524.1 , Wang, Inouye, Anand and Sun do not teach that the first vector comprises a nucleotide sequence as denoted by SEQ ID NO: 3, and the second vetor comprises one or more nucleotide sequences as denoted by SEQ ID NO: 4 and 5. Witherell teaches a capsid recognition sequence for a ssRNA bacteriophage, Qβ, coat protein , fragment 2, which is identical to SEQ ID NO: 3 and which has among the highest K a values of the sequences tested (Table II and below)): Witherell does not teach sequences as denoted by SEQ ID NO: 4 or 5. Saiba teaches reference SEQ ID NO: 3, a viral (AP205) coat protein gene with 100% identity to instant SEQ ID NO: 4: RESULT 1 BLX94641 (NOTE: this sequence has 3 duplicates in the database searched) ID BLX94641 standard; DNA; 396 BP. XX AC BLX94641; XX DT 08-DEC-2022 (first entry) XX DE AP205 coat protein gene, SEQ ID 3. XX KW AP205 coat protein; CP gene; allergy; analgesic; antiallergic; KW antiarthritic; antibacterial; antidiabetic; antiinflammatory ; KW antimicrobial-gen.; antiparasitic; autoimmune disease; KW borrelia infection; cancer; cytostatic; gastrointestinal-gen.; gene; KW immune stimulation; immunosuppressive; immunotherapy; infectious disease; KW inflammatory disease; lyme disease; metabolic-gen.; migraine; KW non-insulin dependent diabetes; plasmodium falciparum infection; KW prophylactic to disease; ss; testosterone; therapeutic; KW vaccine antibacterial; vaccine, anticancer; vaccine, antiparasitic; KW vaccine, general; virus-like particle. XX OS Acinetobacter phage AP205. XX CC PN WO2022218928-A1. XX CC PD 20-OCT-2022. XX CC PF 11-APR-2022; 2022WO-EP059646. XX PR 12-APR-2021; 2021EP-00167817. XX CC PA (SAIB-) SAIBA AG. XX CC PI Tars K, Lieknina I, Cernova D; XX DR WPI; 2022-D2246G/091. DR P-PSDB; BLX94663, BLX94664, BLX94665. DR REFSEQ; NC_002700.2. XX CC PT New modified virus-like particle of RNA bacteriophage AP205 (AP205 VLP) CC PT comprising fusion proteins comprises AP205 coat protein dimer comprising CC PT first and second AP205 polypeptide used to treating disease in animal or CC PT human e.g. cancer. XX CC PS Example 1; SEQ ID NO 3; 88pp; English. XX CC The present invention relates to a novel modified virus-like particle of CC RNA bacteriophage AP205 (AP205 VLP), useful for treating disease or CC disorder in an animal or human. The AP205 VLP comprises one or more CC fusion proteins comprising: (a) an AP205 coat protein dimer, where the CC AP205 coat protein dimer comprises a first AP205 polypeptide and a second CC AP205 polypeptide where the first AP205 polypeptide is fused at its C- CC terminus directly or via an amino acid spacer to the N-terminus of the CC second AP205 polypeptide; and (b) an antigenic polypeptide, where the CC antigenic polypeptide is fused to N-terminus and/or the C-terminus of the CC AP205 coat protein dimer directly or via an amino acid linker. The CC invention further relates to a pharmaceutical composition comprising the CC AP205 VLP, and a pharmaceutically acceptable carrier, diluent and/or CC excipient. The novel AP205 VLP of the invention can be used for: vaccine CC development; generating immune responses against a variety of antigens; CC amd treating disease or disorder such as autoimmune disease, inflammatory CC disease, infectious disease, cancer, inflammatory disease such as RA, MS, CC psoriasis, ankylosing spondylitis, asthma, Crohns , Colitis, COPD, CC diabetes, and neurodermatitis (allergic dermatitis), Lyme borreliosis, CC migraine, type II diabetes, and allergy in dog; treating or preventing CC malaria; and lowering testosterone levels in an animal or human. XX SQ Sequence 396 BP; 116 A; 91 C; 83 G; 106 T; 0 U; 0 Other; Query Match 100.0%; Score 396; Length 396; Best Local Similarity 100.0%; Matches 396; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGGCAAATAAGCCAATGCAACCGATCACATCTACAGCAAATAAAATTGTGTGGAGTGAT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGGCAAATAAGCCAATGCAACCGATCACATCTACAGCAAATAAAATTGTGTGGAGTGAT 60 Qy 61 CCAACTCGTTTATCAACTACATTTTCAGCAAGTCTGTTACGCCAACGTGTTAAAGTTGGT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 CCAACTCGTTTATCAACTACATTTTCAGCAAGTCTGTTACGCCAACGTGTTAAAGTTGGT 120 Qy 121 ATAGCCGAACTGAATAATGTTTCAGGTCAATATGTATCTGTTTATAAGCGTCCTGCACCT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 ATAGCCGAACTGAATAATGTTTCAGGTCAATATGTATCTGTTTATAAGCGTCCTGCACCT 180 Qy 181 AAACCGGAAGGTTGTGCAGATGCCTGTGTCATTATGCCGAATGAAAACCAATCCATTCGC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 AAACCGGAAGGTTGTGCAGATGCCTGTGTCATTATGCCGAATGAAAACCAATCCATTCGC 240 Qy 241 ACAGTGATTTCAGGGTCAGCCGAAAACTTGGCTACCTTAAAAGCAGAATGGGAAACTCAC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 ACAGTGATTTCAGGGTCAGCCGAAAACTTGGCTACCTTAAAAGCAGAATGGGAAACTCAC 300 Qy 301 AAACGTAACGTTGACACACTCTTCGCGAGCGGCAACGCCGGTTTGGGTTTCCTTGACCCT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 AAACGTAACGTTGACACACTCTTCGCGAGCGGCAACGCCGGTTTGGGTTTCCTTGACCCT 360 Qy 361 ACTGCGGCTATCGTATCGTCTGATACTACTGCTTAA 396 |||||||||||||||||||||||||||||||||||| Db 361 ACTGCGGCTATCGTATCGTCTGATACTACTGCTTAA 396 Saiba further teaches that reference SEQ ID NO: 3, a modified capsid protein from the AP205 ssRNA bacteriophage, allows fusion of antigens or other peptides at the N- and/or C-terminus (p. 2) without comprising VLP integrity and stability (p. 3). This is in contrast to other related ssRNA bacteriophages such as Qβ (p. 1). Thus, Saiba provides a teaching, suggestion or motivation to use the modified AP205 capsid protein to form a VLP amenable to fusion with a BBB-penetrating peptide. The above references do not teach SEQ ID NO: 5. However, Cellivery teaches that SEQ ID NO: 5 is merely the TAT CPP nucleotide sequence (SEQ ID NO: 833): Van den Worm teaches that the well-known single-stranded RNA bacteriophages from the Leviviridae family - MS2, Qβ , PP7 , and AP205 - share a similar mechanism of encapsidation , in which the capsid protein (CP) dimers bind to the operator hairpin (recognition tag) (p. 858). Van den Worm also notes that, “ non-specific RNA sequences are able to interact with CP dimers and contribute substantially to the overall assembly reaction ” (Id.). In Figure 1, Van den Worm shows that the hairpin structure is shared between QB and AP205. Van den Worm further notes that, for AP205, “the genome interacts only loosely with the capsid, probably only through non-specific RNA backbone interactions” (p. 862). In summary, Van den Worm teaches that Qβ and AP205 are two closely related bacteriophages with similar recognition hairpin structures and assembly mechanisms, and that AP205 in particular is prone to non-specific interactions with RNA to facilitate packaging. Georgakopoulos -Soares further notes that, in the context of mRNA, “ secondary structures can impact RNA synthesis, splicing, translation and mRNA half-life ”, thus providing the ordinary artisan with a motivation to experiment with different recognition tags to find the tag that works best with a given mRNA sequence. Regarding claims 4 and 9, SEQ ID NOs: 8 and 9 comprise SEQ ID NOs: 1, 2 and 3, as taught by the prior art above, in a pT7CFE1-NHA vector (see the sequence listing and p. 11 ln 11-15). Likewise, SEQ ID NO: 10 merely comprises SEQ ID NOs: 4 and 5, which are also taught by the prior art. It is noted that the claims are interpreted as requiring only some nucleotide sequences denoted by the recited identifiers, and that there is no evidence on the record that the vector backbones which make up the remainder of SEQ ID NOs: 8, 9 and 10 exhibit an unexpected property over the elements taught by the prior art. It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have modified the more generic composition taught by Williams, NM_001524.1 , Wang, Inouye, Anand and Sun to include the specific known TAT peptide taught by Cellivery and a pair of compatible capsid recognition tags and capsid proteins for assembly of the VLP , e.g., as taught by Witherell and Saiba . The ordinary artisan would have been motivated to utilize S aiba’s AP205 construct based on Saiba’s teachings that the modified AP205 capsid protein was more amenable to being fused with other peptide sequences relative to other, related phages, which would have facilitated the addition of a TAT peptide to the capsid protein. It would further have been obvious to try any of the recognition hairpins from any of the closely-related phages, such as MS2, Qβ or PP7, as taught by Van den Worm, based on the combination of Van den Worm’s teachings that these phages were all closely related and shared similar packaging mechanisms and AP205 capsid assembly is primarily non-sequence-specific , and Georgakopoulos -Soares ’s teachings that secondary structures (such as hairpins) in mRNA influence various properties such as translation and half-life. There were a finite number of known Leviviridae phages capable of forming VLPs, and a finite number of known capsid proteins and recognition hairpins associated with them. Thus in regard to the limitations of the claims, the skilled artisan has good reason to pursue the known options within his or her technical grasp to optimize the combination of mRNA, recognition hairpin and capsid for improved assembly, delivery and expression of the mRNA . Claim s 3 and 8 are rejected under 35 U.S.C. 103 as being unpatentable over Williams, NM_001524.1 , Wang, Inouye, Anand and Sun, as applied to claims 1 and 5-6 above, further in view of U.S. PGPUB 2024/0042009 A1 to Esperovax , Inc. (hereinafter ‘ Esperovax ’, priority filing date 11/25/2020) . Williams, NM_001524.1 , Wang, Inouye, Anand and Sun render obvious the composition and method of administering it of claims 1 and 5-6 , from which the instantly rejected claims depend, as described above. Williams, NM_001524.1 , Wang, Inouye, Anand and Sun do not teach an IRES between the capsid recognition sequence and SEQ ID NOs: 1 and 2. SEQ ID NOs: 1 and 2 are interpreted as at least portions of orexin mRNA sequences, i.e., protein coding sequences. Experovax teache s a recombinant yeast cell comprising a nucleic acid sequence encoding a therapeutic protein (claim 1), a nucleic acid sequence encoding a VLP-forming protein (claim 2), including a capsid protein (claim 3), wherein the nucleic acid sequence encoding the therapeutic protein further comprises an IRES element inactive in yeast (claim 4), and the IRES is placed 5’ of the therapeutic protein gene (para [0083]), all in “replicons comprising…[a] nucleic acid sequence encoding a therapeutic protein…an MS2 binding site” (para [0103]). Experovax further notes that this approach is appropriate in situations where a therapeutic protein is to be expressed in a mammalian subject: [0083] In an exemplary embodiment, an IRES element from the Encephalomyocarditis Virus is placed 5′ of the therapeutic protein gene, for example in the 5′ UTR of the therapeutic protein gene … the IRES element is regulated by the Gal promoter and is switched on in the late phases of yeast production, such that the mRNA is produced but no corresponding protein is made. The mRNA can then be captured by the GAG-MS2 fusion protein and incorporated into the VLPs for secretion past the destabilized cell wall. The particles can then be taken up by endogenous cells in the mammalian subject, e.g., enterocytes or other intestinal epithelial cells, dendritic cells or other immune cells, and the like, where the mRNA is unpackaged and translated and the protein expressed. These embodiments are particularly advantageous for therapeutic protein expression requiring precise folding and/or post-translational modification, e.g. for antibody or protein replacement therapies It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have placed the mRNAs in the first vector as taught by the combination of Williams, NM_001524.1 , Wang, Inouye, Anand and Sun under the control of an IRES 5’ of the mRNA. As taught by Experovax , inserting an IRES at that location does not allow expression of the protein in the packaging cell, such as a yeast cell, but does allow expression in a subject to which the VLP/host cell is administered, which is desirable for protein replacement therapies. Further incorporating the capsid recognition sequences, as taught by Williams, would predictably have allowed packaging of the mRNA expression construct in the VLP for administration to the mammalian subject. Conclusion No claim is allowed at this time. Any inquiry concerning this communication or earlier communications from the examiner should be directed to FILLIN "Examiner name" \* MERGEFORMAT AMANDA M ZAHORIK whose telephone number is FILLIN "Phone number" \* MERGEFORMAT (703)756-1433 . The examiner can normally be reached FILLIN "Work Schedule?" \* MERGEFORMAT M-F 8:00-16:00 EST . Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, FILLIN "SPE Name?" \* MERGEFORMAT Neil Hammell can be reached on FILLIN "SPE Phone?" \* MERGEFORMAT (571) 270-5919 . The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /AMANDA M ZAHORIK/ Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Jun 02, 2023
Application Filed
Mar 03, 2026
Non-Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12545941
MGAT1 DEFICIENT CELLS AND USES THEREOF
2y 5m to grant Granted Feb 10, 2026
Patent 12533423
NEUROPROTECTIVE GENE THERAPY TARGETING THE AKT PATHWAY
2y 5m to grant Granted Jan 27, 2026
Patent 12522835
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Jan 13, 2026
Patent 12516332
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Jan 06, 2026
Patent 12509677
PROBIOTIC STRAINS HAVING INCREASED STORAGE STABILITY
2y 5m to grant Granted Dec 30, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
61%
Grant Probability
99%
With Interview (+53.1%)
2y 5m
Median Time to Grant
Low
PTA Risk
Based on 59 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month