DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Response to Amendment
The amendment filed August 10th, 2026 is acknowledged. Regarding the Office Action mailed February 10th, 2026:
The objections to the specification are withdrawn in view of the amendments.
The objections to the drawings are withdrawn in view of the amendments.
The rejections of claims 2, 5-7, 24, 29, and 31 as set forth under 35 U.S.C. 112(b) are withdrawn in view of the amendments.
The rejection set forth under 35 U.S.C. 112(d) is withdrawn in view of the amendments.
The rejection set forth under 35 U.S.C. 112(a) is withdrawn in view of the amendments.
The rejection set forth under 35 U.S.C. 101 is withdrawn in view of the amendments.
The rejections set forth under 35 U.S.C. 103 are withdrawn in view of the amendments.
Maintained or modified rejections are set forth below, as necessitated by the amendments. Responses to arguments, if necessary, follow their respective rejection sections.
Claim Summary
Claims 1, 2, 18, 21, 23-24, 29, 32, 39, 69, and 100 have been amended. Claims 3-5, 7-10, 13-17, 19-20, 22, 25-26, 28, 30, 33-35, 38, 40-68, 70-99, and 101-102 have been canceled. Claims 1-2, 6, 11-12, 18, 21, 23-24, 27, 29, 31-32, 36-37, 39, 69,and 100 are pending. Claims 1-2, 6, 11-12, 18, 21, 23-24, 27, 29, 31-32, 36-37, 39, 69,and 100 are under examination and discussed in this Office action.
Claim Rejections - 35 USC § 112(b) – Modified – Necessitated by Amendment
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 11, 12, 18, 21, 23, 27, and 32 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 11 recites the limitation “wherein the CRISPR nuclease comprises a Cas12a nuclease”. It is unclear how the use of Cas12a will successfully discriminate between Chlamydia trachomatis and Neisseria gonorrhoeae given the specific crRNAs of claim 1. As presented, SEQ ID NOs 10 and 24 both possess the sequence <taatttctactaagtgtagat> as the first 21 base pairs. As evidenced by Jedrzejczyk (CRISPR-Cas12a nucleases function with structurally engineered crRNAs: SynThetic tracrRNA, Scientific Reports, July 2022, 12, 1-12), this specific sequence is known as a constant region (Page 1, paragraph 2; Figure 1: constant region from base -20 to 0 presented as RNA equivalent to the sequence above), which a Cas12a will interact with (Page 1, paragraph 2). Therefore, both crRNAs could interact with a Cas12a nuclease. If the CRISPR nuclease of claim 1 is embodied as a single CRISPR nuclease of Cas12a, it is unclear how Cas12a will specifically collaterally cleave the first or the second single stranded nucleic acid linker probes if only one bacteria is present in a sample because Cas12a is not known to collaterally cleave specific sequences. Kellner (SHERLOCK: nucleic acid detection with CRISPR nucleases, Nature Protocols, September 2019, 14, 2986-3012; previously cited) teaches that Cas12a is not known to have a collateral cleavage motif preference and instead has nonspecific nuclease activity towards ssDNA (Page 2986, paragraph 1; Box 1: motif preference not applicable; Figure 2, multiplex detection, Cas12a has no specific collateral cleavage motif). Given these considerations, a single-sample single-tube multiplex detection embodiment of Chlamydia trachomatis and Neisseria gonorrhoeae will result in both the first and the second linker probes being cleaved even if only one bacteria is present in the sample. The activated Cas12a will indiscriminately collaterally cleave any ssDNA in the reaction, resulting in a false positive test for at least one of the bacteria. Therefore, in some embodiments, it is unclear how the Cas12a of claim 11 will work as claimed.
Claim 12 recites the limitation “wherein the single stranded nucleic acid linker probe of part ii) comprises SEQ ID NO:5, wherein the single stranded nucleic acid linker probe of part iv) comprises SEQ ID NO:17”, and further depends from the method as described in claim 1. In certain embodiments, it is unclear how the use of these specific ssDNA linker probes will successfully discriminate between Chlamydia trachomatis and Neisseria gonorrhoeae. For instance, if the CRISPR nuclease of claim 1 is embodied as a single CRISPR nuclease of Cas12a, it is unclear how Cas12a will specifically collaterally cleave SEQ ID NO:5 or SEQ ID NO:17 if only one bacteria is present in a sample because Cas12a is not known to collaterally cleave specific sequences. Kellner (SHERLOCK: nucleic acid detection with CRISPR nucleases, Nature Protocols, September 2019, 14, 2986-3012; previously cited) teaches that Cas12a is not known to have a collateral cleavage motif preference and instead has nonspecific nuclease activity towards ssDNA (Page 2986, paragraph 1; Box 1: motif preference not applicable; Figure 2, multiplex detection, Cas12a has no specific collateral cleavage motif). Given these considerations, a multiplex detection of Chlamydia trachomatis and Neisseria gonorrhoeae will result in both ssDNA linker probes being cleaved even if only one bacteria is present in the sample. The activated Cas12a will indiscriminately collaterally cleave any ssDNA in the reaction, resulting in a false positive test for at least one of the bacteria. Therefore, in some embodiments, it is unclear how claim 12 will work as claimed.
Claim 18 recites the limitation “wherein the first, second, third and/or fourth single stranded nucleic acids are bound to one or more labels which can be a same label or a different label, wherein the label is selected from any one of a fluorescent label, radiolabel, streptavidin, an antibody, 6-carboxyfluorescein (FAM), biotin, a thiol group located on the 5' or 3' end of the single stranded nucleic acid, a nanoparticle, and combinations thereof”. It is unclear from this recitation if all the single stranded nucleic acids are intended to be bound together to the same label or labels, or if they can each individually be bound to a different label or labels. It is also unclear if the different label is the same type of label for each individual single stranded nucleic acid, or if a different label can be used for each individual single stranded nucleic acid. This is further complicated by the recitation of “the label is selected from…”, which could be interpreted as there being only one label that is used for all of the individual single stranded nucleic acids, eliminating the option for more.
The newly amended “which can be a same label or a different label” does not serve to clarify these issues, and instead adds a new issue related to embodiments where the label is the same. It is unclear how, in embodiments where a combination of the first, second, third and fourth single stranded nucleic acids are bound to one label which can be the same label, Chlamydia trachomatis and Neisseria gonorrhoeae can be distinguished from each other in embodiments where they are detected in the same sample and reaction container. For instance, if the label used for the first and second single stranded nucleic acids (associated with Chlamydia trachomatis as detailed in claim 1) and the third and fourth single stranded nucleic acids (associated with Neisseria gonorrhoeae as detailed in claim 1) is the same fluorescent label, a sample only positive for Chlamydia trachomatis would look as if it is positive for both organisms since the fluorescent label is the same for both organisms. Claims 21, 23, 27, and 32 are also rejected here for their dependence on claim 18 and not further clarifying the identified issue.
Claim 23 recites the limitation “wherein a single gold nanoparticle is bound to more than one single stranded nucleic acid of the same sequence, or of different sequences.” While the amendment has clarified that the same sequence or different sequences may be bound to a single gold nanoparticle, it is still unclear from this recitation how the gold nanoparticle would differentiate between detecting Chlamydia trachomatis and Neisseria gonorrhoeae depending on which different single stranded nucleic acid sequences are bound to the gold nanoparticle. As claimed in claim 1, the first and second single stranded nucleic acids are associated with detection of Chlamydia trachomatis, while the third and fourth single stranded nucleic acids are associated with detection of Neisseria gonorrhoeae. If a single gold nanoparticle were bound to both the first and the fourth single stranded nucleic acid, for instance, there would be no ability to distinguish that a sample is positive for one particular bacteria given that the gold nanoparticle could interact with both bacteria in a single-sample single-tube multiplex detection embodiment. Any combinations other than just the first and/or second single stranded nucleic acids being bound to the nanoparticle, or just the third and/or fourth single stranded nucleic acids being bound to the nanoparticle, would have similar issues. Therefore, the claim is still found indefinite.
Claim 32 recites the limitation “wherein an antibody is added to the sample that binds to the one or more labels on the first, second, third, and/or fourth single stranded nucleic acids, wherein the antibody is conjugated to a detectable label.” While the amendment has clarified the antecedent basis issue, it is now unclear from this recitation how the detectable label on the antibody would differentiate between Chlamydia trachomatis and Neisseria gonorrhoeae if the antibody can bind to combinations of the four single stranded nucleic acids. As claimed in claim 1, the first and second single stranded nucleic acids are associated with detection of Chlamydia trachomatis, while the third and fourth single stranded nucleic acids are associated with detection of Neisseria gonorrhoeae. If an antibody can bind to a label on both the first and the fourth single stranded nucleic acid, for instance, there would be no ability to distinguish that a sample is positive for a particular bacteria given that the antibody could interact with single stranded nucleic acids of both bacteria in a single-sample single-tube multiplex detection embodiment. The same would be true if the antibody could bind to any combinations other than just the first and/or second single stranded nucleic acids, or just the third and/or fourth single stranded nucleic acids. Therefore, the claim is still found indefinite.
Response to Arguments
Applicant's arguments filed August 10th, 2026 related to claims 12 and 18 have been fully considered but they are not persuasive.
With respect to claim 12, the Applicant first summarizes the rejection from the previous Office Action (Pages 15-16 of the Remarks filed August 10th, 2026). The Applicant then argues that the method can be performed on separate samples (as presented in claim 37), wherein there would be no confusion between linkers (Page 16 of the Remarks filed August 10th, 2026). The Applicant further argues that even if there is one sample (as presented in claim 36), the reaction could happen in two separate reaction containers, or the method can be performed sequentially (Page 16 of the Remarks filed August 10th, 2026). The Applicant gives summary recitations of claims 18 and 27, which relate to labeling for discriminating Chlamydia trachomatis and Neisseria gonorrhoeae (Page 16 of the Remarks filed August 10th, 2026). The Applicant further argues that claim 12 is not indefinite because it does not recite each and every way Chlamydia trachomatis and Neisseria gonorrhoeae may be distinguished, and a person skilled in the art would understand the metes and bounds of the claim and the variety of ways in which Chlamydia trachomatis and Neisseria gonorrhoeae nucleic acids can be detected and distinguished (Page 16 of the Remarks filed August 10th, 2026).
In response to these arguments, it is noted that claim 1 states that the presence or absence of Chlamydia trachomatis and Neisseria gonorrhoeae is detected in a sample. “A sample”, given the broadest reasonable interpretation, can be interpreted to mean one sample in one reaction container. Claim 12 depends from claim 1, and therefore can reasonably be interpreted to encompass one sample in one reaction container based on the claim dependencies. While the Applicant indicates an option for separate samples, this limitation appears in claim 37, which does not further limit claim 12 and therefore cannot inform the embodiments of claim 12. Furthermore, while claim 36 specifically limits the sample to a single sample, it does not include claim language limiting the method to one sample being split across multiple reaction containers and also does not further limit claim 12. Therefore, claim 12 is open to all embodiments that include detection of both Chlamydia trachomatis and Neisseria gonorrhoeae in one sample in one reaction container, including the embodiments identified above related to one Cas12a nuclease. It is still unclear how, if one Cas12a is the embodied nuclease, the use of the specific ssDNA linker probes will successfully discriminate between Chlamydia trachomatis and Neisseria gonorrhoeae when Cas12a indiscriminately cleaves ssDNA. Therefore, the arguments are not persuasive
With respect to claim 18, the Applicant first summarizes the rejection from the previous Office Action (Page 17 of the Remarks filed August 10th, 2026). The Applicant states claim 18 has been amended to specify that the first, second, third, and/or fourth single stranded nucleic acids are bound to one or more labels which can be a same label or a different label (Page 17 of the Remarks filed August 10th, 2026). The Applicant further states that dependent claims 20, 23, and 27 also make this clear (Page 17 of the Remarks filed August 10th, 2026).
In response to these arguments, it is noted that the added amendment has not solved the previously identified clarity issue and has introduced further clarity issues as analyzed above. Therefore, the arguments are not persuasive. The rejection is modified as necessitated by amendment and maintained, as well as the rejection of associated dependent claims.
With respect to claim 23, the Applicant states that the claim has been amended to solve the clarity issue (Pages 17-18 of the Remarks filed August 10th, 2026).
In response to this statement, it is acknowledged that the Applicant has clarified that either the same or different single stranded nucleic acids can be bound to the gold nanoparticle. However, this presents further clarity issues as analyzed above. Therefore, the rejection is modified as necessitated by amendment and maintained.
With respect to claim 32, the Applicant states that the claim has been amended to solve the clarity issue based on the Examiner’s suggestion (Page 19 of the Remarks filed August 10th, 2026).
In response to this statement, it is acknowledged that the Applicant has clarified that the antibody has can bind to labels on the first, second, third, and/or fourth single stranded nucleic acids. However, this presents further clarity issues as analyzed above. While the Applicant indicates the amendment was made based on the Examiner’s suggestion, it should be noted that the applied interpretation was used for the purpose of complete examination in the interest of compact prosecution, without indication that it was a suggested amendment for the claim.
Conclusion
Claims 11, 12, 18, 21, 23, 27, and 32 are rejected. Claims 1-2, 6, 18, 21, 24, 29, 31, 36-37, 39, 69, and 100 are free of the prior art.
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Allison E Schloop whose telephone number is (703)756-4597. The examiner can normally be reached Monday-Friday 8:30-5 ET.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Anne Gussow can be reached at (571) 272-6047. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ALLISON E SCHLOOP/Examiner, Art Unit 1683
/Robert T. Crow/Primary Examiner, Art Unit 1683
