DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of Group III (claims 41-42, 44, 48, 50, 52 and 74) in the reply filed on 7/9/2026 is acknowledged.
This application contains claims directed to the following patentably distinct species: Type of gRNA targeting CIITA.
SEQ ID NOs:1-101 (claim 42)
SEQ ID NOs: 47, 55, 71, 80, 82, 83, 87, 91, 96-101 (claim 74)
The species are independent or distinct because the sequences of the listed SEQ ID NOs are unique and they do not overlap. In addition, these species are not obvious variants of each other based on the current record.
Applicant is required under 35 U.S.C. 121 to elect a single disclosed species, or a single grouping of patentably indistinct species, for prosecution on the merits to which the claims shall be restricted if no generic claim is finally held to be allowable. Currently, claim 41 is generic.
There is a serious search and/or examination burden for the patentably distinct species as set forth above because at least the following reason(s) apply: the species or groupings of patentably indistinct species have acquired a separate status in the art in view of their different classification; the species or groupings of patentably indistinct species have acquired a separate status in the art due to their recognized divergent subject matter; and/or the species or groupings of patentably indistinct species require a different field of search (e.g., searching different classes /subclasses or electronic resources, or employing different search strategies or search queries).
Applicant is advised that the reply to this requirement to be complete must include (i) an election of a species to be examined even though the requirement may be traversed (37 CFR 1.143) and (ii) identification of the claims encompassing the elected species or grouping of patentably indistinct species, including any claims subsequently added. An argument that a claim is allowable or that all claims are generic is considered nonresponsive unless accompanied by an election.
The election may be made with or without traverse. To preserve a right to petition, the election must be made with traverse. If the reply does not distinctly and specifically point out supposed errors in the election of species requirement, the election shall be treated as an election without traverse. Traversal must be presented at the time of election in order to be considered timely. Failure to timely traverse the requirement will result in the loss of right to petition under 37 CFR 1.144. If claims are added after the election, applicant must indicate which of these claims are readable on the elected species or grouping of patentably indistinct species.
Should applicant traverse on the ground that the species, or groupings of patentably indistinct species from which election is required, are not patentably distinct, applicant should submit evidence or identify such evidence now of record showing them to be obvious variants or clearly admit on the record that this is the case. In either instance, if the examiner finds one of the species unpatentable over the prior art, the evidence or admission may be used in a rejection under 35 U.S.C. 103 or pre-AIA 35 U.S.C. 103(a) of the other species.
Upon the allowance of a generic claim, applicant will be entitled to consideration of claims to additional species which depend from or otherwise require all the limitations of an allowable generic claim as provided by 37 CFR 1.141.
During a telephone conversation with Mr. Newman Han on 7/21/2026 a provisional election was made without traverse to prosecute the invention of SEQ ID NO:87. Affirmation of this election must be made by applicant in replying to this Office action.
Claims 3, 5-6, 8-9, 12-13, 15, 18-23, 25, 27-28, 30-31, 33-34, 38, 40, 43, 45-47, 49, 51, 53, 55, 57-59, 61, 63, 65-67, 70-71, 73, 75, 77-80, 82-83, 85-86 have been canceled, claims 1-2, 4, 7, 10-11, 14, 16-17, 24, 26, 29, 32, 35-37, 39, 54, 60, 62, 64, 68-69, 72, 76, 81, 84 and 87 have been withdrawn from consideration as being drawn to non-elected subject matter, and claims 41-42, 44, 48, 50, 52 and 74 have been considered on the merits.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 42 rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 42 discloses a limitation referring to Table 1. It is not clear what this table 1 intends to point out. Without the content of Table 1 not being listed in the claim, it is considered that the mere citing of “Table 1” renders the claim indefinite.
MPEP§2173.05(s) states “[w]here possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table "is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim. Incorporation by reference is a necessity doctrine, not for applicant’s convenience." Ex parte Fressola, 27 USPQ2d 1608, 1609 (Bd. Pat. App. & Inter. 1993) (citations omitted).”
Claim 48 is dependent on claim 45 which has been canceled. Thus, it is indefinite because the dependency of claim 48 is unclear. For search purpose claim 48 is interpreted to be dependent on claim 44.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 41-42, 44, 50, 52 and 74 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Meissner et al. (US2019/0309259A1)
Meissner et al. teach a method for producing hypoimmunogenic stem cells comprising contacting a stem cell with a Cas protein or a nucleic acid sequence encoding the Cas protein and RNAs having sequences selected from the group consisting of SEQ ID NO: 5184-36352, thereby editing the CIITA gene (para. 19). Meissner et al. teach CIITA-deficient stem cell engineered by using CRISPR/Cas system and gRNAs targeting CIITA (para. 193, 232, 374). The RNAs (SEQ ID NOs:5184-36352) for editing the CIITA gene taught by Meissner et al. are considered as guide RNA (gRNA) for the Cas9 protein (a RNA-guided DNA binding agent) to reduce or eliminate CIITA surface expression and/or activity in the cell (para. 19).
Regarding the CIITA gRNA targets a CIITA genomic target sequence comprising at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242, however, it is considered that gRNAs taught by Meissner et al. would inherently meet the limitation because the SEQ ID NO:11415 of Meissner et al.
is 100% identical to the claimed SEQ ID NO:87 (see alignment below).
RESULT 2
US-15-572-776-11415
(NOTE: this sequence has 11 duplicates in the database searched)
Sequence 11415, US/15572776
Publication No. US20190309259A1
GENERAL INFORMATION
APPLICANT: President and Fellows of Harvard College
TITLE OF INVENTION: UNIVERSAL DONOR STEM CELLS AND RELATED METHODS
FILE REFERENCE: HRVY-073-WO1
CURRENT APPLICATION NUMBER: US/15/572,776
CURRENT FILING DATE: 2019-06-03
PRIOR APPLICATION NUMBER: PCT/US2016/31551
PRIOR FILING DATE: 2016-05-09
PRIOR APPLICATION NUMBER: US 62/158,999
PRIOR FILING DATE: 2015-05-08
FEATURE:
OTHER INFORMATION: CRISPR gRNA sequence
Query Match 100.0%; Score 20; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CTGCATCCCTGCTCAGGCTA 20
||||||||||||||||||||
Db 1 CTGCATCCCTGCTCAGGCTA 20
Because the gRNA taught by Meissner et al. is identical to the gRNA of the instant invention, the features of the claimed gRNA targeting the genomic coordinates as claimed would be inherently met by the gRNA of Meissner et al.
Regarding claim 44 directed to the composition further comprising an RNA-guided DNA binding agent, it is considered that the Cas9 taught by Meissner et al. would meet the limitation. As the cells are contacted with Cas9 protein or a nucleic acid encoding Cas9 and the RNA (gRNA), the mixture of the cells along with Cas9 protein or nucleic acid and gRNA would meet the composition of claim 44.
Regarding claims 50 and 52, as the RNA taught by Meissner et al. is identical to the gRNA of SEQ ID NO:87 of the instant invention, it is considered that the feature as claimed in claim 50 would be inherently met by the RNA of Meissner et al.
It is noted that the optional limitations of the claims are not considered.
Thus, the reference anticipates the claimed invention.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 41-42, 44, 48, 50, 52 and 74 is/are rejected under 35 U.S.C. 103 as being unpatentable over Meissner et al. (supra) in view of Adli (2018, Nature Communication).
Meissner et al. anticipate the subject matter of claims 41-42, 44, 50, 52 and 74, and thus, render them obvious (see above).
Regarding claim 48 directed to the RNA-guided DNA binding agent generates a cytosine to thymine conversion with the CIITA genomic target sequence, while Meissner et al. teach Cas9, however, they do not teach the base editing function as claimed.
Adli teach that the CRISPR-Cas9 technology has advanced to base-editing technology, so-called second-generation genome-editing tools which utilizes a fusion complex composed of nickase Cas9 fused to an APOBEC1 deaminase enzyme and uracil glycosylase inhibitor (UGI) protein effectively converts Cytosine (C) into Thymine (T) at the target site without causing double strand DNA breaks (p.6, 1st col.). Adli teach that using the CRISPR base editor, early STOP codons can be introduced in genes which is an efficient and less deleterious alternative to WT Cas0-mediated gene knockout (p.6, 2nd col.).
It would have been obvious to a person skilled in the art to use the second-generation CRISPR base editor for the gene editing of CIITA (knockout of CIITA gene) taught by Meissner et al. with a reasonable expectation of success.
A person of ordinary skilled in the art would have been motivated to use the second-generation CRISPR base editor that can convert C to T (cytosine based editor; CBE) as alternative to the original CRISPR/Cas9 system as taught by Adli.
Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill before the effective filing date of the claimed invention.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to TAEYOON KIM whose telephone number is (571)272-9041. The examiner can normally be reached 9-5 EST Monday-Friday.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JAMES SCHULTZ can be reached at 571-272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/TAEYOON KIM/ Primary Examiner, Art Unit 1631