Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Status of Claims
Claims 1-20 are pending. Claims 1-8 are the subject of this NON-FINAL Office Action. This is the first office action on the merits.
Priority Note
Applicants have not filed English translations of the Chinese priority documents; thus, priority cannot be verified.
Election/Restrictions
Applicant’s election with traverse of Group I (claims 1-8) in the reply filed on 06/12/2026 is acknowledged. Applicants argue that the same special technical features exists between Groups I-IV because they all require the same primer and probe design. To the extent the primer design method of claim 1 is decipherable, this is unequivocally untrue. Claim 9 (Group II) does not require a method, rather only a resulting product. In other words, any products in the prior art that meet the structural requirements of the primers anticipated the product claims whether the method is used or not. The same applies to the remaining groups. Moreover, the “one step detection” of Group IV is not required in any of the other product or method claims, nor can it be required in the product claims. Applicants simply mischaracterize what is claimed in each group. Finally, as explained below, the primer and probe design is anticipated, proving that a special technical feature is lacking.
Claims 9-20 are withdrawn.
Claim Rejection - 35 USC § 112- Indefiniteness
The following is a quotation of 35 U.S.C. 112(b):
(B) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
Claims 1-8 are rejected under 35 U.S.C. 112(b) as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor regards as the invention.
The metes and bounds of the claims are so unclear and confusing that the Office cannot determine if the instant claims are patentable because it would require the Office to speculate as to the metes and bounds of the instant claims. See MPEP § 2173.06 (“Second, where there is a great deal of confusion and uncertainty as to the proper interpretation of the limitations of a claim, it would not be proper to reject such a claim on the basis of prior art. As stated in In re Steele, 305 F.2d 859, 134 USPQ 292 (CCPA 1962), a rejection under 35 U.S.C. 103 should not be based on considerable speculation about the meaning of terms employed in a claim or assumptions that must be made as to the scope of the claims.”).
As to the “forward primer,” one cannot determine the sequence required. Specifically, Applicants use the word “sequence” throughout step S1, yet there are more than one sequence. For example, the referent is unclear in “replacing U in the sequence with T.”
As to the “stem-loop primer,” the sequence here is completely undecipherable. First, Applicants’ state “the forward primer is compared with a universal stem-loop primer.” However, “universal stem-loop primer” is vague. The specification vaguely states
the term “universal stem-loop sequence” refers to all sequences consisting of the part of the stem-loop structure composed of the stem sequence and the circular sequence, and the part of the specific target miRNA, which may be used for miRNA detection
(para. 0073). In other words, the “stem-loop primer” is a stem-loop primer. This informs the reader of nothing new. Without knowing the exact sequence to compare, much less what makes stem-loop primer “universal,” it is impossible to determine the “stem-loop primer” sequence.
Second, the “complementary pairing” is confusing and unclear because it is never compared to any sequence. The claim requires “the forward primer is compared with a universal stem-loop primer to find out a region in which the number of consecutive bases of complementary pairing is greater than 5.” Applicants simply never state to what region these bases are complementary. It is impossible to determine what is complementary to what.
As to melting temperatures, this is dependent on numerous unstated variables such as salt concentration, magnesium concentration, primer concentration, etc. See e.g. OligoPool, Which Tm Value to Trust When NEB, IDT & Primer3 Differ, available at https://oligopool.com/guides/melting-temperature, accessed 07/06/2026. Thus, it is unclear what variables are held at what amounts, yielding unclear metes and bounds of the melting temperatures.
Finally, it is impossible to determine what sequence are compared for the deltaGibbs. The claim simply does not state which specific sequences are compared.
Claim 3 suffers similar confusion when it states “the starting point of the reverse primer is located at the starting point of the circular sequence of the stem-loop primer, or 1-8 bp deviation to the 5' end, or 1-3 bp deviation to the 3' end.” What is the “starting point” of a primer- the 3’ end or the 5’ end? What is the “starting point” of a circular sequence? What is a base pair “deviation” “to a 5’ [or 3’] end”- a mismatch, a mispairing, or is this a measure of location? Where do the 5’ and 3’ ends start and end? None of this is specified.
In claim 4, there is no measure of the 3’ and 5’ ends, yielding confusion as to the scope of each.
It is not clear from claim 7 whether all of the sequences are used for the comparison step in claim 1, or only one.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. § 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-8 are rejected under 35 U.S.C. § 102(a)(1) as being anticipated by Chen et al, Real-time quantification of microRNAs by stem-loop RT-PCR, Nucleic Acids Res. 2005 Nov 27;33(20):e179. doi: 10.1093/nar/gni178, as evidenced by US 20050266418.
As best the Examiner can determine based on Figure 1, the claims are directed to designing the following primers and probe:
PNG
media_image1.png
406
650
media_image1.png
Greyscale
This is well-known since at least 2005.
As to claims 1-6 and 8, Chen teaches forward primer (GCCTGAAGCTGCCAGTTGA) that excludes last 6 bases of miRNA target (miR-21 minus aacugu in aagcugccaguugaagaacugu) and Tm 60°C (based on salt adjusted @ 250mM); stem-loop primer (GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACAGTT) that has 6 bases (ACAGTT) complementary to miR and deltaGibbs of the 6 bases (-3.62 kcal/mol) versus forward primer (-21.98 kcal/mol) of -18.36kcal/mol (based on 37°C, 50nM salt, 1.5mM magnesium, 02.nM dNTP, and 250nM primer); reverse primer (GTGCAGGGTCCGAGGT) identical to stem, without 5 or bases of miR (ACAGTT) and Tm 57.51°C (based on salt adjusted @ 250mM); and probe (TGGATACGACACAGTTCT) split between stem-loop and miR (Fig. 1).
PNG
media_image2.png
562
392
media_image2.png
Greyscale
Further as to claim 4, US 20050266418 is the patent application for the technique of Chen et al. as shown in the Figures of US 20050266418 and the fact the same inventors (Chen and Ridzon from Applera assignee) are listed. US 20050266418 explicitly requires “the detector probes of the present teachings have a Tm of 63-69C” (para. 0039).
Prior Art
The following prior art is also pertinent: US 20060078924; US 20070111226; US 20070048757; US20100047784; CN103045723A (SEQ ID NO: 1); CN103757126 (SEQ ID NO: 2); CN108103201 (SEQ ID NO: 3); CN109295233 (SEQ ID NO: 4).
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Aaron Priest whose telephone number is (571)270-1095. The examiner can normally be reached 8am-6pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at (571) 272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AARON A PRIEST/Primary Examiner, Art Unit 1681