DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant’s correspondence received on 07/13/2026. Claims 1-4, 9-13, 16-17, 21-23, 29, 32-33, 36-37 and 39 are currently pending. Claim 39 is withdrawn from prosecution as being drawn to nonelected subject matter. Accordingly, claims 1-4, 9-13, 16-17, 21-23, 29, 32-33, 36-37 are examined herein.
Election/Restrictions
Claim 39 is withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being
drawn to a nonelected Group II, there being no allowable generic or linking claim. The restriction requirement mailed on 04/13/2026 is still deemed proper. Applicant's elected Group I without traverse in the reply filed on 07/13/2026.
Information Disclosure Statement
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. This application claims priority to PRO 63/417,233 filed on 10/18/2022 and PRO 63/353,374 filed on 06/17/2022.
Claim Objections
Claims 1, 16-17 are objected to because of the following informalities: The recitation “a RNA” should be “an RNA”. Appropriate correction is required.
Claim Interpretation
The recitation “(a) a guide RNA … and/or (b) a RNA-guided endonuclease…” in claim 1 is interpreted as a Markush group of “(a) a guide RNA …”, “(b) a RNA-guided endonuclease…”, or “(a) and (b)”. Hence, claim 1 and dependent claims encompass 3 embodiments with distinct requirements:
Embodiment I: a method for delivering a CRISPR/Cas-mediated gene editing system ..., thereby reducing the expression of the target gene in cells of the eye of the subject, which requires only “(a)”;
Embodiment II: a method for delivering a CRISPR/Cas-mediated gene editing system ..., thereby reducing the expression of the target gene in cells of the eye of the subject, which requires only “(b)”;
Embodiment III: a method for delivering a CRISPR/Cas-mediated gene editing system ..., thereby reducing the expression of the target gene in cells of the eye of the subject, which requires “(a) and (b)”.
Claim Rejections - 35 USC § 112 Scope of Enablement
Claims 1-4, 9-13, 16-17, 21-23, 29, 32-33, 36-37 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement, because the specification, while being enabling for the Embodiment III as interpreted above, does not reasonably provide enablement for Embodiment I or II, as interpreted above. The claim contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention.
The test of enablement is whether one skilled in the art could make and use the claimed invention from the disclosures in the specification coupled with information known in the art without undue experimentation (United States v. Telectronics., 8 USPQ2d 1217 (Fed. Cir. 1988)). Whether undue experimentation is needed is not based upon a single factor but rather is a conclusion reached by weighing many factors. These factors were outlined in Ex parte Forman, 230 USPQ 546 (Bd. Pat. App. & Inter. 1986) and again in In re Wands, 8 USPQ2d 1400 (Fed. Cir. 1988), and the most relevant factors are indicated below:
Nature of the Invention
The claimed invention directs to a method for delivering a CRISPR/Cas-mediated gene editing system to cells of the eye of a subject with specific requirement for specific molecular components, and a result of reducing the expression of a target gene in the cells of the eye of the subject is required.
The Breadth of the Claims
The scope of the independent claim 1 limits the method to 3 distinct embodiments with different requirements for specific molecular components, as interpreted above.
Guidance of the Specification
The specification only presents Embodiment III in the only relevant working examples (Examples 4-6, pages 45-48), and is silent as to: what outcomes should be reasonably expected by persons having ordinary skill in the art (PHOSITAs) for Embodiments I and II claimed by claim 1. There is no guidance regarding how to achieve reducing the expression of the target gene in cells of the eye of the subject using the claimed method embodiments wherein delivering said CRISPR/Cas gene editing system that require only either “(a) a guide RNA…” or “(b) a RNA-guided endonuclease…” alone.
The State of the Prior Art
Regarding the state of the art, a review article by Pacesa (Cell. 2024 Feb 29;187(5):1076-1100) confirms the ground-breaking discovery of an engineered CRISPR/Cas gene editing system by Jinek (Science. 2012 Aug 17;337(6096):816-21; Cited on IDS filed on 08/22/2023) that “a fully programmable one-nuclease-one-guide-RNA design” is required to achieve targeted gene editing using a CRISPR/Cas gene editing system (Jinek, page 816, Abstract; Pacesa, page 1076, last two lines). It is not known in the art how to achieve targeted gene editing using CRISPR/Cas system with either a guide RNA alone or an RNA-guided endonuclease alone.
The Level of Predictability in the Art
Since no prior art exists that teaches achieving targeted gene editing using either a guide RNA alone or an RNA-guided CRISPR associated endonuclease alone, prior art does not establish predictability, hence it is highly unpredictable how PHOSITA could achieve the required targeted gene-editing results using the claimed Embodiments I or II.
The Quantity of Experimentation necessarily Needed
In light of the high level of unpredictability in the art, and the limited amount of direction provided by the inventor, and the noticeable absence of working examples other than the Embodiment III, the quantity of experimentation necessarily needed to make or use the invention as claimed based on the disclosure is considerably high. There would be an unreasonable amount of experimentation required by a person of ordinary skill in the art.
Conclusion of 35 U.S.C. 112(a) Enablement Analysis
After applying the Wands factors and analysis to claim 1, taking into consideration the factors outlined above, including the nature of the invention, the breadth of the claims, the state of the art, the guidance provided by the applicant and the specific examples, in view of the applicant’s entire disclosure, it is concluded that the specification is not enabled for the full scope as discussed above. Therefore, claim 1 is rejected under 35 U.S.C. §112(a) for failing to disclose sufficient information to enable a person of skill in the art to use the invention commensurate in scope with these claims.
Claims 2-4, 9-13, 16-17, 21-23, 29, 32-33, 36-37 are also rejected for depending from claim 1 and failing to remedy the lack of full scope of enablement therein.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
This rejection focuses on Embodiment III, see Claim Interpretation above.
Claims 1-4, 9-12, 32-33, 36 are rejected under 35 U.S.C. 103 as being unpatentable over Jain (Proc Natl Acad Sci U S A. 2017 114(42):11199-11204; Cited on IDS filed on 08/22/2023), in view of Finn (Cell Rep. 2018 22(9):2227-2235), further in view of Ryals (PLoS One. 2020;15(10): e0241006). Rejections of claims 10 & 11 are evidenced by Cong (Science. 2013;339(6121):819-23) and Jinek (Science. 2014;343(6176):1247997).
Jain (2017) teaches a method for delivering a CRISPR/Cas-mediated gene editing system (Page 11199, Title, Abstract) to cells of the eye of a subject (mouse, page 11201, Figure 2), the method comprising administering to the subject an adenovirus with CRISPR assembly (Ad5-crMYOC) with (a) a nucleic acid encoding the guide RNA for a target gene; and (b) a nucleic acid encoding the RNA-guided endonuclease, (Fig. S6. Map of the shuttle vector used to generate the Ad5-crMYOC virus show expression cassettes for Cas9 endonuclease and gRNA), thereby reducing the expression of the target gene in cells of the eye of the subject (Page 11202, Fig. 3C&D for mice treated in vivo, 3F for human eyes treated ex vivo; Page 11201, right column, 2nd ¶, lines 26-29). Jain does not teach “administering to the subject a plurality of lipid nanoparticles (LNPs) complexed with” the required (a) and (b).
However, Finn (Cell Rep. 2018;22(9):2227-2235) teaches “administering to the subject a plurality of lipid nanoparticles (LNPs) complexed with” the required components (a) and (b) to reduce the expression of a target gene in a subject (Page 2227, Graphical Abstract; Page 2228, Abstract). Finn does not teach delivering LNPs complexed with the required (a) and (b) to cells in the eye of a subject.
However, Ryals (PLoS One. 2020;15(10):e0241006) teaches “administering to the subject a plurality of lipid nanoparticles (LNPs) complexed with” therapeutic mRNAs to the cells of the eye of mice (Page 1, Abstract; Page 6, Figure 1; Page 7, Figure 2).
It would have been obvious to persons having ordinary skills in the art (PHOSITAs) before the effective filing date of the claimed invention to have substituted the adenovirus delivery vehicle taught by Jain (2017) with the LNP nonviral vehicles, taught by Finn (2018) and Ryals (2020), and substituted the double stranded DNA that encodes the required components (a) and (b) with the RNA format of (a) and (b) taught by Finn and Ryals. It would have merely amounted to a simple substitution of prior art elements according to known methods to yield predictable results. One would have been motivated to do so because Finn (2018) teaches that LNPs offer numerous benefits over viral vectors, including “(1) transient, non-integrating … construct to limit … off-target events, immune responses, …; (2) efficient delivery with … one or more sgRNAs; (3) the option to redose … ; and (4) scalability … ” (Page 2228, right column, 3rd ¶). One would have reasonable expectation of success because both CRISPR/Cas gene editing methods work through the same molecular mechanism and successful LNP-based gene editing in vivo using different species of animals (Finn, Page 2228, Abstract, mice and Rats). Ryals’s teaching confirms the feasibility of delivering LNPs to cells of the eye of a subject, further boosting the reasonable expectation of success because Ryals shares the identical cell target and administration route as Jain.
Regarding claim 1, substituting Jain’s adenovirus vector format of dsDNA delivery for Cas9 and gRNA with Finn’s LNP-based RNA format of delivery to cells of the eye of a subject, based on the bridging teachings from Ryals, PHOSITAs would have arrived at the claimed invention with reasonable expectation of success as discussed above.
Regarding claim 2, both Jain (Page 11199, Abstract, lines 6 & 8) and Ryals (Page 1, Abstract, lines 16) teach targeting cells of trabecular meshwork and achieving gene expression modulation.
Regarding claim 3, Jain further teaches the target gene being the myocilin (MYOC) gene (Page 11199, Title, Abstract).
Regarding claim 4, both Jain and Finn teaching achieving reducing the expression of the protein encoded by a target gene using different formats of delivery of Cas9 and gRNA for more than at least 20% (Jain Figure 3F, for ex vivo editing of MYOC in human eyes; Finn, page 2231, Figure 2, for in vivo editing of TTR in liver of mice).
Regarding claim 9, Jain teaches ex vivo editing of MYOC in human eyes and in vivo editing in mice. Jain shows reduction of MYOC expression in the trabecular meshwork (TM) cells (Figure 3A) and measured the amount of secreted MYOC in the culture of the anterior chamber tissue that includes the TM cells as an indirect method to measure the level of MYOC protein expression as the result of gene editing, which shows reduction of the secreted MYOC protein to about 50% of control levels (Figure 3F) after a single administration, i.e. single dose (Page 11203, left column, 5th ¶; right column, 2nd ¶). Given that Finn (2018) shows sustained and dose-dependent in vivo knockdown of the TTR target gene in mouse livers for over 50 weeks (Page 2231, Figure 2E-G) with some doses achieving over 90% knockdown, PHOSITAs would have reasonable expectation of success to achieve at least 20% knockdown of MYOC gene in the cells of the TM eye tissue, by substituting the adenovirus delivery method of Jain with the LNP format of Finn, with reasonable dose optimization.
Regarding claims 10 and 11, Jain (Page 11203, left column, 2nd ¶, line 7) and Finn (Page 2227, last ¶, line 4) teach SpCas9 or Spy Cas9, both are alternative names for Streptococcus pyogenes Cas9, as evidenced by Cong (2013; Page 820, left column, line 10) and Jinek (2014; Page 1215, Rationale, line 3).
Regarding claim 12, Jain further teaches designing gRNA near the start codon of human MYOC, in exon1 (Page 11200, left column, 2nd ¶, lines 7-8).
Regarding claim 32, both Jain (Page 11201, Figure 2) and Ryals (Page 4, under Injections, line 3) describe using intravitreal injection as an administration route.
Regarding claim 33, Finn (2018) further teaches a single administration of a plurality of nanoparticles (Pages 2227 & 2228, Title). Ryals (2020) teaches intravitreal injections (Page 4, under Injections, line 3).
Regarding claim 36, Jain further teaches a method of administering a CRISPR/Cas-mediated gene editing system to cells of the eye of a human subject, either maintained in an ex vivo organ culture system as cultured organs (Page 11199, Abstract, lines 11-12), or as cultured cells because human trabecular meshwork (TM) cells were isolated from carefully dissected human TM tissue explants derived from patients with glaucoma or from normal donors (Page 111202, right column, 4th ¶, lines 1-3). Both embodiments read on the claim limitation “cells of the eye of a subject”.
Claim 13, 16-21 are rejected under 35 U.S.C. 103 as being unpatentable over Jain (2017), in view of Finn (2018), Ryals (2020), further in view of Maeder (US20170029850A1, published on 02/02/2017) and Yusa (WO2015040075A1 published on 03/26/2015).
The teachings of Jain (2017), Finn (2018), and Ryals (2020) have been discussed above as applied to claims 1-4, 9-12, 32-33, 36. None of Jain, Finn, and Ryals teaches the target site of a guide RNA comprising a nucleotide sequence of SEQ ID NO: 65, the guide RNA sequence comprising a spacer sequence having a RNA sequence corresponding to SEQ ID NO: 64, or the guide RNA comprising a nucleotide sequence SEQ ID NO: 258.
However, Maeder (2017) teaches a MYOC targeting guide RNA (Page 63, Table 4, myoC-177) with the 20nt DNA strand targeting sequence set forth in SEQ ID NO: 563 matches 100% identity with the claimed SEQ ID NO: 64, which is the reverse complement of the target sequence in the genome set forth in SEQ ID NO: 65. See alignment below,
Query: Instant SEQ ID NO: 64, Sbjct: SEQ ID NO: 563 Maeder.
Query 1 ATGCCAGTATACCTTCAGTG 20
||||||||||||||||||||
Sbjct 1 ATGCCAGTATACCTTCAGTG 20
Query: Instant SEQ ID NO: 64, Sbjct: Reverse Complement of Instant SEQ ID NO: 65.
Query 1 ATGCCAGTATACCTTCAGTG 20
||||||||||||||||||||
Sbjct 1 ATGCCAGTATACCTTCAGTG 20
Maeder further teaches in Example 1 that “any gRNA scaffold (e.g. including everything except the targeting domain, e.g., including sequences derived from the crRNA and tracrRNA)” “may be used to create gRNAs compatible with Cas9s from any bacterial species” (Page 489, ¶[1664], first 4 lines and last 2 lines) to construct the functional guide RNAs. Maeder further teaches using LNPs for non-viral delivery of the claimed CRISPR/Cas gene editing system (Page 481, ¶[1551] and ¶[1554], lines 10-16).
Maeder does not teach the specific gRNA scaffold that forms the full guide RNA sequence that comprises the spacer sequence having an RNA sequence corresponding to the claimed SEQ ID NO: 64.
However, Yusa (2015) teaches a 77nt gRNA scaffold sequence in SEQ ID NO: 2 (Page 6), which matched 100% identity with the 77nt gRNA scaffold portion of the claimed gRNA sequence set forth in SEQ ID NO: 258. See sequence alignment below:
Query: SEQ ID NO: 2, Yusa. Sbjct: Instant SEQ ID NO: 258.
Query 1 GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 21 GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT 80
Query 61 GGCACCGAGTCGGTGCT 77
|||||||||||||||||
Sbjct 81 GGCACCGAGTCGGTGCT 97
Combining the gRNA 20nt spacer sequence of Maeder (SEQ ID NO: 563) with the 77nt gRNA scaffold sequence of Yusa makes a full size 97nt gRNA sequence that matches 100% identity with the claimed SEQ ID NO: 258:
Query: Combined SEQ ID NO: 563 (Maeder) and SEQ ID NO: 2 (Yusa). Sbjct: Instant SEQ ID NO: 258.
Query 1 ATGCCAGTATACCTTCAGTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1 ATGCCAGTATACCTTCAGTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTC 60
Query 61 CGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT 97
|||||||||||||||||||||||||||||||||||||
Sbjct 61 CGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT 97
It would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have combined the LNP delivery strategies taught by Jain (2017), Finn (2018), and Ryals (2020), the MYOC targeting gRNA spacer sequences, taught by Maeder (2017), which indirectly teaches the MYOC target sequence, and the gRNA scaffold sequence taught by Yusa (2015), to formulate a CRISPR/Cas gene editing system targeting MYOC. It would have merely amounted to a simple combination of prior art elements according to known methods to yield predictable results. One would have been motivated to do so because Finn (2018) teaches that LNPs offer numerous benefits over viral vectors, as discussed above. One would have reasonable expectation of success because both CRISPR/Cas gene editing methods work through the same molecular mechanism. Furthermore, successful LNP-based gene editing in vivo using different species of animals (Finn, Page 2228, Abstract, mice and Rats) and Ryals’s teachings confirm the feasibility of delivering LNPs to cells of the eye of a subject, further boosting the reasonable expectation of success because of the identical target and route as Jain and Maeder.
Regarding claims 13, 16, 17, since the 20nt spacer sequence of a guide RNA (gRNA) is the reverse complement sequence of the DNA target sequence, like SEQ ID NOs: 64 and 65 (see alignment above), a gRNA targeting MYOC with a spacer sequence set forth in SEQ ID NO: 64 is known in the art as Maeder teaches the identical spacer sequence in SEQ ID NO: 563, which indirectly teaches a genomic target sequence set forth in the claimed SEQ ID NO: 65.
Regarding claim 21, since Maeder already teaches that any gRNA scaffold sequence compatible with Cas9 can be used with the known spacer sequences to construct the fullsize gRNA sequence (Page 481, ¶[1551] and ¶[1554], lines 10-16). At least one combination embodiment set forth above in the SEQ ID NO: 563 (Maeder) and SEQ ID NO: 2 (Yusa) combination teaches the identical full-size 97nt MYOC targeting gRNA sequence that matches 100% identity with the claimed SEQ ID NO: 258.
Claim 22, 23, 29 are rejected under 35 U.S.C. 103 as being unpatentable over Jain (2017), in view of Finn (2018), Ryals (2020), and further in view of Love (Proc Natl Acad Sci U S A. 2010;107(5): 1864-9).
The teachings of Jain (2017), Finn (2018), and Ryals (2020) have been discussed above as applied to claims 1-4, 9-13, 16-17, 21, 32-33, 36. None of Jain, Finn, and Ryals teaches the limitations:
(Claim 22) the method of claim 1, “wherein a LNP of the plurality of LNPs comprises an ionizable cationic lipid, a helper lipid, a sterol, and a poly (ethylene glycol)-lipid (PEG-lipid), and wherein the ionizable cationic lipid is C12-200; the helper lipid is 1,2-distearoyl-sn-glycero-3- phosphocholine (DSPC); the sterol is cholesterol; and/or the PEG-lipid is DMG-PEG”;
(Claim 23) the method of claim 22, “wherein the LNP comprises about 20-60% the ionizable lipids, about 18.5% to 60% the sterol, about 0.01 to 30% the helper lipid, and/or about 0%-10% PEG-lipid”; or
(Claim 29) the method of claim 1, “wherein a LNP of the plurality of LNPs comprises about 50 mol% of C12-200, about 10 mol% of DSPC, about 37.0-39.5 mol% of cholesterol, and about 0.5-3.0% of DMG-PEG;
However, Love (2010) teaches that “C12-200, distearoyl phosphatidylcholine (DSPC), cholesterol and mPEG2000-DMG were solubilized in 90% ethanol at a molar ratio of 50∶10∶38.5∶1.5” (Page 1868, right column, lines 7-9). Since the total molar ratios add up to 100 (50+10+38.5+1.5=100), the composition of each component can be interpreted as percentage of 50% or 50mol% for C12-200, which is within the claimed range of 20-60% for the ionizable lipids; 10% or 10mol% for DSPC, which is within the claimed range of 0.01% to 30% for the helper lipid, 38.5% or 38.5mol% for cholesterol, which is within the claimed range of 18.5% to 60% the sterol or 37.0-39.5mol% of cholesterol; 1.5% for mPEG2000-DMG, which is within the range of 0%-10% PEG-lipid or 0.5-3.0% for DMG-PEG. Hence, Love (2010) teaches all the above limitations in view of Jain (2017), Finn (2018), and Ryals (2020).
It would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have modified the method of delivering CRISPR/Cas gene editing system to the cells of the eye of a subject … taught by Jain, Finn and Ryals using the compositions and methods of fabricating the LNPs taught by Love (2010). It would have merely amounted to a simple combination of prior art elements according to known methods to yield predictable results. One would have been motivated to do so because Finn (2018) teaches that LNPs offer numerous benefits over viral vectors, as discussed above (Page 2228, right column, 3rd ¶). One would have reasonable expectation of success because the congruent teachings of all prior arts and the successful LNP-based gene editing in vivo using different species of animals (Finn, Page 2228, Abstract, mice and Rats).
Claim 37 is rejected under 35 U.S.C. 103 as being unpatentable over Jain (2017), in view of Finn (2018), Ryals (2020), and further in view of Charkraborty (US20190256829A1, published 08/22/2019).
The teachings of Jain (2017), Finn (2018), and Ryals (2020) have been discussed above as applied to claims 1-4, 9-13, 16-17, 21-23, 29, 32-33, 36. None of Jain, Finn, and Ryals teaches the limitation on the method of claim 1, “wherein the LNPs are complexed with (a) … and (b) … separately, or wherein the LNPs complexed with (a) … or the LNPs complexed with (b) … are different LNPs”.
However, Charkraborty (2019) teaches that "a Cas9 mRNA, and sgRNA are either each formulated into separate lipid nanoparticles or all co-formulated into a lipid nanoparticle..." (Claim 38). Since it is a known alternative LNP complexing strategy in the art, it would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have modified the method of delivering CRISPR/Cas gene editing system to the cells of the eye of a subject taught by Jain, Finn and Ryals using the alternative method of complexing the LNPs taught by Charkraborty (2019). It would have merely amounted to a simple substitution of prior art elements based on known methods to yield predictable results. One would have been motivated to do so because complexing the endonuclease and gRNA separately allows flexibility in optimizing the nuclease:gRNA ratio given the major differences in molecular size and charge for endonuclease mRNA and gRNAs. One would have reasonable expectation of success because the congruent teachings of all prior arts and the simple fact that LNP-based gene editing involving either co-complexing in the same particle or in different particles works the same way.
Non-Statutory Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
US Patent US12263227B2
Claims 1-4, 9-12, 32-33, 36 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-18 of U.S. Patent No. US12263227B2, in view of Jain (2017). Although the claims at issue are not identical, they are not patentably distinct from each other.
US12263227B2 teaches novel lipid nanoparticle (LNP)-based compositions useful for, e.g., the delivery of a site-specific endonuclease or a nucleic acid molecule encoding same, into a target cell (Front page, Abstract). US12263227B2 does not teach a method for delivering a CRISPR/Cas-mediated gene editing system to cells of the eye of a subject…, thereby reducing the expression of the target gene in cells of the eye of the subject.
However, the teachings of Jain (2017), already discussed above in the §103 rejection, provide guidance, examples, and motivations to replace the adenoviral format of delivery of a viral CRISPR/Cas gene editing system with an RNA format of an equivalent system packaged in LNPs because US12263227B2’s teaching that LNPs “can improve stability and allow for efficient delivery of such biomolecules into living cells and tissues” (Page 2, column 2, first 3 lines).
It would have been obvious for PHOSITAs before the effective filing date of the claimed invention to have modified the method of delivering CRISPR/Cas gene editing system to the cells of the eye of a subject … taught by Jain using the compositions and methods of fabricating the LNPs taught by US12263227B2. It would have merely amounted to a simple combination of prior art elements according to known methods to yield predictable results. One would have been motivated to do so because US12263227B2 teaches that LNPs offer numerous benefits over viral vectors such as improved stability in cells. One would have reasonable expectation of success because the congruent teachings of all prior arts and the successful LNP-based gene editing in vivo by US12263227B2 (Examples 2, 3, 6).
Claims 1-4, 9-12, 32-33, 36 correspond to the claims 1-18 of US12263227B2.
US Patents
US12644123B2, US12037616B2, US11578309B2, US11591381B2, US12188060B2, US11118196B2, US11116797B2, US12203110B2, US12215320B2, US11166985B2, US11118177B2, US11072792B2, US10995328B2, US11529427B2, US11578323B2, US10724052B2, US11559588B2, US11920148B2, US11407997B2, US11827877B2, US11459587B2, US11801313B2, US11427838B2, US11564997B2, US11174469B2, US11268077B2, US11566236B2, US10662425B2, US11083799B2, US11851653B2, US11369692B2, US11866727B2 (Hereinafter, USPATs)
Claims 1-4, 9-12, 32-33, 36 are rejected on the ground of nonstatutory double patenting as being unpatentable over USPATs, in view of Jain (2017), further in view of Duan (Front Genet. 2021;12: 673286). Although the claims at issue are not identical, they are not patentably distinct from each other.
USPATs teach using lipid nanoparticle (LNP)-based compositions useful for, e.g., the delivery of a site-specific endonuclease or a nucleic acid molecule encoding same, into a target cell. USPATs do not teach a method for delivering a CRISPR/Cas-mediated gene editing system to cells of the eye of a subject…, thereby reducing the expression of the target gene in cells of the eye of the subject.
However, the teachings of Jain (2017), already discussed above in the §103 rejection, provide guidance, examples, and motivations to replace the adenoviral format of delivery of a viral CRISPR/Cas gene editing system with an RNA format of an equivalent system packaged in LNPs because Duan (2021) teaches that there are well understood mechanisms maintaining the stability of the RNA cargos in cells when encapsulated in LNPs, showing great promise for therapeutic applications (Page 1, Abstract, line 7; Page 9, Conclusions).
It would have been obvious for PHOSITAs before the effective filing date of the claimed invention to have modified the method of delivering CRISPR/Cas gene editing system to the cells of the eye of a subject … taught by Jain using the compositions and methods of fabricating the LNPs taught by USPATs. It would have merely amounted to a simple combination of prior art elements according to known methods to yield predictable results. One would have been motivated to do so because Duan teaches that LNPs offer numerous benefits over viral vectors such as improved stability in cells. One would have reasonable expectation of success because the congruent teachings of all prior arts and the successful LNP-based gene editing in vitro by USPATs.
Claims 1-4, 9-12, 32-33, 36 correspond to the all claims of USPATs.
US Applications: 19/064068, 19/041857, 18/885643, 18/877012, 18/336961, 17/489218, 17/437915, 17/286276, 16/488149, 15/550951 (Hereinafter, USapps)
Claims 1-4, 9-12, 32-33, 36 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over USapps, in view of Jain (2017), further in view of Duan (Front Genet. 2021;12: 673286). Although the claims at issue are not identical, they are not patentably distinct from each other.
USapps teach using lipid nanoparticle (LNP)-based compositions useful for, e.g., the delivery of a site-specific endonuclease or a nucleic acid molecule encoding same, into a target cell. USapps do not teach a method for delivering a CRISPR/Cas-mediated gene editing system to cells of the eye of a subject…, thereby reducing the expression of the target gene in cells of the eye of the subject.
However, the teachings of Jain (2017), already discussed above in the §103 rejection, provide guidance, examples, and motivations to replace the adenoviral format of delivery of a viral CRISPR/Cas gene editing system with an RNA format of an equivalent system packaged in LNPs because Duan (2021) teaches well understood mechanisms maintaining the stability of the RNA cargos in cells when encapsulated in LNPs, showing great promise for therapeutic applications (Page 1, Abstract, line 7; Page 9, Conclusions).
It would have been obvious for PHOSITAs before the effective filing date of the claimed invention to have modified the method of delivering CRISPR/Cas gene editing system to the cells of the eye of a subject … taught by Jain using the compositions and methods of fabricating the LNPs taught by USPATs. It would have merely amounted to a simple combination of prior art elements according to known methods to yield predictable results. One would have been motivated to do so because Duan teaches that LNPs offer numerous benefits over viral vectors such as improved stability in cells. One would have reasonable expectation of success because the congruent teachings of all prior arts and the successful LNP-based gene editing in vitro by USapps.
Claims 1-4, 9-12, 32-33, 36 correspond to the all claims of USapps.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Conclusion
No claims are allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Delphinus D. Yu whose telephone number (571) 272-1576. The examiner can normally be reached Mon-Thr 7:30am to 4:30pm Fri 10am to 2pm ET.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil P Hammell can be reached on (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/DELPHINUS DOU YI YU/Examiner, Art Unit 1636
/NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636