Prosecution Insights
Last updated: September 17, 2026
Application No. 18/339,842

TREATMENT OF HYPERBILIRUBINEMIA

Final Rejection §112§DP
Filed
Jun 22, 2023
Priority
Apr 25, 2014 — EU 14305622.4 +4 more
Examiner
SINGH, ANOOP KUMAR
Art Unit
1632
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
International Centre For Genetic Engineering And Biotechnology
OA Round
4 (Final)
43%
Grant Probability
Moderate
5-6
OA Rounds
11m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 43% of resolved cases
43%
Career Allowance Rate
309 granted / 719 resolved
-17.0% vs TC avg
Strong +68% interview lift
Without
With
+67.5%
Interview Lift
resolved cases with interview
Typical timeline
4y 2m
Avg Prosecution
63 currently pending
Career history
782
Total Applications
across all art units

Statute-Specific Performance

§101
3.9%
-36.1% vs TC avg
§103
35.0%
-5.0% vs TC avg
§102
12.7%
-27.3% vs TC avg
§112
32.7%
-7.3% vs TC avg
Black line = Tech Center average estimate • Based on career data from 719 resolved cases

Office Action

§112 §DP
DETAILED ACTION The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicant’s amendments to the claims and arguments filed on April 14, 2026 have been received and entered. Claim 1 has been amended, while claims 13-14 are canceled. Claims 1-12 are pending in the instant application. Priority This application is a continuation of US application no 16/553,235 filed on 08/28/2019 that is a Continuation of US application no 15/303,834 filed on 10/13/2016, which is a 371 of PCT/EP2015/059099 filed on 04/27/2015 that claims priority from foreign applications EP 14305622.4 filed on 04/25/2014 and EP 14196400.7 filed on 12/04/2014. Claims 1-12 are under consideration. Withdrawn Claim Rejections - 35 USC § 112-new matter Claims 1, 3-13 were rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. Applicant’s amendments to the base claim deleting the phrase consists of the elimination of ATG start codons at positions 308-310 and 363-364 of SEQ ID NO:5 by way of nucleotide substitution(s), previous rejection of claim is hereby withdrawn. Applicants’ arguments with respect to the withdrawn rejections are thereby rendered moot. Withdrawn -Claim Rejections - 35 USC § 112 Claim 13 was rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. Applicants’ cancellation of claim 13 renders its rejections moot. Withdrawn-Claim Rejections - 35 USC § 112 Claim 2 was rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Applicants’ cancellation of claim 2 renders its rejections moot. Maintained-Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1, 3-12 remain rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-20 of U.S. Patent No. 11339406 and Kay et al (WO/2007/120533, 10/25/2007, art of record). Although the claims at issue are not identical, they are not patentably distinct from each other because the claimed modified HBB2 intron is structurally and functionally same as one encompassed by the claims in ‘406. In the instant case, claims are directed to an intron which is a modified HBB2 intron as compared to the HBB2 intron shown in SEQ ID NO:5, wherein the modification consists of SEQ ID NO:6. Claim 3 is directed to a nucleic acid construct comprising the intron according to claim 1, further comprising a transgene and one or more additional expression control sequences, and wherein the said additional expression control sequence is a ubiquitous or tissue-specific promoter. Claim 6 is directed to a vector comprising the intron according to claim 1, which is a viral vector (claim 7), wherein said viral vector is a single-stranded or double-stranded self-complementary AAV vector, wherein the AAV vector has an AAV-derived capsid subsequently limiting to an AAV8 capsid that is a pseudotyped AAV vector. Claim 12 is directed to a cell transformed with the nucleic acid construct according to claim 3.. In contrast, claims in ‘406 are directed to a recombinant adeno-associated virus (AAV) vector comprising an expression cassette, said expression cassette comprising a nucleic acid molecule encoding a truncated human acid alpha-glucosidase (hGAA) polypeptide, wherein said nucleic acid molecule is operably linked to a promoter and wherein said expression cassette optionally comprises an intron (claim 12), wherein the intron is a HBB2 intron that comprises SEQ ID NO: 22 to SEQ ID NO: 26. It is noted that SEQ ID NO: 6 of instant application is encompassed by SEQ ID NO: 22-26 of ‘406. The claims in '406 differs from claimed invention by not disclosing nucleic acid comprising the modified intron is part of AAV that is AAV8 or isolate Hbb2 intron. It would be obvious for one of ordinary skill in the art seeking to study the role of intron to increase mRNA stability and the production of the protein would isolate HBB2 intron from the construct disclosed in ‘406 with reasonable expectation of success. Further, Kay cures the deficiency by teaching a nucleic acid comprising modified intron could be incorporated in AAV vector more specifically an scAAV or more preferably and AAV8 vector (see page 12, lines 29-34) comprising said modified intron and a therapeutic sequence under the control of a liver-specific promoter to express gene of interest in a liver cell (see figure 3, pages 12, lines 19-24, page 16, lines 9-11 and claims 1-15, example 2). Kay teaches a method of expressing said nucleic acid vector in a subject in need thereof (see claim 8-14, example 2). Therefore, it would have been obvious to one of ordinary skill in the art to isolate the modified intron from the construct and incorporate the construct comprising modified intron as disclosed in '406 to in an AAV or AAV8 vector for expressing said nucleic acid vector in a subject in need thereof as disclosed in Kay. Query Match 100.0%; Score 441; Length 4198; Best Local Similarity 100.0%; Matches 441; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 831 GTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTT 890 Qy 61 CTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 891 CTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCA 950 Qy 121 GGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 951 GGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATA 1010 Qy 181 ATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTTCTGCATATAAATTGT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1011 ATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTTCTGCATATAAATTGT 1070 Qy 241 AACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1071 AACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTT 1130 Qy 301 TTATTTTCTGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1131 TTATTTTCTGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAA 1190 Qy 361 TCTTGTTCATACCTCTTATCTTCCTCCCACAGCTCCTGGGCAACCTGCTGGTCTCTCTGC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1191 TCTTGTTCATACCTCTTATCTTCCTCCCACAGCTCCTGGGCAACCTGCTGGTCTCTCTGC 1250 Qy 421 TGGCCCATCACTTTGGCAAAG 441 ||||||||||||||||||||| Db 1251 TGGCCCATCACTTTGGCAAAG 1271 Response to arguments Applicant disagree with the rejection arguing the claims of the present application would not extend the protection of the same invention claimed within the '406 patent nor is there any evidence of record (that qualifies as prior art) that establishes that the claimed invention is an obvious variation. Applicants’ arguments have been fully considered, but are not found persuasive. In response, it is noted that claims 3-9, 11 and 12 are broad and directed to a nucleic acid encoding construct comprising the intron of the invention, further comprising any transgene and one or more additional expression control sequence. Dependent claims limit the tissue specific or ubiquitous promoter. Claims are also directed to any vector comprising the intron of the invention, wherein the vector is a viral vector or ssAAV vector. In contrast, claims in ‘406 directed to a recombinant adeno-associated virus (AAV) vector comprising an expression cassette, said expression cassette comprising a nucleic acid molecule encoding a transgene (truncated human acid alpha-glucosidase (hGAA) polypeptide, said truncated hGAA polypeptide), wherein said nucleic acid molecule is operably linked to a promoter (claim 9) , wherein said promoter is a liver-specific promoter (claims 10-11), wherein expression cassette comprises a HBB2 intron (claim 14), wherein said DNA construct comprises the nucleic acid of SEQ ID NO: 22-26 claim 15). It is noted that claims 22-26 encompass hbb2 intron set forth in SEQ ID NO: 6. As such, the ‘406 claims represent a species of the instant broader claims 3-9, 11 and 12. It is well established that a species of a claimed invention renders the genus obvious. In re Schaumann, 572 F.2d 312, 197 USPQ 5 (CCPA 1978). Regarding claims 1 and 10 of instant application, it would have been obvious to one of ordinary skill in the art to modify the rAAV of ‘406 by using AAV8 vector as disclosed in Kay, with reasonable expectation of success. One of ordinary skill in the art would be motivated to do so because prior art teaches AAV8 vector is more efficient at gene transfer in vivo than AA V-2 vectors (see page 12, lines 29-33 of Kay). It would have been further obvious to one of ordinary skill in the art seeking to study the role of intron to increase mRNA stability and the production of the protein would be motivated to isolate HBB2 intron from the construct disclosed in ‘406 with reasonable expectation of success. Therefore, in view of the fact patterns of the instant case, and the ground of rejection outlined by the examiner, applicants' arguments are not compelling and do not overcome the rejection of record. Conclusion No claims allowed. bacpacresources.org/library. php?id=107), 2007 teaches pTARBAC2.1 vector map: PNG media_image1.png 682 700 media_image1.png Greyscale THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ANOOP K. SINGH whose telephone number is (571)272-3306. The examiner can normally be reached Monday-Friday, 8AM-5PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Peter Paras can be reached at (571)272-4517. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ANOOP K SINGH/Primary Examiner, Art Unit 1632
Read full office action

Prosecution Timeline

Show 3 earlier events
Apr 01, 2025
Final Rejection mailed — §112, §DP
Jul 30, 2025
Response after Non-Final Action
Sep 23, 2025
Request for Continued Examination
Oct 02, 2025
Response after Non-Final Action
Jan 14, 2026
Non-Final Rejection mailed — §112, §DP
Apr 14, 2026
Response Filed
Jun 10, 2026
Examiner Interview (Telephonic)
Jun 24, 2026
Final Rejection mailed — §112, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12703852
HEMATOPOIETIC PROGENITOR CELL MARKER
6y 9m to grant Granted Aug 11, 2026
Patent 12696885
CELLS, VERTEBRATES, POPULATIONS & METHODS
6y 7m to grant Granted Aug 04, 2026
Patent 12680078
DIFFERENTIATION OF PLURIPOTENT STEM CELLS AND CARDIAC PROGENITOR CELLS INTO STRIATED CARDIOMYOCYTE FIBERS USING LAMININS LN-511, LN-521 AND LN-221
8y 0m to grant Granted Jul 14, 2026
Patent 12680083
MEDIA FOR CULTURING NAIVE HUMAN PLURIPOTENT STEM CELLS
2y 5m to grant Granted Jul 14, 2026
Patent 12624352
DNA-RESPONSIVE HYDROGELS, METHODS OF ALTERING A PROPERTY OF A HYDROGEL, AND APPLICATIONS THEREOF
6y 3m to grant Granted May 12, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

5-6
Expected OA Rounds
43%
Grant Probability
99%
With Interview (+67.5%)
4y 2m (~11m remaining)
Median Time to Grant
High
PTA Risk
Based on 719 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month