Prosecution Insights
Last updated: April 19, 2026
Application No. 18/339,842

TREATMENT OF HYPERBILIRUBINEMIA

Non-Final OA §102§103§112§DP
Filed
Jun 22, 2023
Examiner
SINGH, ANOOP KUMAR
Art Unit
1632
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
International Centre For Genetic Engineering And Biotechnology
OA Round
3 (Non-Final)
43%
Grant Probability
Moderate
3-4
OA Rounds
4y 6m
To Grant
99%
With Interview

Examiner Intelligence

Grants 43% of resolved cases
43%
Career Allow Rate
304 granted / 709 resolved
-17.1% vs TC avg
Strong +68% interview lift
Without
With
+67.6%
Interview Lift
resolved cases with interview
Typical timeline
4y 6m
Avg Prosecution
59 currently pending
Career history
768
Total Applications
across all art units

Statute-Specific Performance

§101
3.5%
-36.5% vs TC avg
§103
36.1%
-3.9% vs TC avg
§102
15.7%
-24.3% vs TC avg
§112
29.4%
-10.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 709 resolved cases

Office Action

§102 §103 §112 §DP
DETAILED ACTION The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 09/23/2025 has been entered. Applicant’s amendments to the claims and arguments filed on July 30, 2025 have been received and entered. Claim 1 has been amended, while claim 14 is canceled. Claims 1-13 are pending in the instant application. Priority This application is a continuation of US application no 16/553,235 filed on 08/28/2019 that is a Continuation of US application no 15/303,834 filed on 10/13/2016, which is a 371 of PCT/EP2015/059099 filed on 04/27/2015 that claims priority from foreign applications EP 14305622.4 filed on 04/25/2014 and EP 14196400.7 filed on 12/04/2014. Claims 1-13 are under consideration. Withdrawn-Claim Rejections - 35 USC § 102 Claims 1, 3-13 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Samulski (WO2006119137, dated 11/09/2006) or USPGPUB US20100196335A1). In view of Applicants’ amendment of base claim 1, introducing the limitation wherein the modification consists of the elimination of ATG start codons at positions 308-310 and 363-364 of SEQ ID NO:5 by way of nucleotide substitution(s), that is not taught by Samulski, the previous rejection is rendered moot and hereby withdrawn. Claims 1, 3-4, 6 and 12 were rejected under 35 U.S.C. 102(a)(1) as being anticipated by accession number EI402174 (Feb, 7, 2014 see sequence search results) as evidenced by CHORI-252: Vervet Monkey BAC Library using Vector pTARBAC2.1 (bacpacresources.org/library. php?id=107), 2007). In view of Applicants’ amendment of base claim 1, introducing the limitation wherein the modification consists of the elimination of ATG start codons at positions 308-310 and 363-364 of SEQ ID NO:5 by way of nucleotide substitutions, that is not taught by Samulski, the previous rejection is rendered moot and hereby withdrawn. Withdrawn-Claim Rejections - 35 USC § 103 Claims 1 and 2 are rejected under 35 U.S.C. 103 as being unpatentable over Samulski (WO2006119137, dated 11/09/2006) or USPGPUB US20100196335A1) as evidenced by Saito et al (US 9458466, EFD 7/16/2013) and Son (Journal of Biological Chemistry, 2003, 278, 18037-18044, IDS). In view of Applicants’ amendment of base claim 1, introducing the limitation wherein the modification consists of the elimination of ATG start codons at positions 308-310 and 363-364 of SEQ ID NO:5 by way of nucleotide substitution(s), that is not taught by Samulski, the previous rejection is rendered moot and hereby withdrawn. New-Claim Rejections - 35 USC § 112- necessitated by amendments The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1, 3-13 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. In the instant case, the recitation of limitation “..wherein the modification consists of the elimination of ATG start codons at positions 308-310 and 363-364 of SEQ ID NO:5 by way of nucleotide substitution(s).” (claim 1) is considered new matter. Applicants point to original filed claims for the specific support of the claimed amendment. However, upon further review of the instant specification, examiner could not find support for the modification consists of the elimination of ATG start codons at positions 308-310 and 363-364 of SEQ ID NO:5 by way of nucleotide substitution(s). There is no explicit or implicit support for using a modification consists of the elimination of ATG start codons at positions 308-310 and 363-364 of SEQ ID NO:5 by way of nucleotide substitution(s). It should be further noted that a sequence search of SEQ ID NO:5 shows only AT at position 363-364 and not an ATG as required by the claim. In fact, contrary to applicants' assertions, instant specification directly supports to a modified intron consisting of SEQ ID NO: 6 (includes elimination of ATG and GTG by nucleotide substitution) as compared to the HBB2 intron as set forth in SEQ ID NO: 5. There is no support for a modification consisting of elimination of the ATG start codon only at 308-310 and 363-364 of SEQ ID NO:5 by way of nucleotide substitution Thus, at the time the application was filed, an Artisan of skill would not recognize from the disclosure that Applicant was in possession of the modification consists of the elimination of ATG start codons at positions 308-310 and 363-364 of SEQ ID NO:5, as claimed. MPEP 2163.06 notes “If new matter is added to the claims, the examiner should reject the claims under 35 U.S.C. 112, first paragraph-written description requirement”. In re Rasmussen, 650 F.2d 1212, 211 USPQ 323 (CCPA 1981). In case if applicants have evidence to support otherwise, applicants are invited to indicate page and line number for the written support specifically for the modification consists of the elimination of ATG start codons at positions 308-310 and 363-364 of SEQ ID NO:5. Dependent claims are included in the rejection because they directly or indirectly depend from the rejected base claim. This is a new matter rejection. New-Claim Rejections - 35 USC § 112- necessitated by amendments The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claim 13 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention. In determining whether Applicant’s claims are enabled, it must be found that one of skill in the art at the time of invention by applicant would not have had to perform “undue experimentation” to make and/or use the invention claimed. Such a determination is not a simple factual consideration, but is a conclusion reached by weighing at least eight factors as set forth in In re Wands, 858 F.2d at 737, 8 USPQ 1400, 2d at 1404. Such factors are: (1) The breadth of the claims; (2) The nature of the invention; (3) The state of the art; (4) The level of one of ordinary skill in the art; (5) The level of predictability in the art; (6) The amount of direction and guidance provided by Applicant; (7) The existence of working examples; and (8) The quantity of experimentation needed to make and/or use the invention. The office has analyzed the specification in direct accordance to the factors outlines in In re Wands. MPEP 2164.04 states: “[W]hile the analysis and conclusion of a lack of enablement are based on factors discussed in MPEP 2164.01(a) and the evidence as whole, it is not necessary to discuss each factor in written enablement rejection.” These factors will be analyzed, in turn, to demonstrate that one of ordinary skill in the art would have had to perform “undue experimentation” to make and/or use the invention and therefore, applicant’s claims are not enabled. Nature of the Invention: Claim is directed to a method of gene or cell therapy in a subject comprising expressing a nucleic acid construct comprising a nucleic acid construct comprising an intron which is a modified HBB2 intron. as compared to the HBB2 intron shown in SEQ ID NO:5, wherein the modification consists of the elimination of ATG start codons at positions 308-310 and 363-364 of SEQ ID NO:5 by way of nucleotide substitution(s).substitutions and further comprising a transgene and one or more additional expression control sequences. Breadth of the claims: The claim is directed to a method of gene or cell therapy in a subject by expressing any nucleic acid construct comprising an intron which is a modified HBB2 intron. as compared to the HBB2 intron shown in SEQ ID NO:5, wherein the modification consists of the elimination of ATG start codons at positions 308-310 and 363-364 of SEQ ID NO:5 by way of nucleotide substitution(s).substitutions and further comprising a transgene and one or more additional expression control sequences for some known or yet to be identified condition for therapeutic purposes in order for it to be a gene or cell therapy. The claims are broadly directed to an in vivo or ex vivo therapy of any subject in need thereof by expressing any transgene by administering a nucleic acid construct of the invention via any route and to any site. It is noted that breadth of instant claims does not limit a therapeutic, palliative or preventive treatment of any disease, condition, or disorder of any specific stage, thus embrace early as well as late stage of any disease or disorder as broadly claimed in human patients, It is relevant to note that cell use for administration is a nucleic acid that does not include any a therapeutic gene and therefore the claims as presented is not enabled for any therapy as broadly encompassed by the claim. Further, claim encompasses, transplanting autologous, allogeneic or xenogeneic transplantation of any cell modified with the construct of the invention via any route. Guidance of the Specification and The Existence of Working Examples: The instant specification teaches a modified intron, in particular a modified HBB2 intron, has advantageous properties and can significantly improve the expression of the transgene (see page 4). The specification contemplates using a cell comprising the modified intron of the invention, and further comprising a therapeutic gene of interest, for use in gene therapy. The specification prophetically contemplates that instant invention may generally be applied for therapy of any disease that may be treated by expression of a therapeutic gene in a cell or tissue of a subject. These include, for example, proliferative diseases (cancers, tumors, dysplasias, etc.); infectious diseases; viral diseases (induced, e.g., by the Hepatitis B or C viruses, HIV, herpes, retroviruses, etc.); genetic diseases (cystic fibrosis, dystroglycanopathies, myopathies such as Duchenne Muscular Myopathy; myotubular nyopathy; hemophilias; sickle-cell anemia, sickle cell disease, Fanconi's anemia; diabetes; amyotrophic lateral sclerosis, mononeurones diseases such as spinal muscular atrophy, spinobulbar muscular atrophy, or Charcot-Marie- Tooth disease; arthritis; severe combined immunodeficiencies (such as RS-SCID, ADA- SCID or X-SCID), Wiskott-Aldrich syndrome , X-linked thrombocytopenia, X-linked congenital neutropenia, Chronic granulornatous disease, etc.); cardiovascular diseases (restenosis, ischemia, dyslipidemia, homozygous familial hypercholesterolemia, etc.); neurological diseases (psychiatric diseases, neurodegenerative diseases such as Parkinson's or Alzheimer's, Huntington's disease addictions (e.g., to tobacco, alcohol, or drugs), epilepsy, Canavan's disease, adrenoleukodystrophy, etc.); eye diseases such as retinitis pigmentosa, Leber congenital amaurosis, Leber hereditary optic neuropathy, Stargardt disease; lysosomal storage diseases such as San Filippo syndrome; and hyperbilirubinemia such as CN type I or15 II or Gilbers syndrome, Pompe disease, etc. The specification discloses nucleic acid construct comprising the modified intron, the cell comprising said construct or said vector may further be used in cell therapy when the gene of interest is a therapeutic gene as defined above (see page 5, line 19-page 6). The guidance provided in the specification is limited to levels of messenger RNA observed in Huh-7 cells transfected with plasmid expressing wild-type UGT1A1 or two codon optimized UGT1A1 sequences (panel A) and the quantification by western blot of UGT1A1 protein in the same samples (panel B) (figure 1, example). Figures 2 and 3 shows the effect of different intron optimization in the expression of luciferase (panel A) and the effect of HBB2 optimization on UGTlAI RNA and protein expression level (panel B). The working examples provided by the specification do not correlate to any gene or cell therapy in any subject intended for any therapeutic purpose. It is relevant to note that none of the claim require delivery of any transgene and therefore claim as presented is not enabled for any gene or cell therapy. Given the lack of guidance provided by the specification it would have required undue experimentation for one of skill in the art to practice the invention as claimed without a reasonable expectation of success. Applicant example only provides an invitation to one of skill in the art without disclosing any specifics as to how to administer to any subject in need thereof the any nucleic acid construct encoding known or yet to be identified gene in vivo or in a differentiated (somatic) or undifferentiated cell derived from any subject to treat broad class of disease of different etiology and pathology to make and use the invention, without reasonable expectation of success. State of the Art and Predictability of the Art and the Amount of Experimentation Necessary: The state of art before the effective filing date of instant application, describe progress and failures in achieving desired effects after human gene therapy (see Geng et al 2025, Lancet, 118, 1- 12, page 10, col. 1, para. 3, col. 2Kaiser et al, para 580, col. 3, para. 2), suggesting vector targeting in vivo to be unpredictable and inefficient (Kaiser Science, 317, 2007, 580 ). Verma- (Annu Rev Biochem. 2005; 74:711-38) and Geng describes progress made in developing new vectors and also suggest vector targeting in vivo to be unpredictable and inefficient. Verma et al reviews various vectors known in the art for use in gene therapy and problems associated with each implying that at the time of claimed invention resolution to vector targeting had not been achieved in the art (Geng et al page 10, col. 2, para. 2; Verma et al., 2005; entire article). With regard to nucleic acid vectors for gene therapy applications, the prior art effectively addresses the limitations, drawbacks and unpredictability of said vectors. For example, Thomas et al. (Nature Rev.Genet. 4: 346-358; 2003) state: “The ability to accurately predict vector-related side effects at a particular dose is confounded in human studies by the degree of variability between immune responses in different individuals”. …“T-cell responses can still be elicited against the expressed transgene product, particularly if the vectors transduce cells that are robust for antigen presentation, including dendritic cells. The route of vector administration might affect the degree to which dendritic cells are transduced; route of administration has a profound effect on the development of T-cell responses to transgenes that are expressed from AAV vectors. Pre-existing humoral immunity to the parental wild-type viruses is another obstacle that affects all classes of viral vector and circulating virus-neutralizing antibodies could preclude efficient transduction with the viral vector” (col. 2, page 353, last two paragraphs). In specifically addressing the problems associated with the route of administration of AAV vectors, Brockstedt et al (Clinical Immunol. 92:67-75; 1999), observed that “mice injected with a single dose of rAAV developed humoral immunity to the encoded transgene and AAV proteins, regardless of the route of administration” (second column, p. 73, Ronzitti et al, Front of Immunology, 2020, 11, 670, 1-13 ). The authors further observed: “While several factors can contribute to the overall immunogenicity of rAAV vectors, vector design and the total vector dose appear to be responsible of immune-mediated toxicities.” it is further disclosed that rAAV “vectors can trigger both innate and adaptive immune responses” (see abstract of Ronzitti). It is noted that, Prior to instant invention, Hajjar et al (Circ. Res., March 31, 2000; 86(6): 616 – 621) discloses the feasibility of in vivo cardiac gene transfer by viral vector. Hajjar et al disclose intracoronary catheter delivery of an adenovirus encoding ß-galactosidase achieved transduction of ~30% of the myocytes in the distribution of the coronary artery. The highest CTL responses included intravenous administration of AAV (panel C, Fig. 2, p. 71). In the instant case, specification fails to address the issue of cellular immune response following delivery of any vector or AAV encoding any transgene in the heart or other skeletal muscle tissue particularly since art teaches gene transfer to the heart is influenced by other factors such as (i) the use of crystalloid solution as opposed to whole blood, (ii) high coronary flow rate, (iii) exposure time, (iv) virus concentration, and (v) temperature (Donahue et al, Proc. Natl Acad Sci US A. 1997;94: 4664–4668). It is noted that independent claim 13 requires expressing nucleic acid in the subject in need thereof by any means to transduce plurality of heart, skeletal and other muscle cells. Therefore, the therapeutic outcome of a general gene transfer method prophetically described in the specification would not be reasonably correlated to a method set forth in broad independent claim 13. It is not apparent as to how a skilled artisan could carry over these inventions in any subject having a disease of different etiology and pathology by introducing any vector comprising a nucleic acid comprising the modified intron of the invention without undue experimentation. A showing that enough of a nucleic acid encoding protein of interest is expressed in the target cell, enough nucleic acid is incorporated into the target cells, that such nucleic acid is properly incorporated into such cells as DNA, enough mRNA is produced therefrom, and enough protein is produced and enhanced transgene expression have an effect on the target cells and such effect is enough of an effect for a long enough period of time resulting in treating any known or yet to be identified condition in a predictable animal model. There is no evidence on record or any nexus between administering a nucleic acid comprising the modified intron of the invention and any transgene or cell expressing said transgene to achieve desirable efficacy that would effectively target cells for higher expression of transgene in a subject. An artisan would have to perform undue experimentation in order to practice the invention, as quantity of experimentation in this area is extremely large, as there are a significant number of parameters, which would have to be studied and tested to make and definitively show that one is in possession of the method in any subject having any disease or disorder, comprising administering a nucleic acid comprising the modified intron of the invention and any transgene or cell expressing said transgene to achieve desirable efficacy. This would require a significant degree of inventive effort, with each of the many intervening steps, upon effective reduction to practice without reasonable expectation of success in the different steps. The claim broadly embraces administering via any route gene or any number of cells derived from any species into any subject. The claims are clearly interpreted to read on xenotransplantation of any cell for any known or unknown therapy. The state of the art teaches that hepatocytes are typically harvested from livers that are not deemed to be suitable for liver transplant, but these cells are limited in number, variable in quality, and not able to be expanded in vitro. The ability of hepatocytes to effectively repopulate a diseased liver appears to be limited to a select group of disorders that allow a growth advantage to the transplanted cells (such as hereditary tyrosinemia, Wilson disease, or progressive familial intrahepatic cholestasis). Furthermore, these procedures continue to require immunosuppression, and there has been insufficient experience to define the amount and duration of immunosuppression needed in this setting. Lastly, how long these hepatocytes will be viable and the nature of their interaction with native hepatocytes remain unclear (see page 2, last para. Huebert et al Mayo Clin Proc. 2014; 89(3): 414–424, art of record). Mount (Phil. Trans. R. Soc. B, 2015, 370: 1-16, art of record) reported ex vivo and in vivo gene modification are associated with the risk of insertional mutagenesis through activation, silencing or dysregulation of genes. It is disclosed that early trials resulted in leukemias or pre-leukemias in three gene therapy trials of retrovirally modified HSCs (see page 5, col. 2, last para.). Mount assert that risk related to insertional mutagenesis, related to disease background, cell type to be transduced and vector characteristics. Mount continue to teach “therapies using cell plasticity are also considered at a relatively high risk of tumorigenicity, in this case due to the concerns about transfer of remaining pluripotent cells with the differentiated product or genetic abnormalities arising during cell derivation and culture” (see page 7, col. 1, para. 1). The specification fails to characterize any genetically modified cell derived from any species for any therapy. It is relevant to note that, neither instant specification nor prior art provide the fate of any genetically modified cells delivered via any route for therapeutic purpose without delivering any transgene. One of skill in the art would have to perform undue experiment to make and use the invention, without reasonable expectation of success. The claimed invention as recited encompasses autologous, allogeneic as well as xenogeneic transplantation, however, these transplantation methods are not routine. The claimed invention encompasses autologous, allogeneic as well as xenogeneic transplantation, however, these transplantation methods are not routine. The specification does not teach how to address the issues of hyperacute and complement mediation associated with the xenotransplantation of cells. Prior to instant invention, xenogeneic transplantation of cells was not routine. Mount (Phil. Trans. R. Soc. B , 2015, 370: 1-16) reported that “immunogenicity is a challenge to both efficacy and safety as immune rejection of cells will limit their survival and function and adverse immune reactions can result from, or be caused by, transplanted cells. Immunogenicity is influenced by multiple factors including the allelic differences between the product and the patient, the relative immune privilege of the site of administration, the maturation status of the cells, the need for repeat administration and the immune competence of the host (see page 7, col. 1, para. 2). Spangers (Kidney International (2008) 74, 14–21 art of record), reviewing the state of the art of physiologic and immunologic hurdles of xeno transplantation, summarized: that the “proof of principle has been delivered in rodents, induction of pig-to nonhuman primate chimerism remains problematic (abstract). Tomov et al (Neural Regen Res 15(7):1173-1178, 2020, art of record) reported intracerebral dopaminergic transplantation, patients with seemingly functional grafts deteriorated quickly after withdrawal of immunosuppression, with a postmortem finding of extensive microglial infiltration of the grafts (see page 1176, col. 1, last para.). Liu et al (Stem Cell Research & Therapy (2021) 12:376, 1-15, art of record) disclose that most xenograft and allograft experiments used high doses of immunosuppressants throughout the lifespan of the animals or use immunodeficiency animals. However, overdosed immunosuppression or immunodeficiency results in the susceptibility to infections and thus short lifespan of animals, which contrasts to the prolonged time windows required by human neural cells to fully mature and integrate into host brain networks (page 2-Background). The major route of graft rejection occurs via the recognition of foreign protein molecules (e.g., MHC molecules) by the host immune system. The rate at which heterogenous grafts are rejected depends on both MHC disparities and transplantation site ……. there is still quite a lack of knowledge on the immunological graft–host interactions in the central nervous system (CNS). A more precise knowledge about the survival of human neural stem cells in animal brain without immunosuppression, and the mechanisms underlying the rejection in the CNS, may prevent unnecessarily excessive suppression of the immune system in preclinical animal studies, even in patients, warranting the present study (page 2-Background). These references clearly demonstrate the: incompatibility and ultimate rejection of xenografts between donor and host species. In summary at the time of the invention, the art of xenotransplantation was unpredictable and the specification does not provide any guidance how to address the issues of unpredictability in xenotransplantation of cells. It is emphasized that the specification does not provide any guidance as to how would the transplantation of any genetically modified would have been carried out. Thus, the references discussed here provided evidence that cell transplantation would not have been regarded as enabled before the effective filing date for the breadth encompassed and one of ordinary skill in the art would have to determine the condition, route, condition to test genetically modified cells from different tissue in treating plurality of different disease of different etiology and pathology to make and use the invention, without reasonable expectation of success. Such guessing would require extensive and undue experimentation, without reasonable expectation of success. Applicant should note that “case law requires that the disclosure of an application shall inform those skilled in the art how to use applicants’ alleged discovery, not to find out how to use it for themselves.” In re Gardner 166 USPQ 138 (CCPA) 1970. In conclusion, in view of breadth of the claims and absence of a showing by Applicant, in the way of specific guidance and direction, and/or working examples demonstrating the same, such invention as claimed by Applicant is not enabled for the claimed inventions as supported by the observations in the art record. New-Claim Rejections - 35 USC § 112- necessitated by amendments The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claim 2 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. In the instant case, claim 2 limits the claim to the modified HBB2 intron comprises SEQ ID NO: 6 that includes elimination of ATG and GTG from SEQ ID NO: 5 and therefore claim 2 does not further limit the base claim 1 modification that consists of the elimination of only ATG start codon at positions 308 and 363 of SEQ ID NO: 5. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Appropriate correction and/or clarification is required. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1-13 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-20 of U.S. Patent No. 11339406 and Kay et al (WO/2007/120533, 10/25/2007, art of record). Although the claims at issue are not identical, they are not patentably distinct from each other because the claimed modified HBB2 intron is structurally and functionally same as one encompassed by the claims in ‘406. In the instant case, claims are directed to an intron which is a modified HBB2 intron as compared to the HBB2 intron shown in SEQ ID NO:5, wherein the modification consists of the elimination of ATG start codons at positions 308-310 and 363-364 of SEQ ID NO:5 by way of nucleotide substitutions. Dependent claims limit the modified HBB2 intron comprises SEQ ID NO:6, further comprising a transgene and one or more additional expression control sequences, and wherein the said additional expression control sequence is an ubiquitous or tissue-specific promoter. Claim 6 is directed to a vector comprising the intron according to claim 1, which is a viral vector (claim 7), wherein said viral vector is a single-stranded or double-stranded self-complementary AAV vector, wherein the AAV vector has an AAV-derived capsid subsequently limiting to an AAV8 capsid that is a pseudotyped AAV vector. Claim 12 is directed to a cell transformed with the nucleic acid construct according to claim 3. Claim 13 is directed to a method of gene or cell therapy in a subject comprising expressing a nucleic acid construct according to claim 4 in a subject in need of gene or cell therapy. In contrast, claims in ‘406 are directed to a recombinant adeno-associated virus (AAV) vector comprising an expression cassette, said expression cassette comprising a nucleic acid molecule encoding a truncated human acid alpha-glucosidase (hGAA) polypeptide, wherein said nucleic acid molecule is operably linked to a promoter and wherein said expression cassette optionally comprises an intron (claim 12), wherein the intron is a HBB2 intron that comprises SEQ ID NO: 22 to SEQ ID NO: 26. It is noted that SEQ ID NO: 6 of instant application is encompassed by SEQ ID NO: 22-26 of ‘406. The claims in '406 differs from claimed invention by not disclosing nucleic acid comprising the modified intron is part of AAV that is AAV8,. The deficiency is cured by Kay who teaches a nucleic acid comprising modified intron could be incorporated in AAV vector more specifically an scAAV or more preferably and AAV8 vector (see page 12, lines 29-34) comprising said modified intron and a therapeutic sequence under the control of a liver-specific promoter to express gene of interest in a liver cell (see figure 3, pages 12, lines 19-24, page 16, lines 9-11 and claims 1-15, example 2). Kay teaches a method of expressing said nucleic acid vector in a subject in need thereof (see claim 8-14, example 2). Therefore, it would have been obvious to one of ordinary skill in the art to modify the construct comprising modified intron as disclosed in '406 to incorporate in an AAV or AAV8 vector for expressing said nucleic acid vector in a subject in need thereof as disclosed in Kay. Query Match 100.0%; Score 441; Length 4198; Best Local Similarity 100.0%; Matches 441; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 831 GTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTT 890 Qy 61 CTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 891 CTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCA 950 Qy 121 GGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 951 GGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATA 1010 Qy 181 ATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTTCTGCATATAAATTGT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1011 ATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTTCTGCATATAAATTGT 1070 Qy 241 AACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1071 AACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTT 1130 Qy 301 TTATTTTCTGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1131 TTATTTTCTGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAA 1190 Qy 361 TCTTGTTCATACCTCTTATCTTCCTCCCACAGCTCCTGGGCAACCTGCTGGTCTCTCTGC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1191 TCTTGTTCATACCTCTTATCTTCCTCCCACAGCTCCTGGGCAACCTGCTGGTCTCTCTGC 1250 Qy 421 TGGCCCATCACTTTGGCAAAG 441 ||||||||||||||||||||| Db 1251 TGGCCCATCACTTTGGCAAAG 1271 Allowable Subject Matter Should applicant amend the base claim to a nucleic acid construct comprising a modified Hbb2 intron, wherein the modified Hbb2 intron consists of SEQ ID NO: 6, instant rejection may be overcome. Examiner’s note: Applicant’s representative is requested to contact Examiner to resolve the pending issues to put instant application in condition for allowance. Conclusion No claims allowed. bacpacresources.org/library. php?id=107), 2007 teaches pTARBAC2.1 vector map: PNG media_image1.png 682 700 media_image1.png Greyscale Any inquiry concerning this communication or earlier communications from the examiner should be directed to ANOOP K. SINGH whose telephone number is (571)272-3306. The examiner can normally be reached Monday-Friday, 8AM-5PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Peter Paras can be reached at (571)272-4517. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ANOOP K SINGH/ Primary Examiner, Art Unit 1632
Read full office action

Prosecution Timeline

Jun 22, 2023
Application Filed
Aug 10, 2024
Non-Final Rejection — §102, §103, §112
Dec 13, 2024
Response Filed
Mar 26, 2025
Final Rejection — §102, §103, §112
Jul 30, 2025
Response after Non-Final Action
Sep 23, 2025
Request for Continued Examination
Oct 02, 2025
Response after Non-Final Action
Jan 10, 2026
Non-Final Rejection — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12570957
ISOLATED NAIVE PLURIPOTENT STEM CELLS AND METHODS OF GENERATING SAME
2y 5m to grant Granted Mar 10, 2026
Patent 12564645
METHODS FOR TREATMENT OF METHYLMALONIC ACIDEMIA
2y 5m to grant Granted Mar 03, 2026
Patent 12553062
AAV COMPOSITIONS
2y 5m to grant Granted Feb 17, 2026
Patent 12544406
INDUCED PLURIPOTENT STEM CELL DERIVED GLIAL ENRICHED PROGENITOR CELLS FOR THE TREATMENT OF WHITE MATTER STROKE
2y 5m to grant Granted Feb 10, 2026
Patent 12538905
MOUSE HAVING A HUMANIZED B-CELL ACTIVATING FACTOR GENE
2y 5m to grant Granted Feb 03, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
43%
Grant Probability
99%
With Interview (+67.6%)
4y 6m
Median Time to Grant
High
PTA Risk
Based on 709 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month