DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of Claims
Claims 1-4 & 7-22 are under examination on the merits.
The objection to the specification is withdrawn in light of Applicant’s amendments.
The objection to claim 11 is withdrawn in light of Applicant’s amendments.
The rejection of claims 2-3 under U.S.C. 112(d) is withdrawn in light of Applicant’s amendments.
Claim Rejections - 35 USC § 112
Indefiniteness
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 4 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second
paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Due to Applicant' s amendment of the claims, the rejection is modified from the rejection set forth in the Office action mailed 3/11/2025, as applied to claims 1-11 & 15-22. Applicant' s arguments filed 6/10/2025 have been fully considered but they are not persuasive.
Claim 4 recites the limitation "said sequence" in line 1. There is insufficient antecedent basis for this limitation in the claim. Because there are three distinct sequences provided in claim 1 (line 3: having at least 95% sequence identity to SEQ ID NO: 1, line 5: comprising SEQ ID NO: 1, and line 8: having at least 85% sequence identity to at least 50 contiguous nucleotides of SEQ ID NO: 1), claim 4 is indefinite as to which fragment “said sequence” refers to.
Applicant urges that because amended claim 4 recites “said sequence” and defines the sequence as having a certain percent identity to a certain number of contiguous nucleotides, the amendments are clear in view of claim amendments (Remarks, page 7, paragraph 3).
This argument is unpersuasive, because claim 1 recites multiple distinct sequences. “Said sequence” still does not have sufficient antecedent basis because there is more than one sequence it could be referencing.
Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-4 & 7-22 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Due to Applicant' s amendment of the claims, the rejection is modified from the rejection set forth in the Office action mailed 3/11/2025, as applied to claims 1-22. Applicant' s arguments filed 6/10/2025 have been fully considered but they are not persuasive.
A. Claims 1-4 & 7-22 require a DNA molecule comprising a DNA sequence having at least 95% sequence identity to SEQ ID NO: 1 and having promoter activity. Claims 2 and 3 are drawn to a DNA sequence with at least 97 or 99% sequence identity to any of SEQ ID NO: 1. Claim 7 is further drawn to the DNA molecule capable of providing expression of the heterologous transcribable polynucleotide molecule in a root nodule of a plant when said DNA molecule is expressed in said plant. Claim 10 is further drawn to the DNA sequence providing expression in response to an external stimulus. Claim 11 is further drawn to the DNA sequence providing expression in a specific cell or tissue.
A DNA sequence with 95% identity to 2000 nucleotide long SEQ ID NO: 1 encompasses sequences with 100 substitutions relative to SEQ ID NO: 1. Sequences with 97 or 99% sequence identity encompass sequences with 60 and 20 nucleotide substitutions respectively.
Thus, the claims are broad and read on many DNA molecules.
The only species of sequence having promoter activity described in the specification is SEQ ID NO: 1. Thus, the specification does not describe species over the full scope of the DNA molecules, and thus does not describe the full scope of the claimed nucleic acids.
The instant specification describes an activity of the disclosed promoter: to provide expression within the cortex of nodule primordia and an expression domain limited to the infection zone II in young and mature nodules (paragraph [0032]), which may be expressed during symbiotic infection by rhizobia (paragraph [0035]). The instant specification provides an example of a “minimal promoter” comprising a TATA box or equivalent sequence for binding of the RNA polymerase II complex (paragraph [0046]), although the claims do not require that the DNA molecule comprise the example minimal promoter. Rather, the instant specification describes sequences comprising 3’ deletions removing the TATA box element or equivalent sequence from SEQ ID NO: 1 to function as enhancer elements (paragraph [0048]).
The instant specification teaches a TATA box or equivalent sequence as a structural feature of a promoter but does not describe any other structural features of instant SEQ ID NO: 1 responsible for the ability to affect transcription and/or translation of the operably linked transcribable polynucleotide molecule and none responsible for providing expression of the heterologous transcribable polynucleotide molecule in a root nodule of a plant when said DNA molecule is expressed in a plant. The instant specification describes that fragments may exhibit promoter activity if possessed by the starting promoter molecule or a minimal promoter that comprises a TATA box or equivalent (paragraph [0046]).
Promoters and regulatory elements responsive to symbiotic infection are known in the art (Chakraborty et al (2022) Plant Cell Physiol. 63(10): 1326–1343. (published 5/12/2022, hereafter Chakraborty), table 1). Zhu et al (2004) Plant and Soil. 265: 47–59 (hereafter Zhu) describes a promoter for a PME in pea comprising a TATA box without a CAAT box, two G-box like elements, an I-box, two sequences homologous to vascular-specific cis elements of a phenylalanine ammonia lyase promoter, and nodulin promoter consensus sequences (page 52, right column, paragraph 2-page 54, left column, paragraph 1). However, many diverse transcription factors are involved in rhizobium-legume symbiosis, having both positive and negative regulation roles (Chakraborty figure 1). Cis-regulatory elements are known to be important in regulating biological processes, and modifications or mutations in cis-regulatory element modules can exclude a gene product from a particular spatiotemporal context (Chakraborty, page 1328, left column, paragraph 1). The function of transcription factors interacting with cis-regulatory modules is contextual and may vary across model systems (Chakraborty, page 1328, left column, paragraph 1). Regulatory elements involved in symbiosis may also integrate signals from the abiotic environment (Chakraborty figure 2).
Thus, promoters comprise diverse, distinct structures with distinct function. The specification fails to provide a structure or function to make up for the lack of knowledge on the art regarding the features of the claimed DNA sequences with promoter activity.
Since the disclosure fails to describe the common attributes that identify members of the genus, and because the genus is highly variant, SEQ ID NO:1 alone is insufficient to describe the claimed genus of DNA molecules.
Hence, Applicant has not, in fact, described nucleic acids with 95% sequence identity with promoter activity over the full scope of the claims, and the specification fails to provide an adequate written description of the claimed invention. Therefore, given the lack of written description in the specification with regard to the structural and functional characteristics of the claimed compositions, Applicant does not appear to have been in possession of the claimed genus at the time this application was filed.
Applicant urges that the specification describes SEQ ID NO: 1 and sequences with 95% identity that have promoter activity. Applicant urges that the specification describes that regulatory elements may comprise substitutions, deletions, and or insertion naturally and describes “variant” molecules as referring to a second DNA molecule that still maintains general functionality of the first DNA molecule. Applicant urges that this description would clearly convey to a person of skill in the art that Applicants were in possession of the claimed genus (Remarks page 8, paragraph 3-page 9 paragraph 1).
This argument is unpersuasive. The instant specification teaches a TATA box or equivalent sequence as a structural feature of a promoter but does not describe any other structural features of instant SEQ ID NO: 1 responsible for the ability to affect transcription and/or translation of the operably linked transcribable polynucleotide molecule and none responsible for providing expression of the heterologous transcribable polynucleotide molecule in a root nodule of a plant when said DNA molecule is expressed in a plant. A TATA box is a minimal promoter and does not differentiate the instant invention from other promoter sequences. The specification has not described which portions of the 2000bp-long SEQ ID NO: 1 are structurally and functionally important to be conserved within a fragment or within the 95% sequence identity requirement.
Applicant urges that the specification describes art-recognized domains associated with activity such as a TATA box, and that identification of known promoter elements may be used by one of skill in the art to design variants of the promoter having similar expression to the original promoter. Applicant also urges that the specification “literally describes the claimed variants and fragments” (Remarks page 9 paragraph 2-page 10 paragraph 2).
This argument is unpersuasive, because the instant specification does not describe any structural features of instant SEQ ID NO: 1 responsible for the ability to affect transcription and/or translation of the operably linked transcribable polynucleotide molecule, nor any features responsible for providing expression of the heterologous transcribable polynucleotide molecule in a root nodule of a plant when said DNA molecule is expressed in a plant, so the specification does not describe the structural features that distinguish a promoter with 95% identity to SEQ ID NO: 1 or 85% identity to 50 contiguous bases of SEQ ID NO: 1 from other DNA molecules with 95% identity to SEQ ID NO: 1 or 85% identity to 50 contiguous bases of SEQ ID NO: 1. Although Applicant has described lengths and percent sequence identities that variants and fragments of SEQ ID NO: 1 can comprise, Applicant has not provided specific examples of such variants that provide the claimed function. The specification does not describe the sequence of any variant or fragment. Without providing the features necessary to the invention or providing examples of sequences that perform the function, Applicant has not described examples over the full scope of the claimed genus.
Applicant urges that disclosure of a sequence would have put one of skill in the art in possession of the entire genus of nucleic acid sequences having a given percent identity to that sequence, and that because "The Guidelines" provide that when claims recite an activity of a sequence, the identification of domains responsible for the activity recited in the claims provides the necessary information for a person of skill in the art to conclude that Applicants would have been in possession of the claimed genus based on a single sequence (Remarks page 10 paragraphs 3-4).
This argument is not persuasive, because Applicant has described a single domain (TATA box) capable of providing a basal level of transcription. Applicant has not described domains responsible for providing expression of the heterologous transcribable polynucleotide molecule in a root nodule of a plant when said DNA molecule is expressed in a plant. Applicant describes compositions derived from SEQ ID NO: 1 comprised of 3’ deletions in which “the TATA box element or equivalent sequence thereof” is removed (paragraph [0048]), which suggests that even the TATA box element is not a necessary structural feature of SEQ ID NO: 1. Therefore, Applicant has not provided identification of domains responsible for the activity of SEQ ID NO: 1.
Applicant urges that identification of domains responsible for the activity provides necessary information to demonstrate possession of the claimed genus when there is an art-recognized structure-function relationship. Applicant urges that the expectation that many substitutions would result in a protein with the required activity is sufficient to satisfy the written description (Remarks page 10, paragraph 4- page 12, paragraph 1).
This argument is unpersuasive, because the only structural feature with an art-recognized function is a TATA box (paragraph [0046]). According to the instant specification, a TATA box is a minimal promoter that provides a basal level of transcription. The instant specification does not describe any structural features of instant SEQ ID NO: 1 responsible for the ability to affect transcription and/or translation of the operably linked transcribable polynucleotide molecule, nor any features responsible for providing expression of the heterologous transcribable polynucleotide molecule in a root nodule of a plant when said DNA molecule is expressed in a plant. The specification does not require that a TATA box be present in variants and fragments of SEQ ID NO: 1. Because Applicant has not described the features of SEQ ID NO: 1 that provide the function of expression characteristic of SEQ ID NO: 1, one of ordinary skill in the art would not know which, if any, substitutions or truncations would result in a DNA sequence with the required activity.
Applicant urges that a person of skill would have recognized possession of the full scope of the invention because variants and fragments of a promoter can maintain regulatory activity. Applicant urges, citing Welsch et al (2003) Planta. 216: 523-534 (hereafter Welsch), that a deletion of 432 bp of a 1746 nucleotide long promoter region led to “almost indistinguishable” expression compared to the full-length promoter while a deletion of 1550bp changed the promoter activity of the sequence in response to some types of light but did not abolish all promoter activity. Applicant urges, citing Piechulla et al (1998) Plant Molecular Biology. 38: 655-662 (hereafter Piechulla), that short 5’ upstream regions are sufficient for expression and responsible for circadian rhythm in Lhc promoters. Applicant urges, citing Cho et al (2002) The Plant Cell. 14. 3237-3253 (published 12/2002, hereafter Cho) that deletions and substitution mutations can retain or increase promoter activity (Remarks page 12, paragraph 2-page 14 paragraph 1).
This argument is unpersuasive, because Welsch, Piechulla, and Cho demonstrate that the effects of deletions and substitution mutations on promoter activity are unpredictable with regards to promoter activity, tissue specificity, and response to external stimulus. Truncated promoters, particularly fragments of only 50-115bp, do not necessarily retain promoter activity. Cho teaches that AtEXP7 promoter deletions of -134 retained ~50% of promoter activity but lost cell specificity and inducibility (page 3244, right column, paragraph 3-4). AtEXP18 promoter deletions completely lost promoter activity at -145bp (Cho page 3246, right column, paragraph 2). In addition, a 35S minimal promoter did not show expression in root hairs and gain-of-function promoter constructs had weak expression similar to the 35S minimal promoter (Cho figure 9E, page 3245, right column, paragraph 2-page 3246, right column, paragraph 1). Given the unpredictability of promoter features contributing to function, one of ordinary skill in the art would not recognize which contiguous nucleotides of SEQ ID NO: 1 are necessary and sufficient for promoter activity and which could be mutated or deleted. Thus, one of ordinary skill in the art would not recognize that Applicant was in possession of the genus at the time of filing of the instant application.
Applicant urges that the Written Description requirement is met because the specification has described SEQ ID NO: 1 and a requirement for promoter activity (Remarks page 14, paragraph 2).
This argument is unpersuasive, because the structural features leading to promoter activity and root hair or nodule specificity are not described in the specification or known in the art. Applicant has not described features other than a TATA box that contribute to promoter activity. The specification does not require that a TATA box be present in variants and fragments of SEQ ID NO: 1. The instant specification does not describe any structural features of instant SEQ ID NO: 1 responsible for the ability to affect transcription and/or translation of the operably linked transcribable polynucleotide molecule, nor any features responsible for providing expression of the heterologous transcribable polynucleotide molecule in a root nodule of a plant when said DNA molecule is expressed in a plant. Applicant has not described or provided examples of fragments or variants that preserve the required function. Because Applicant has not described the features of SEQ ID NO: 1 that provide the function of expression characteristic of SEQ ID NO: 1, one of ordinary skill in the art would not know which, if any, substitutions or truncations would result in a DNA sequence that preserves the required activity.
B. Claims 1-4 & 7-22 require a fragment comprising at least 50 contiguous nucleotides of SEQ ID NO: 1 and having promoter activity or a sequence having at least 85 percent identity to at least 50 contiguous nucleotides of SEQ ID NO: 1 and having gene-regulatory activity. Claim 4 is further drawn to a sequence between 50 and 115 nucleotides long, having 87% sequence identity to SEQ ID NO: 1 and promoter activity. Claim 7 is further drawn to the DNA molecule capable of providing expression of the heterologous transcribable polynucleotide molecule in a root nodule of a plant when said DNA molecule is expressed in said plant. Claim 10 is further drawn to the DNA sequence providing expression in response to an external stimulus. Claim 11 is further drawn to the DNA sequence providing expression in a specific cell or tissue.
The claims are drawn to any fragment with at least 85% sequence identity to a sequence of SEQ ID NO: 1 at least 50 contiguous nucleotides long with gene-regulatory activity or a sequence of at least 50 contiguous nucleotides of SEQ ID NO: 1, or for claim 4 to a fragment with at least 87% sequence identity and between 50 and 115 nucleotides long. Thus, the claims are broad and read on nucleotides with at least 87% sequence identity to 50 contiguous nucleotides of SEQ ID NO: 1 with promoter activity.
The instant specification describes an activity of the disclosed regulatory element: to provide expression within the cortex of nodule primordia and an expression domain limited to the infection zone II in young and mature nodules (paragraph [0032]), which may be expressed during symbiotic infection by rhizobia (paragraph [0035]). The instant specification provides an example of a “minimal promoter” comprising a TATA box or equivalent sequence for binding of the RNA polymerase II complex (paragraph [0046]), although the claims do not require that the DNA molecule comprise the example minimal promoter. Rather, the instant specification describes sequences comprising 3’ deletions removing the TATA box element or equivalent sequence from SEQ ID NO: 1 to function as enhancer elements (paragraph [0048]).
The instant specification teaches a TATA box or equivalent sequence as a structural feature of a promoter but does not describe any other structural features of instant SEQ ID NO: 1 responsible for the ability to affect transcription and/or translation of the operably linked transcribable polynucleotide molecule and none responsible for providing expression of the heterologous transcribable polynucleotide molecule in a root nodule of a plant when said DNA molecule is expressed in a plant.
Promoters and regulatory elements responsive to symbiotic infection are known in the art (Chakraborty et al (2022) Plant Cell Physiol. 63(10): 1326–1343. (published 5/12/2022, hereafter Chakraborty), table 1). Zhu et al (2004) Plant and Soil. 265: 47–59 describes a promoter for a PME in pea comprising a TATA box without a CAAT box, two G-box like elements, an I-box, two sequences homologous to vascular-specific cis elements of a phenylalanine ammonia lyase promoter, and nodulin promoter consensus sequences (page 52, right column, paragraph 2-page 54, left column, paragraph 1). However, many diverse transcription factors are involved in rhizobium-legume symbiosis, having both positive and negative regulation roles (Chakraborty figure 1). Cis-regulatory elements are known to be important in regulating biological processes, and modifications or mutations in cis-regulatory element modules can exclude a gene product from a particular spatiotemporal context (Chakraborty, page 1328, left column, paragraph 1). The function of transcription factors interacting with cis-regulatory modules is contextual and may vary across model systems (Chakraborty, page 1328, left column, paragraph 1). Regulatory elements involved in symbiosis may also integrate signals from the abiotic environment (Chakraborty figure 2).
Thus, promoters and regulatory elements comprise diverse, distinct structures with distinct function. The specification fails to provide a structure or function to make up for the lack of knowledge on the art.
Since the disclosure fails to describe the common attributes that identify members of the genus, and because the genus is highly variant, SEQ ID NO:1 alone is insufficient to describe the claimed genus of DNA molecules.
Hence, Applicant has not, in fact, described fragments of SEQ ID NO: 1 at least 50 nucleotides long with at least 85% sequence identity and gene regulatory activity, or at least 87% identity if the fragment is between 50 and 115 nucleotides long, over the full scope of the claims, and the specification fails to provide an adequate written description of the claimed invention. Therefore, given the lack of written description in the specification with regard to the structural and functional characteristics of the claimed compositions, Applicant does not appear to have been in possession of the claimed genus at the time this application was filed.
Applicant urges that the specification literally describes promoters that are fragments of SEQ ID NO: 1 and explains that a fragment may be defined as exhibiting gene regulatory activity or promoter activity possessed by the starting promoter molecule. Applicant urges that the specification describes art-recognized domains associated with the activity recited in the claims. Applicant urges that embodiments of fragments are contemplated at paragraph [0047] and that the specification explains that known promoter elements may be used to design variants having a similar expression pattern or may comprise substitutions, deletions, and/or substitutions. Applicant urges that a defined fragment length of at least 50 contiguous nucleotides and SEQ ID NO: 1 would clearly convey to a person of skill in the art that Applicants were in possession of the claimed genus at the time of filing (Remarks, page 15, paragraph 3-page 16, paragraph 2).
This argument is unpersuasive, because the only structural feature associated with promoter activity described in the specification is a TATA box (paragraph [0046]). Applicant has not provided examples of fragments of SEQ ID NO: 1 that are 50bp length with the recited function of promoter activity, or described which 50 nucleotide long fragments would have promoter activity and root hair or nodule specificity, merely described that such fragments can exist. As presented above, truncated promoters, particularly fragments of only 50-115bp, do not necessarily retain promoter activity. Cho (Exhibit C) teaches that AtEXP7 promoter deletions of -134 retained ~50% of promoter activity but lost cell specificity and inducibility (page 3244, right column, paragraph 3-4). AtEXP18 promoter deletions completely lost promoter activity at -145bp (Cho page 3246, right column, paragraph 2).
The instant specification does not describe any structural features of instant SEQ ID NO: 1 responsible for providing expression of the heterologous transcribable polynucleotide molecule in a root nodule of a plant when said DNA molecule is expressed in a plant. The specification does not describe the sequence of any variant or fragment. Applicant has not described or provided examples of fragments that preserve the activity of SEQ ID NO: 1 nor even that preserve promoter activity broadly. Thus, a person of skill in the art would not recognize that Applicants were in possession of the claimed genus at the time of filing.
Scope of Enablement
Claims 1-4 & 7-22 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a DNA molecule comprising a DNA sequence of SEQ ID NO: 1, does not reasonably provide enablement for any sequence having at least 95 percent sequence identity to SEQ ID NO: 1 and having promoter activity or for a fragment of SEQ ID NO: 1 comprising 50 contiguous nucleotides and having promoter activity or a sequence having at least 85% sequence identity to at least 50 contiguous nucleotides of SEQ ID NO: 1 and having gene-regulatory activity. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the invention commensurate in scope with these claims.
Due to Applicant' s amendment of the claims, the rejection is modified from the rejection set forth in the Office action mailed 3/11/2025, as applied to claims 1-22. The rejection of claims 1-4, 8, 9, & 12-22 for not being enabled for a DNA molecule lacking gene-regulatory activity (part B) is withdrawn in light of Applicant’s amendments. Applicant' s arguments filed 6/10/2025 have been fully considered but they are not persuasive.
Claims 1-4 and 7-22 are drawn to a DNA sequence comprising a sequence having at least 95 percent sequence identity to SEQ ID NO: 1 and having promoter activity or a fragment of SEQ ID NO: 1 comprising 50 contiguous nucleotides and having promoter activity or a sequence having at least 85 % sequence identity to at least 50 contiguous nucleotides of SEQ ID NO: 1 and having gene-regulatory activity, or a plant, seed, commodity product, comprising the DNA sequence or a method comprising the DNA sequence. Claim 7 is further drawn to the DNA molecule capable of providing expression of the heterologous transcribable polynucleotide molecule in a root nodule of a plant when said DNA molecule is expressed in a plant. Claim 10 is further drawn to the DNA sequence providing expression in response to an external stimulus and claim 11 is further drawn to the expression in a root hair cell, the cortex of nodule primordia, a mature nodule, or within a nodular infection zone in young, mature, or indeterminate nodules.
The only species of regulatory element described in the specification is SEQ ID NO: 1. Thus, the specification does not describe species over the full scope of the claimed DNA molecules.
The instant specification describes an activity of the disclosed regulatory element: to provide expression within the cortex of nodule primordia and an expression domain limited to the infection zone II in young and mature nodules (paragraph [0032]), which may be expressed during symbiotic infection by rhizobia (paragraph [0035]). The instant specification provides an example of a “minimal promoter” comprising a TATA box or equivalent sequence for binding of the RNA polymerase II complex (paragraph [0046]), although the DNA molecule as claimed does not require the example minimal promoter. Rather, the instant specification describes sequences comprising 3’ deletions removing the TATA box element or equivalent sequence from SEQ ID NO: 1 to function as enhancer elements (paragraph [0048]).
The instant specification teaches a TATA box or equivalent sequence as a structural feature of a promoter but does not describe any other structural features of instant SEQ ID NO: 1 responsible for the ability to affect transcription and/or translation of the operably linked transcribable polynucleotide molecule and none responsible for SyPME promoter activity. The specification fails to provide a structure responsible for activity for specific spatial expression (as in claim 11) or in response to a stimulus (as in claim 10) or that constitutes SyPME promoter activity (as in claim 7).
Promoters and regulatory elements responsive to symbiotic infection are known in the art (Chakraborty et al (2022) Plant Cell Physiol. 63(10): 1326–1343. (published 5/12/2022, hereafter Chakraborty), table 1). Zhu et al (2004) Plant and Soil. 265: 47–59 describes a promoter for a PME in pea comprising a TATA box without a CAAT box, two G-box like elements, an I-box, two sequences homologous to vascular-specific cis elements of a phenylalanine ammonia lyase promoter, and nodulin promoter consensus sequences (page 52, right column, paragraph 2-page 54, left column, paragraph 1). However, many diverse transcription factors are involved in rhizobium-legume symbiosis, having both positive and negative regulation roles (Chakraborty figure 1). Cis-regulatory elements are known to be important in regulating biological processes, and modifications or mutations in cis-regulatory element modules can exclude a gene product from a particular spatiotemporal context (Chakraborty, page 1328, left column, paragraph 1). The function of transcription factors interacting with cis-regulatory modules is contextual and may vary across model systems (Chakraborty, page 1328, left column, paragraph 1). Regulatory elements involved in symbiosis may also integrate signals from the abiotic environment (Chakraborty figure 2). Thus, regulatory elements comprise diverse, distinct structures with distinct function, and changes to the sequence can affect function.
As the specification does not provide any examples of a DNA molecule with promoter activity other than SEQ ID NO: 1 and does not provide any structure responsible for promoter activity in a DNA molecule comprising at least 95% sequence identity to SEQ ID NO: 1 or a fragment of SEQ ID NO: 1 comprising 50 contiguous nucleotides and having promoter activity or a sequence having at least 85 % sequence identity to at least 50 contiguous nucleotides of SEQ ID NO: 1 and having gene-regulatory activity, other than the TATA-box motif (paragraph [0046]), undue trial and error experimentation would be required to screen through the myriad of DNA molecules encompassed by the claims to determine which sequences have promoter activity, and additionally which have promoter activity or provide expression of the heterologous transcribable polynucleotide molecule in a root nodule of a plant when said DNA molecule is expressed in a plant or respond to external stimulus in a root hair cell, within the cortex of nodule primordia, a mature nodule, or within a nodular infection zone in young, mature, or indeterminate nodules.
Given the claim breadth and lack of guidance in the specification as discussed above, the instant invention is not enabled through the full scope of claims 1-4 & 7-22.
Applicant urges that the specification teaches that SEQ ID NO: 1 provides the structure responsible for the activity of specific spatial expression or expression in response to a stimulus and that the specification explains that fragments or variants exhibiting those activities can be made using methods known in the art (Remarks page 17, paragraph 2).
This argument is unpersuasive, because the claims are not limited to SEQ ID NO: 1. Undue experimentation is still required to determine which contiguous nucleotides are necessary and sufficient to provide the promoter activity of SEQ ID NO: 1 and which sequences are therefore encompassed by the instant claims.
Applicant urges that the claims are fully enabled because a person of skill in the art would be capable of generating variants of SEQ ID NO: 1 and testing them for promoter activity given the teaching in the specification (Remarks, page 18, paragraph 2). Applicant urges that some experimentation and routine screening does not preclude enablement when a reasonable amount of guidance is provided with respect to the direction in which experimentation should proceed. Applicant urges that SEQ ID NO: 1 is "extensive guidance" as well as the description of assays for determining promoter activity provided in the specification (Remarks, page 18 paragraph 3- page 19 paragraph 1).
This argument is unpersuasive, because the sequence variation encompassed by the claims constitutes a huge number of variant sequences, fragments, and variant fragments. Screening this extremely large number of variants in order to determine which sequences are enabled as the instant invention would require making the sequences, transforming plants with the sequences, growing the plants, applying external stimuli, and analyzing expression patterns across tissues. Given the work required, screening such a large number of potential sequences constitutes undue experimentation. SEQ ID NO: 1, without any teachings about the motifs required for its activity aside from a general description of TATA box motifs in promoters, is not extensive guidance for one of ordinary skill in the art to determine which variants and fragments are likely to retain the activity of SEQ ID NO: 1.
Applicant urges that the invention is enabled because the specification teaches skilled practitioners of the art how to produce variants or fragments of a nucleotide sequence of SEQ ID NO: 1 (Remarks, page 19 paragraph 2-page 20 paragraph 1). Applicant urges that the invention is enabled because the specification teaches one of skill in the art how to evaluate a sequence for promoter activity in a plant cell. Applicant urges that only the most basic and routine of experimentation would therefore be required in order to obtain the claimed sequences with promoter activity (page 20, paragraph 2-paragraph 4).
This argument is not persuasive, because knowing how to make variants still requires undue testing of whether those sequences have promoter activity. As presented above, promoter activity, responsiveness, and tissue specificity can be unpredictable in fragments and variants. Cho (Exhibit C) teaches that AtEXP7 promoter deletions of -134 retained ~50% of promoter activity but lost cell specificity and inducibility (page 3244, right column, paragraph 3-4), while AtEXP18 promoter deletions completely lost promoter activity at -145bp (Cho page 3246, right column, paragraph 2). The instant claims encompass fragments shorter even than the truncated promoter of Cho that lost activity. Knowing how to test for promoter activity would not preclude the undue experimentation required to determine which of the sequences encompassed by the claims retain promoter activity.
Applicant urges that amended claims recite DNA molecules having promoter activity and exclude sequences not exhibiting gene-regulatory activity (Remarks, page 21, paragraphs 3-4).
The rejection (part B) over claims 1-4, 8, 9, and 12-22 under 35 U.S.C. 112(a) has been withdrawn in light of Applicant’s amendments.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-4, 8 & 12-22 are rejected under 35 U.S.C. 103 as being unpatentable over Budworth et al US 7,550,578 B2 (patented 6/23/2009, hereafter Budworth) in view of NCBI reference sequence NC_053045.1 (available 2/26/2021).
Due to Applicant' s amendment of the claims, the rejection is modified from the rejection set forth in the Office action mailed 3/11/2025, as applied to claims 1-6, 8, & 12-22. Applicant' s arguments filed 6/10/2025 have been fully considered but they are not persuasive.
Claims 1-4, 8, & 12-22 are drawn to a DNA molecule comprising a DNA sequence having at least 95% sequence identity to SEQ ID NO: 1 linked to a transcribable polynucleotide, a transgenic plant cell, plant, or seed comprising said DNA molecule, or a commodity product or method of producing said product comprising said DNA molecule.
Budworth teaches rice promoter sequences obtained from ORF, including ORF with root-specific expression (column 3, lines 6-28). Budworth teaches that a plant promoter region lies upstream of the structural gene and determines expression level and spatial and temporal pattern of expression (column 66, lines 5-24). Budworth envisions promoters of about 25 to 2000bp (column 4, lines 37-44). Budworth teaches one of the root-specific ORF to be a pectin methylesterase described as a pectinesterase PPE8B precursor (Budworth SEQ ID NO: 941; column 156, lines 10-12 & column 94, lines 1-8). Budworth teaches a method of testing promoters in plants wherein the promoter is cloned into a vector controlling the GUS gene and transformed in rice or maize (column 108, lines 31-47).
Budworth teaches that the promoters can be from both monocots and dicots (column 33, lines 30-44) and envisions the nucleotide in a transformed plant that is a dicot or a monocot (column 10, lines 6-9).
Budworth teaches that root-specific promoters may be useful for expressing genes related to nutrient uptake (column 8, lines 36-55). Budworth envisions a use for constructs comprising said promoters to increase utilization of available nutrients in plants (column 57, line 63-column 58, line 10).
Budworth also envisions uses for constructs comprising promoters to improve grain for cereal (column 53, lines 31-45), including to improve the quantity or quality of starch, oil corn gluten meal or corn gluten feed (column 55, lines 50-55). Budworth envisions the transgenic plants used in traditional agriculture for the use of grain (column 78, lines 27-39)
Budworth does not teach a DNA sequence having at least 95% sequence identity to instant SEQ ID NO: 1.
NCBI reference sequence NC_053045.1 teaches a M. truncatula genome sequence encoding a pectinesterase/pectinesterase inhibitor PPE8B and its upstream sequence with 99% sequence identity to instant SEQ ID NO: 1 (nucleotides 72-2078 of the appended GenBank record). See alignment below.
Sequence ID: Query_307029Length: 2100Number of Matches: 1
Range 1: 72 to 2078GraphicsNext MatchPrevious Match
Alignment statistics for match #1
Score
Expect
Identities
Gaps
Strand
3661 bits(1982)
0.0
2000/2007(99%)
7/2007(0%)
Plus/Plus
Query 1 TGTTCTCTCTATTAAGATTCCTCCCTCCCCTTCGTTAAACCAAACAAAAAGAAGTTGATA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 72 TGTTCTCTCTATTAAGATTCCTCCCTCCCCTTCGTTAAACCAAACAAAAAGAAGTTGATA 131
Query 61 TCACTAAGATGATAGAAGTTGAATATTTAATTTAGATTAGAGTGCATGTCAGCATCAAAT 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 132 TCACTAAGATGATAGAAGTTGAATATTTAATTTAGATTAGAGTGCATGTCAGCATCAAAT 191
Query 121 TATTACTAAAATTACCGAAACCAAATAATTAAAAAACAAGGCCTGCATACAAGAATTGGC 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 192 TATTACTAAAATTACCGAAACCAAATAATTAAAAAACAAGGCCTGCATACAAGAATTGGC 251
Query 181 ATAAGAGATGGACGCGgaaaaggaaagttaaaattgaaaagaaaagaaaaCAACATATTG 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 252 ATAAGAGATGGACGCGGAAAAGGAAAGTTAAAATTGAAAAGAAAAGAAAACAACATATTG 311
Query 241 AGGAACCTGCCATACATGGACAAACATGTGATGCTTGTATAAAAAAGAAAAGTTCTCCTC 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 312 AGGAACCTGCCATACATGGACAAACATGTGATGCTTGTATAAAAAAGAAAAGTTCTCCTC 371
Query 301 TCATTTTCATTTTCATTTCATATATATAAAATATGGTGAAATTGAATACGT------TAC 354
||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct 372 TCATTTTCATTTTCATTTCATATATATAAAATATGGTGAAATTGAATACGTAAGATATAC 431
Query 355 TAAAGTGAAAATTTTTAATTTGATGAAATGGACTAAGAGAGAAAAACAAAAATAGATCTA 414
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 432 TAAAGTGAAAATTTTTAATTTGATGAAATGGACTAAGAGAGAAAAACAAAAATAGATCTA 491
Query 415 GAGCCATCTATGTTGAGGCAGCAAGCTGTAATAATCACATTGGGTGGGTGACGGTGTCGA 474
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 492 GAGCCATCTATGTTGAGGCAGCAAGCTGTAATAATCACATTGGGTGGGTGACGGTGTCGA 551
Query 475 GAATAATTTACCTCATGTATTTTGTTCTAGATGATTAGTGAACTGATCTAGAGATTTTAA 534
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 552 GAATAATTTACCTCATGTATTTTGTTCTAGATGATTAGTGAACTGATCTAGAGATTTTAA 611
Query 535 TTAGTAAAATCAGTATGTATATAGAAATTTATTTTTAATAATAGATGGCTCTAGATATGT 594
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 612 TTAGTAAAATCAGTATGTATATAGAAATTTATTTTTAATAATAGATGGCTCTAGATATGT 671
Query 595 TTTTGAAATGTACTATTAGAAAAAACCCAAATCCCAAATCAGATAGATAAGACTTTTGAG 654
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 672 TTTTGAAATGTACTATTAGAAAAAACCCAAATCCCAAATCAGATAGATAAGACTTTTGAG 731
Query 655 AAGAGTATATAAAGATGAGACAATCCTCAACTTACAAGCTGGTTGGTTTTGTAAGGATGA 714
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 732 AAGAGTATATAAAGATGAGACAATCCTCAACTTACAAGCTGGTTGGTTTTGTAAGGATGA 791
Query 715 GTTAAGGGGTTTGAGGCTTTTCtttttttGGAATATAAATTTTAGGCTAGTTGTTAACAA 774
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 792 GTTAAGGGGTTTGAGGCTTTTCTTTTTTTGGAATATAAATTTTAGGCTAGTTGTTAACAA 851
Query 775 ATTTTCTTCTtatataaatatatat-aaaaaatgtatatataatatcaagtaaaaattat 833
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct 852 ATTTTCTTCTTATATAAATATATATAAAAAAATGTATATATAATATCAAGTAAAAATTAT 911
Query 834 tgaaaatatactgctaaaaaaataattattGAAAATTTATAGTGGGTTACTTGTCATCAC 893
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 912 TGAAAATATACTGCTAAAAAAATAATTATTGAAAATTTATAGTGGGTTACTTGTCATCAC 971
Query 894 ATCTTTTCAAATAAGTCGATTAATGTATTATGGTAGAAGTTGTAAAGAGAAAGTTCATAT 953
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 972 ATCTTTTCAAATAAGTCGATTAATGTATTATGGTAGAAGTTGTAAAGAGAAAGTTCATAT 1031
Query 954 AGAGAGAAAAAGAATGGATGTTTTCTTTTGAAGAACCTAGGAACGAAAGTCAAAAGAACA 1013
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1032 AGAGAGAAAAAGAATGGATGTTTTCTTTTGAAGAACCTAGGAACGAAAGTCAAAAGAACA 1091
Query 1014 AAATGCTTAAAAGTGAAAAATTACAGGTATTAGAGATACTCTaaaaaaaTTAGAATATGT 1073
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1092 AAATGCTTAAAAGTGAAAAATTACAGGTATTAGAGATACTCTAAAAAAATTAGAATATGT 1151
Query 1074 ATCATCGTGAACAAACTCATAAACATTCCGAAGGCTCCTTCaaaaaaaCATTCTGAAGGT 1133
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1152 ATCATCGTGAACAAACTCATAAACATTCCGAAGGCTCCTTCAAAAAAACATTCTGAAGGT 1211
Query 1134 AATCGATATAAAAACACGATGACATAATGATTTATTTTAGTAAACGATCCATTCATTTGC 1193
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1212 AATCGATATAAAAACACGATGACATAATGATTTATTTTAGTAAACGATCCATTCATTTGC 1271
Query 1194 GTGATAGATTTATTAAAAGAATTGTGAATTTACCTCATGTATTTTGATAGAGAAATTTAA 1253
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1272 GTGATAGATTTATTAAAAGAATTGTGAATTTACCTCATGTATTTTGATAGAGAAATTTAA 1331
Query 1254 CCTTGAGATTAGCTTAGTTTTAAATAGTGTAATTGCCGCCGAACTTGACAACGTAAACTT 1313
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1332 CCTTGAGATTAGCTTAGTTTTAAATAGTGTAATTGCCGCCGAACTTGACAACGTAAACTT 1391
Query 1314 GTGATCTAAGTAGAAGCCTTAAGATGTTGGAATGTCCTTTATTATGTGTCAAAAAAGAAA 1373
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1392 GTGATCTAAGTAGAAGCCTTAAGATGTTGGAATGTCCTTTATTATGTGTCAAAAAAGAAA 1451
Query 1374 TAGTGTGATTGaaaaaaaaaaTCATTGATTTAATTATATCTTAAGATGTGGTGTGTTATG 1433
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1452 TAGTGTGATTGAAAAAAAAAATCATTGATTTAATTATATCTTAAGATGTGGTGTGTTATG 1511
Query 1434 AAAATATAACGAAAGAATGACATGACAATACAATATTTAATATCCCTaaaaaaaaaTACA 1493
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1512 AAAATATAACGAAAGAATGACATGACAATACAATATTTAATATCCCTAAAAAAAAATACA 1571
Query 1494 ATATTTAGTAGAAGAGTTCTTGATTTTATAGAGTTAAATAATTTTATATTAATTAAAACT 1553
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1572 ATATTTAGTAGAAGAGTTCTTGATTTTATAGAGTTAAATAATTTTATATTAATTAAAACT 1631
Query 1554 AAGATTGAAATATACACATATACTATCACTaaaaaaaGAAAAGAAATATATACATATACA 1613
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1632 AAGATTGAAATATACACATATACTATCACTAAAAAAAGAAAAGAAATATATACATATACA 1691
Query 1614 TTTATATGAGCATAAATTGTTTTGGAGACTAAACTTTTCTTGTTAAAAATTGAAATGTGT 1673
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1692 TTTATATGAGCATAAATTGTTTTGGAGACTAAACTTTTCTTGTTAAAAATTGAAATGTGT 1751
Query 1674 TTGTAAAGTTTAATTCAATAAATAATGTCGAGATTGTTATACTAAATATTTCATGTGATA 1733
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1752 TTGTAAAGTTTAATTCAATAAATAATGTCGAGATTGTTATACTAAATATTTCATGTGATA 1811
Query 1734 TTAAAGTTTAGATTTATAATATCTGATCTATATGTCTTCATTTTTATTGACGTTTATAGT 1793
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1812 TTAAAGTTTAGATTTATAATATCTGATCTATATGTCTTCATTTTTATTGACGTTTATAGT 1871
Query 1794 TTCACCTACGTTTAAAATTACTATAAAAGTTAGAATACAAAGTTTATTAGCATCTAACCA 1853
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1872 TTCACCTACGTTTAAAATTACTATAAAAGTTAGAATACAAAGTTTATTAGCATCTAACCA 1931
Query 1854 GCTCTACACAACTGAATCTACAATCTTTTCCTTCCTTTAAATAATCTCAACATCTCTCAA 1913
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1932 GCTCTACACAACTGAATCTACAATCTTTTCCTTCCTTTAAATAATCTCAACATCTCTCAA 1991
Query 1914 TTCTTATTTGCCTCTTAACAAAATAAAAACCATAGAATTAGTGACACTTACTTACTCATC 1973
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1992 TTCTTATTTGCCTCTTAACAAAATAAAAACCATAGAATTAGTGACACTTACTTACTCATC 2051
Query 1974 GTGTCTATTATATTTCAAAGTTCTAAA 2000
|||||||||||||||||||||||||||
Sbjct 2052 GTGTCTATTATATTTCAAAGTTCTAAA 2078
Before the time of filing of the instant application, it would have been obvious to one of ordinary skill in the art to substitute the upstream sequence of a M. truncatula pectinesterase PPE8B taught by NCBI reference sequence NC_053045.1 for the rice pectinesterase PPE8B promoter in the construct of Budworth. Substituting the rice promoter for a promoter of a homologous gene in M. truncatula would have been a design choice. One would have had reasonable expectation of success, because Budworth taught Medicago as a source from which to isolate the n