Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA. DETAILED ACTION Priority Acknowledgement is made of Applicant’s claimed domestic priority under 35 U.S.C. § 119(e), of U.S. Provisional Application Serial No. 63/389,216, filed 07/14/2022. Status of the Claims The amendment dated 07/11/ 20 23 is acknowledged . Claims 1-5 are pending and under examination. Information Disclosure Statement The re was no information disclosure statement (IDS) submitted at the time of this Office action. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (B) CONCLUSION.— The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. Claim s 1 and 3 is rejected under 35 U.S.C. 112(b) , as being indefinite for failing to particularly point out and distinctly claim the subject matter which applicant regards as the invention. Claim 1 contains parentheses, for example, “(subtype G3 genotype)” and “(subtype G14 genotype)”. The use of parentheses in the claim makes the range of concentrations indefinite in that it is unclear whether the range is exemplary or a limitation of the claim invention. See MPEP § 2173.05(d). Claim 3 contains the trademark/trade name s . Where a trademark or trade name is used in a claim as a limitation to identify or describe a particular material or product, the claim does not comply with the requirements of 35 U.S.C. 112, second paragraph. See Ex parte Simpson , 218 USPQ 1020 (Bd. App. 1982). The claim scope is uncertain since the trademark or trade name cannot be used properly to identify any particular material or product. A trademark or trade name is used to identify a source of goods, and not the goods themselves. Thus, a trademark or trade name does not identify or describe the goods associated with the trademark or trade name. In the present case, the trademark/trade name is used to identify/describe a reactive compound, wherein the reactive compound can be from either a redox active compound, a radical building compound, or a stabilizing compound and, accordingly, the identification/description is indefinite. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claim s 1 and 4 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Bailey, "Investigation of the infectious causes of diarrhoea in Australian thoroughbred foals", 2017, University Library MINERVA Access, https://hdl.handle.net/11343/212071:1-186 ). The claims are directed to a panel of oligonucleotides for use in a multiplex reverse transcriptase- polymerase chain reaction (RT-PCR) assay for the identification of rotavirus A and B and genotypes thereof, the panel of nucleotides comprising: a rotavirus A-specific forward PCR primer, a rotavirus A-specific reverse PCR primer, and a labeled oligonucleotide probe, wherein the forward PCR primer, reverse PCR primer, and the labeled oligonucleotide probe are each complementary to a region of a nucleic acid, or the complement thereof, encoding the non-structural protein 3 (NSP3) of an equine rotavirus A; a rotavirus A VP7 (subtype G3 genotype)-specific forward PCR primer, a rotavirus A VP7 (subtype G3 genotype)-specific reverse PCR primer, and a labeled oligonucleotide probe, wherein the forward PCR primer, reverse PCR primer, and the labeled oligonucleotide probe are each complementary to a nucleic acid, or the complement thereof, encoding the structural protein VP7 of an equine rotavirus A, or a fragment thereof, a rotavirus A VP7 (subtype G14 genotype)-specific forward PCR primer, a rotavirus A VP7 (subtype G14 genotype)-specific reverse PCR primer, and a labeled oligonucleotide probe, wherein the forward PCR primer, reverse PCR primer, and the labeled oligonucleotide probe are each complementary to a nucleic acid, or the complement thereof, encoding the structural protein VP7 of an equine rotavirus A, or a fragment thereof; and either ( i ) a rotavirus B VP6-specific forward PCR primer, a rotavirus B VP6-specific reverse PCR primer, and a labeled oligonucleotide, wherein the forward PCR primer, reverse PCR primer, and the labeled oligonucleotide probe are each complementary to a nucleic acid, or the complement thereof, encoding the structural protein VP6, or a fragment thereof, of an equine rotavirus B, or (ii) a rotavirus B non-structural protein 5 (NSP5)-specific forward PCR primer, a rotavirus B an NSP5-specific reverse PCR primer, and a labeled oligonucleotide probe, wherein the forward PCR primer, reverse PCR primer, and the labeled oligonucleotide probe are each complementary to a nucleic acid, or the complement thereof, encoding the non-structural protein NSP5, or a fragment thereof, of an equine rotavirus B. Regarding claims 1 and 4, Bailey discloses a panel of oligonucleotides for use in a multiplex reverse transcriptase-polymerase chain reaction (RT-PCR) assay for the identification of equine rotavirus A and B and genotypes thereof (pages 25-28, section 2.3 PCR Methods) , whereby the RT-PCRs were conducted with primers to rotavirus VP7 and NSP3 (Abstract , page 70 detection of rotaviruses in foal faecal samples sections 5.1 and 5.2 ). Therefore, the cited prior art anticipates the claimed invention. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103(a) which forms the basis for all obviousness rejections set forth in this Office action: (a) A patent may not be obtained though the invention is not identically disclosed or described as set forth in section 102 of this title, if the differences between the subject matter sought to be patented and the prior art are such that the subject matter as a whole would have been obvious at the time the invention was made to a person having ordinary skill in the art to which said subject matter pertains. Patentability shall not be negatived by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims under 35 U.S.C. 103(a), the examiner presumes that the subject matter of the various claims was commonly owned at the time any inventions covered therein were made absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and invention dates of each claim that was not commonly owned at the time a later invention was made in order for the examiner to consider the applicability of 35 U.S.C. 103(c) and potential 35 U.S.C. 102(e), (f) or (g) prior art under 35 U.S.C. 103(a). Claim s 2 and 5 are rejected under 35 U.S.C. 103(a) as being unpatentable over Bailey, "Investigation of the infectious causes of diarrhoea in Australian thoroughbred foals", 2017, University Library MINERVA Access, https://hdl.handle.net/11343/212071:1-186 ) as applied to claims 1 and 4 above , in view of Chen et al. “Chen” (CN108265127) and further in view of Ip (WO2005/027723) . The teachings of Bailey are outlined above and incorporated herein. The claims are directed to the panel of claim 1, wherein the primers and the labeled oligonucleotide probes are selected from the group consisting of: NVP3-FDeg, ACCATCTWCACRTRACCCTC (SEQ ID NO:29); NVP3-R1, GGTCACATAACGCCCCTATA (SEQ ID NO:30); NVP3-Probe, JUN-ATGAGCACAATAGTTAAAAGCTAACACTGTCAA-QSY (SEQ ID NO:31); RVA-G3-756F, GATGTTACCACGACCACTTGTA (SEQ ID NO:32): RVA-G3-872R, AGTTGGATCGGCCGTTATG (SEQ ID NO:33); RVA-G3-779P, FAM-TGGGACCACGAGAGAATGTAGCTGT-MGB (SEQ ID NO:34): RVA-G14-ARG869F, ATCCGACTACGGCTCCA (SEQ ID NO:35); RVA-G14-ARG1011R, TGCAGCAGAATTTAATGATCGC (SEQ ID NO:36): RVA-G14-ARG886P, VIC-CAGATTGGACGAATGATGCGTATAAATTGG-MGB (SEQ ID NO:37); ERVB-VP6-F, CATCCAGAGTGAATGGGAAGAC (SEQ ID NO:38); ERVB-VP6-R, TTCTAACGGCCAGCGAAATTA (SEQ ID NO:39); ERVB-VP6-P, LIZ-CCCTTACACGATACACGCACCGA-QSY (SEQ ID NO:40); ERVB-NSP5-F, GCCTTCTGATTCTACGTCAACTA (SEQ ID NO:41); ERVB-NSP5-R, CTTGTTGTACGCTTCTTCGTATTC (SEQ ID NO:42); and ERVB-NSP5-P, LIZ-AACATCAAGTCGTAGCGACGCAGT-QSY (SEQ ID NO:43), wherein each of the labeled oligonucleotide probes has a detectable label conjugated at each of the 5’ and the 3’ termini of the oligonucleotide. Regarding claims 2 and 5, Bailey does not disclose the primer sequences of claims 2 and 5. Chen, however, discloses rotavirus RNA detection PCR primer sequences of SEQ ID NOs: 29 and 30 of the instant invention having 100% sequence identity (see SEQ ID NO: 9 and SEQ ID NO: 10, respectively, of Chen). Additionally, Ip discloses a qRT -PCR assay for the detection of rotavirus and a probe having 100% sequence identity to SEQ ID NO: 31 (see SEQ ID NO: 2 of Ip). Accordingly, it would have been obvious to one of ordinary skill in the art to generate a panel of primers and probes as well as a method of utilizing the primers and probes for the detection of rotavirus as disclosed by Bailey, whereby the primer sequences of SEQ ID NOs: 29-3 0 and probe SEQ ID NO: 31 are utilized in the RT-PCR as disclosed by Chen and Ip. One of ordinary skill in the art would have been motivated to do so with a reasonable expectation of success given the fact that Chen and Ip demonstrate the amplification and detection of rotavirus using disclosed primers and probes for the advantage of optimizing the RT-PCR for having rapid identification as well as accurate, reliable determination of the presence of rotavirus infection in a subject . Moreover, it would have been obvious to one of ordinary skill in the art to combine said primers of Chen with the probe of Ip given the fact that the sequence primers and probes to the rotavirus were known in the prior art. Therefore, the claimed invention would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Barry Chestnut whose telephone number is (571)270-3546 . The examiner can normally be reached on M-Th 8:00 to 4:00 . If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas Visone can be reached on 571-270-0684 . The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /BARRY A CHESTNUT/ Primary Examiner, Art Unit 1672