Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
Claim Objections
Applicant is advised that should claims 5-10 be found allowable, claims 11-15 will be objected to under 37 CFR 1.75 as being a substantial duplicate thereof. Claims 5-10 describe a method of using the primers of claim 1, and claims 11-15 describe a method of using the kit of claim 3 (which is comprised solely of the primers). Therefore, there is no tangible difference between the two.
When two claims in an application are duplicates or else are so close in content that they both cover the same thing, despite a slight difference in wording, it is proper after allowing one claim to object to the other as being a substantial duplicate of the allowed claim. See MPEP § 608.01(m).
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1, 3, and 4 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a natural phenomenon (including a product of nature) without significantly more.
Subject Matter Eligibility Test (see MPEP § 2106):
Step 1: Are the claims to a process, machine, manufacture, or composition of matter?
Yes. The claims are directed towards:
Claim 1: “A composite primer set…”
Claim 3: “A kit …comprising: the composite primer set…”
Claim 4: “The kit according to claim 3…”
Step 2A: Are the claims directed to a judicial exception?
Prong 1: Do the claims recite an abstract idea, law of nature, or natural phenomenon?
Claim 1 recites a composite primer set comprising 26 different sequences. The kit of claim 3 and 4 is comprised solely of the aforementioned primer set. When searched, the primers showed 100% concordance with naturally occurring sequences derived from the Bos taurus genome. A selection of the sequence search results are shown below, but the concordance is present across all claimed sequences.
SEQ ID 1 compared to Accession# AC150691
PNG
media_image1.png
65
328
media_image1.png
Greyscale
SEQ ID 15 compared to Accession# AC173895
PNG
media_image2.png
50
279
media_image2.png
Greyscale
SEQ ID 6 compared to Accession# AC175343
PNG
media_image3.png
58
281
media_image3.png
Greyscale
SEQID 26 compared to Accession# AC159119
PNG
media_image4.png
55
287
media_image4.png
Greyscale
Prong 2: Do the claims recite additional elements that integrate the judicial exception into a practical application?
There are no additional elements in claim 1; therefore, the judicial exception is not integrated into a practical application.
An additional element of a kit is present in claims 3 and 4. As previously mentioned, the primer set is the only component of the kit. Simply placing the primer set into a kit does not meaningfully change the primer set itself and is considered insignificant extra-solution activity. The term "extra-solution activity" can be understood as activities incidental to the primary process or product that are merely a nominal or tangential addition to the claim. As explained by the Supreme Court, the addition of insignificant extra-solution activity does not amount to an inventive concept, particularly when the activity is well-understood or conventional. Parker v. Flook, 437 U.S. 584, 588-89, 198 USPQ 193, 196 (1978). See MPEP § 2106.05(g). Therefore, the addition of this element does not integrate the recited exception into a practical application.
A second additional element is present in claim 4. This element describes using the kit to perform species identification, individual identification, and kinship analysis on cattle. This does not amount to more than mere instructions for the use of the judicial exception. The recitation of claim limitations that attempt to cover any solution to an identified problem with no restriction on how the result is accomplished and no description of the mechanism for accomplishing the result, does not integrate a judicial exception into a practical application or provide significantly more because this type of recitation is equivalent to the words "apply it". See Electric Power Group, LLC v. Alstom, S.A., 830 F.3d 1350, 1356, 119 USPQ2d 1739, 1743-44 (Fed. Cir. 2016); Intellectual Ventures I v. Symantec, 838 F.3d 1307, 1327, 120 USPQ2d 1353, 1366 (Fed. Cir. 2016); Internet Patents Corp. v. Active Network, Inc., 790 F.3d 1343, 1348, 115 USPQ2d 1414, 1417 (Fed. Cir. 2015). See MPEP § 2106.05(f). Therefore, the addition of this element does not integrate the recited exception into a practical application.
Step 2B: Do the claims recite additional elements that amount to significantly more than the judicial exception?
There are no additional elements in claim 1. The element of the kit in claims 3 and 4, as previously discussed, amount to insignificant extra-solution activity that is well-understood, routine, and conventional activity in the field. Finally, the element in claim 4 describing use of the kit is no more than mere instructions. Individually, and together, the two elements of claim 4 represent well-understood, routine, and conventional activity in the field. Therefore, the additional elements of claims 1, 3, and 4 do not amount to significantly more than the judicial exception meaning these claims do not contain eligible subject matter.
Claim 2 is rejected under 35 U.S.C. 101 because the claimed invention is directed to non-statutory subject matter.
The claim does not fall within at least one of the four categories of patent eligible subject matter because claim 2 recites a use but fails to recite steps. "Use" claims that do not purport to claim a process, machine, manufacture, or composition of matter fail to comply with 35 U.S.C. 101. In re Moreton, 288 F.2d 708, 709, 129 USPQ 227, 228 (CCPA 1961)("one cannot claim a new use per se, because it is not among the categories of patentable inventions specified in 35 U.S.C. § 101 "). See MPEP § 2173.05(q). Therefore, claim 2 does not contain eligible subject matter.
Claim Rejections - 35 USC § 112
The following are quotations of 35 U.S.C. 112(b) and 35 U.S.C. 112(d):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following are quotations of 35 U.S.C. 112 (pre-AIA ), second and fourth paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claims 2 and 7 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 2 is indefinite as it merely recites a use without any active, positive steps delimiting how this use is actually practiced. See Ex parte Erlich, 3 USPQ2d 1011 (Bd. Pat. App. & Inter. 1986) (MPEP § 2173.05(q)).
Claim 7 contains the trademark/trade name “Q-Solution”. Where a trademark or trade name is used in a claim as a limitation to identify or describe a particular material or product, the claim does not comply with the requirements of 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph. See Ex parte Simpson, 218 USPQ 1020 (Bd. App. 1982). The claim scope is uncertain since the trademark or trade name cannot be used properly to identify any particular material or product. A trademark or trade name is used to identify a source of goods, and not the goods themselves. Thus, a trademark or trade name does not identify or describe the goods associated with the trademark or trade name. In the present case, the trademark/trade name is used to identify/describe a reagent used in a PCR amplification reaction and, accordingly, the identification/description is indefinite.
Claim 4 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 3: “A kit for identifying polymorphic markers of cattle…”
Claim 4: “The kit according to claim 3…”
On their face, each of these claims can be broadly interpreted as “the kit”. Therefore, they are both claiming the same product, meaning that claim 4 is not further limiting claim 3.
Although claim 4 contains the additional limitation of “wherein the kit is used to perform species identification, individual identification, and kinship analysis on cattle,” this is considered to be intended use language. Language that suggests or makes a feature or step optional but does not require that feature or step does not limit the scope under the broadest reasonable claim interpretation. See MPEP § 2103(I)(C).
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-5, 7-11, and 13-15 are rejected under 35 U.S.C. 102(a)1 as being anticipated by Xiong (Xiong et al. Chinese Journal of Forensic Medicine. 2022. Vol 37(2). 128-134).1
Regarding claim 1, the instant application claims 26 different sequences representing upstream and downstream primers for 13 different loci. Xiong constructed and validated a 13-locus STR multiplex amplification system in which the forward and reverse primers are the same as the upstream and downstream primers of the instant application (Table 1). Three of the loci are represented in the chart below for exemplarily comparison purposes, but the primers match across all claimed loci.
Locus
Sequence Comparison
TGLA126
Instant Application
TTGGTCCTCTATTCTCTGAATATTCC (SEQ ID: 1)
CTAATTTAGAATGAGAGAGGCTTCT (SEQ ID: 2)
Xiong
TTGGTCCTCTATTCTCTGAATATTCC (F)
CTAATTTAGAATGAGAGAGGCTTCT (R)
BT66
Instant Application
GCAGCATTTCTTTGGCTGTAAA (SEQ ID: 3)
GTGGTTGCCCGTTCATTA (SEQ ID: 4)
Xiong
GCAGCATTTCTTTGGCTGTAAA (F)
GTGGTTGCCCGTTCATTA (R)
BT165
Instant Application
GGATCTTCCCGATAACCC (SEQ ID: 5)
GTAGCAGCAGTAGCAGTTC (SEQ ID: 6)
Xiong
GGATCTTCCCGATAACCC (F)
GTAGCAGCAGTAGCAGTTC (R)
Regarding claims 2-5, 7, 8, 10, 11, 13, and 14, Xiong developed an STR multiplex amplification system to provide genotyping results using the aforementioned primers (addressed in claim 1 rejection) that could be used for bovine species identification, individual bovine identification, and paternity testing (abstract). This system utilizes a PCR amplification method in which the reaction mixture was comprised of 2X Multiplex PCR Master Mix, 5X Q-Solution, primers, deionized water, and genomic DNA (which, in the case of Xiong, was bovine DNA) (section 2.1). The following cycle conditions were used for the PCR reaction: 95oC for 15 min; 30 Cycles (94 oC for 30s, 57 oC for 90s, 72 oC for 90s); 60 oC for 60 min; storage at 4 oC (section 2.1).
Regarding claims 9 and 15, the primers of Xiong were fluorescently labeled with FAM, HEX, TRMRA, and ROX (section 1.2.3).
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 6 and 12 are rejected under 35 U.S.C. 103 as being unpatentable over Xiong.
The limitations of claims 5 and 11 (from which claims 6 and 12 respectively depend) are previously addressed in the 35 USC 102 rejection. While Xiong does not explicitly state the concentration at which each primer is present in their primer set, Xiong teaches that the PCR conditions used in their amplification system were optimized through repeated experimentation to ensure that the parameters used resulted in balanced and specific genotyping results (section 1.2.3). These parameters included the concentration of each primer in the primer set (section 1.2.3), as well as the amount of the primer set used in the final reaction mix (section 2.1). Xiong further teaches that the optimization of their primers was based upon the recommendations of Food and Agriculture Organization (FAO) and International Society for Animal Genetics (ISAG), and that the system was then further subjected to the stringent validation requirements of the Scientific Working Group for DNA Analysis Methods (SWGDAM) (introduction, para3).
Therefore, it would be obvious to one of ordinary skill in the art prior to the effective filling date of the claimed invention to optimize the PCR system of Xiong by trying different primer concentrations (and combinations of primer concentrations) through routine experimentation in order to generate the most reliable and accurate results.
Generally, differences in concentration or temperature will not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration or temperature is critical. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955) (see MPEP § 2144.05.II.A)
Allowable Subject Matter
No claims are allowed at this time.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Kara N Kovach whose telephone number is (571)272-8134. The examiner can normally be reached Monday - Friday, 9am - 3pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at (571) 272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/K.N.K./ Examiner, Art Unit 1681
/SAMUEL C WOOLWINE/ Primary Examiner, Art Unit 1681
1 Note that because a certified translation of the priority document has not been filed, the effective filing date is 7/19/2023. In addition, based on information found at https://d.wanfangdata.com.cn/periodical/zgfyxzz202202004, Xiong has a publication date of April 4, 2022, which is one year and five days prior to Applicant’s priority document filing date.