Prosecution Insights
Last updated: October 04, 2026
Application No. 18/358,551

COMPOSITIONS, METHODS AND DEVICES COMPRISING STEM-LOOP CAPTOR MOLECULES

Non-Final OA §101§102§103§112§DP
Filed
Jul 25, 2023
Priority
Jun 15, 2016 — provisional 62/350,689 +3 more
Examiner
TURPIN, ZACHARY MARK
Art Unit
1682
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Genecapture Inc.
OA Round
1 (Non-Final)
4%
Grant Probability
At Risk
1-2
OA Rounds
9m
Est. Remaining
-1%
With Interview

Examiner Intelligence

Grants only 4% of cases
4%
Career Allowance Rate
1 granted / 25 resolved
-56.0% vs TC avg
Minimal -5% lift
Without
With
+-5.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 12m
Avg Prosecution
52 currently pending
Career history
84
Total Applications
across all art units

Statute-Specific Performance

§101
8.2%
-31.8% vs TC avg
§103
33.8%
-6.2% vs TC avg
§102
15.9%
-24.1% vs TC avg
§112
26.0%
-14.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 25 resolved cases

Office Action

§101 §102 §103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority/Effective Filing Date The present application, filed on July 25, 2023, is a Continuation of 16/310,273, which was filed on December 14, 2018 and issued as US Patent No. 11,713,482 on August 1, 2023. Application No. 16/310,273 is a 371 of PCT/US2017037806, filed on June 15, 2017 and claims the benefit of US Provisional Patent Application Nos. 62/350,689, filed June 15, 2016 and 62/382,754, filed September 1, 2016. Election/Restrictions Applicant's election without traverse of Group I, claims 1-2, 5-8, 10-11 and 16-18 in the reply filed on June 25, 2026 is acknowledged. Applicant’s election with traverse of “a captor molecule identified by SEQ ID NO.2, a probe identified by SEQ ID NO. 1, and a helper oligo identified by SEQ ID NO. 324” in the reply filed on June 25, 2026 is acknowledged. It is noted that claims 16 and 17 recite “captor molecules selected from… SEQ ID NO: 1” and “probes selected from… SEQ ID NO: 2” respectively. It appears that the election contains typographical errors contradicting the claim language (i.e. “a captor molecule… SEQ ID NO. 2”). The examiner has not considered “a captor molecule identified by SEQ ID NO. 2”, as specified in the response, but rather captor molecules as defined by the claims. The traversal is on the grounds that “A requirement for restriction is permissible if there is a patentable difference between the species as claimed and there would be a serious burden on the examiner if restriction is not required… Applicant asserts that the latter standard is not met and that examination of all species would not be a burden to the Examiner. This is not found persuasive because each individual combination of a captor, a probe, and a helper oligo is specific to a different target nucleic acid, wherein the genus of target nucleic acids not only comprise different nucleotide sequences and structures having highly divergent functions, but further are derived from different genomes spanning multiple domains of life and comprising distinct viral genomes (see table I in the specification). Said genomes range from E coli (e.g. SEQ ID NO. 1), Staphylococcus aureus (e.g. SEQ ID NO. 8), Chikungunya virus (CHIKV) (e.g. SEQ ID NO. 25), to human microRNAs (e.g. Let-7a-5p-p, SEQ ID No. 131). Furthermore, the claimed genus apparently encompasses more than 300 captor probes, combined with any one of 11 claimed helper oligos and any of 7 claimed probes (i.e. 300x11x7 or 23,100 combinations). The requirement is still deemed proper and is therefore made FINAL. Claims 19-22, 24, 28-29 and 31 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on June 25, 2026. Claim Status/Action Summary Claims 1-2, 5-8, 10-11, 16-22, 24, 28-29, and 31 are currently pending. As described above, Claims 19-22, 24, 28-29 and 31 are withdrawn as directed to a nonelected invention. Claims 1-2, 5-8, 10-11, and 16-18 are currently under examination. Drawings The drawings filed July 25, 2023 are acceptable. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. Claims 1-2, 5-8, 10-11, and 16-18 are rejected under 35 U.S.C. 112(b) as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, regards as the invention. Claim 1 recites the claim limitation “wherein individual captor molecules are spaced apart from one another at a distance to prevent captor molecule-dimers”. It is unclear whether this distance (which is functionally defined, i.e. any distance wherein captor molecule-dimers do not occur) is intended to require that the captor molecules are separated by some definite distance based upon the linker length and the length of the captor molecules, the length of the captor molecules alone, or something else. The term “general negative control” in claim 1 is a relative term which renders the claim indefinite. The term “general negative control” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. It is unclear whether the “general” negative control is intended to broadly cover any negative control captor molecule, or to require something more of the negative control captor molecule. Claim 2 recites “wherein the captor molecules are spaced apart from each by at least…”. It is unclear whether this is a typographical omission of “each other”, or whether the recited spacing is intended to be relative to some other unspecified structure (e.g. a surface-linked dendron structure). Claim 2 recites “captor molecules are spaced apart from each by at least half of the length of the closed hairpin of the captor molecule” and depends from claim 1, which recites “one or more types of captor molecules”. On page 9, the specification defines ““half the length of the average closed captor molecule” refers to the arithmetic mean of the molecular length of a plurality of captor molecules applied to the substrate”. It is unclear whether claim 2 “half the length of the closed hairpin” is intended to invoke this special definition for “one or more types” of captor molecules defined by a mean length of the oligonucleotide, or if it is intended to require that all of the distances are defined by one (unspecified) captor within the plurality of captors, or further if it is intended to require that the distance is half the length of the closed hairpin (i.e. the distance from the surface to the furthest point of the loop domain in nm) or (i.e. the length of the entire oligonucleotide in nm) or (i.e. the length between one end of the oligonucleotide and the furthest point of the loop domain in nm). A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, claim 8 recites the broad recitation “ionic surfactants”, and the claim also recites “sodium dodecyl sulfate” which is the narrower statement of the limitation. The claim is considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims. Claim 8 recites “sodium dodecyl sulfate at concentrations from 0.005% to 0.2% v/v”. It is noted that sodium dodecyl sulfate (SDS) is a solid from which various solutions may be prepared each having a different quantity of dissolved SDS per unit volume of solution (e.g. 1% weight/volume SDS, 1mM SDS, 10mg/mL SDS, etc.). It is unclear what is meant by a volume/volume concentration of SDS. For example, a 0.2% wt/vol solution of SDS means: 1.1g SDS/550mL solution, while a 0.2% v/vol solution of SDS (given a density of 1.1g/cm3 for SDS) means: 1 cm3 SDS/500 cm3 solution. It is clear that these two concentrations are not equal, as 1.1g SDS = 1 cm3 SDS and the corresponding volumes of solution required for a 0.2% weight/volume or volume/volume differ (550 vs 500 cm3). Claims 2, 5-8, 10-11, and 16-18 are additionally indefinite because of their dependence from, and thus inclusion of the indefinite limitations of, claim 1. Claim Interpretation Claim 1 recites “a distance to prevent captor molecule-dimers”, “conditions that allow for hybridization…”, and “a detectable probe that is capable of binding…”. All of these claim terms have been interpreted broadly, as encompassing: any distance under any conditions in any assay device for which captor molecules do not form dimers, any detectable probe that may bind to a captor molecule, and any conditions (e.g. temperature, salt concentration, formamide concentration, citrate or ascorbate concentration, etc.) under which a probe binds to a captor molecule. While there is not a special limiting definition of the term “helper oligo” in the specification, this claim term has been interpreted as known in the art, exemplified by Fuchs et al., “Unlabeled Helper Oligonucleotides Increase the In Situ Accessibility to 16S rRNA of Fluorescently Labeled Oligonucleotide Probes” Applied and Environmental Microbiology Vol. 66. No. 8, p. 3603-3607 (2000): “unlabeled oligonucleotides, so-called helpers, in an attempt to open inaccessible regions on the 16S rRNA of E. coli for fluorescently labeled oligonucleotides. This work was inspired by publications of O’Meara et al. (14) and Niemeyer et al. (13), who observed an enhanced binding of oligonucleotide probes on isolated nucleic acids when using oligonucleotides complementary to regions neighboring the probe target site.” (Fuchs, page 3603, column 1, paragraph 2). Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 1-2, 5, 8, and 10-11 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Boateng et al. (2012), “Dendron-modified surfaces provide an ideal environment for stem-loop DNA probes” Analytical Biochemistry 430 (2012) 39-44. Regarding claim 1, Boateng et al. (2012), teach methods for detecting target nucleic acids comprising contacting target molecules to stem-loop DNA probes (i.e. “captors”) attached to a substrate of a DNA microarray (i.e. an “assay device”). Boateng et al. (2012) further teach the captors are attached by an “attachment modification” to a “dendron” that is functionalized with an aldehyde for incorporation onto the surface of a glass slide (i.e. a linker to the substrate) (Boateng et al. (2012), figure 1 and 2; see below). PNG media_image1.png 541 808 media_image1.png Greyscale PNG media_image2.png 395 655 media_image2.png Greyscale Boateng et al. (2012) further teach an “immobilization control probe” (i.e. a “general control captor molecule attached to the substrate”) (Boateng et al. (2012), table 1). Boateng et al. (2012) further teach hybridizing the target nucleic acids to the captors in buffering conditions allowing hybridization between the target and the captors (Boateng et al. (2012), page 41, column 1-2, bridging paragraph). Boateng et al. (2012) further teach adding a detectable probe that binds to the captor molecule and detecting the detectable probe on the microarray (i.e. amount and location) (Boateng et al. (2012) table 1) and page 41). Therefore, Boateng et al. (2012) teach each and every method step recited by the present claim arranged exactly as recited in the claim. Regarding claim 2, Boateng et al. (2012) teach the captors are linked to dendrons spaced 4 or 7 nm apart. The captor probes taught by Boateng et al. (2012) are ~57 nucleotides in length. When entirely unfolded (single stranded), this corresponds to approximately 0.64 nm * 57 nucleotides or about 36.5 nanometers. When entirely folded into a closed hairpin, this corresponds to approximately 0.34 nm * 16 nucleotides (the length of the stem) or about 5.44 nanometers. Therefore, “half the length of the closed hairpin” taught by Boateng et al. (2012) is about 2.7 nanometers. As such, Boateng et al. (2012) teach the captors are spaced at either 4 or 7 nm (i.e. at least half the length of the closed hairpin). Regarding claim 5, Boateng et al. (2012) teach testing a range of target nucleic acid concentrations on the assay device (i.e. concentrating the target nucleic acids) (Boateng et al. (2012), figure 8). Regarding claim 8, as described above, the recited SDS concentration is equivalent to either 1.1g/550 mL or 1.1 g/500 mL SDS. This is equivalent to either 6.911 mM or 7.602 mM SDS. Boateng et al. (2012) teach hybridization buffers comprising 7.0 mM SDS (i.e. an ionic surfactant) (Boateng et al. (2012), page 71). Regarding claim 10, Boateng et al. (2012) teach the detector comprises fewer nucleotides (i.e. 16 nucleotides) that are complementary to the stem region of the captor NEG915 than the total number of nucleotides in the stem region of the captor (17 base pairs) (see annotated sequence from Boateng et al. (2012) Table 1 below). Underlined nucleotides comprise the self-complementary “stem” region. Bold nucleotides are the detector and complementary sequence. Neg915: 5’NH2-agacagacagacagacaTGTAGAAAAATAACCGGTTGAAAAtgtctgtctgtctgtc-3’ Detector: 5’Cy3-GACAGACAGACAGACA-3’ Regarding claim 11, Boateng et al. (2012) teach the assay device is soaked in prehybridization washing solution comprising BSA (bovine serum albumin) (i.e. a “competitive binding inhibitor”) (Boateng et al. (2012), page 41, column 1-2, paragraph 3-column 2, paragraph 1). Claims 1-2, 5, 8, and 10 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Valat et al., US 2006/0199183 A1 (published 2006). Regarding claims 1-2, Valat et al. teach methods for detecting target nucleic acids comprising contacting target nucleic acids to captor molecules attached to a substrate of an array device, wherein the captor is linked to a substrate by a linker, the target hybridizes to the captor, and the detectable probe hybridizes to the captor after the target hybridization (and opening of the captor hairpin) (Valat et al., figure 2A-B and 3A, see below). PNG media_image5.png 240 669 media_image5.png Greyscale Valat et al. further teach including non-specific reference control sequences to estimate the contribution of background and cross-hybridization signal (Valat et al., paragraph 0120-0122). Valat et al. further teach the captor molecules are attached to the biochip in a density corresponding to up to 100 probes per cm2 of the surface (i.e. assuming uniform distribution, having an average probe-probe distance of ~1mm (much greater than half the length of the closed hairpin)) (Valat et al., paragraph 0107). Regarding claim 5, Valat et al. teach the target nucleic acids are extracted from cells (i.e. are concentrated) (Valat et al., paragraph 0112). Regarding claim 8, Valat et al. teach buffering conditions comprising SDS at 0.1% (Valat et al., paragraph 0119). Regarding claim 10, Valat et al. teach the detectable probe comprises fewer nucleotides that are complementary to a stem region than the total number of nucleotides in the stem region (Valat et al., figure 7). Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-2, 5-6, 8, and 10-11 are rejected under 35 U.S.C. 103 as being unpatentable over Boateng et al. (2012), “Dendron-modified surfaces provide an ideal environment for stem-loop DNA probes” Analytical Biochemistry 430 (2012) 39-44 in view of Fuchs et al., “Unlabeled Helper Oligonucleotides Increase the In Situ Accessibility to 16S rRNA of Fluorescently Labeled Oligonucleotide Probes” Applied and Environmental Microbiology, Vol. 66, No. 8, p. 3603-3607 (2000). Regarding claim 1, Boateng et al. (2012), teach methods for detecting target nucleic acids comprising contacting target molecules to stem-loop DNA probes (i.e. “captors”) attached to a substrate of a DNA microarray (i.e. an “assay device”). Boateng et al. (2012) further teach the captors are attached by an “attachment modification” to a “dendron” that is functionalized with an aldehyde for incorporation onto the surface of a glass slide (i.e. a linker to the substrate) (Boateng et al. (2012), figure 1 and 2; see below). PNG media_image1.png 541 808 media_image1.png Greyscale PNG media_image2.png 395 655 media_image2.png Greyscale Boateng et al. (2012) further teach an “immobilization control probe” (i.e. a “general control captor molecule attached to the substrate”) (Boateng et al. (2012), table 1). Boateng et al. (2012) further teach hybridizing the target nucleic acids to the captors in buffering conditions allowing hybridization between the target and the captors (Boateng et al. (2012), page 41, column 1-2, bridging paragraph). Boateng et al. (2012) further teach adding a detectable probe that binds to the captor molecule and detecting the detectable probe on the microarray (i.e. amount and location) (Boateng et al. (2012) table 1) and page 41). Regarding claim 2, Boateng et al. (2012) teach the captors are linked to dendrons spaced 4 or 7 nm apart. The captor probes taught by Boateng et al. (2012) are ~57 nucleotides in length. When entirely unfolded (single stranded), this corresponds to approximately 0.64 nm * 57 nucleotides or about 36.5 nanometers. When entirely folded into a closed hairpin, this corresponds to approximately 0.34 nm * 16 nucleotides (the length of the stem) or about 5.44 nanometers. Therefore, “half the length of the closed hairpin” taught by Boateng et al. (2012) is about 2.7 nanometers. As such, Boateng et al. (2012) teach the captors are spaced at either 4 or 7 nm (i.e. at least half the length of the closed hairpin). Regarding claim 5, Boateng et al. (2012) teach testing a range of target nucleic acid concentrations on the assay device (i.e. concentrating the target nucleic acids) (Boateng et al. (2012), figure 8). Regarding claim 6, Boateng et al. (2012) do not teach adding helper oligonucleotides to the target nucleic acids. However, Fuchs et al. teach adding helper oligonucleotides prior to contacting the target polynucleotides with probe open inaccessible polynucleotide regions on the target polynucleotide by suppressing the formation of secondary structures. Fuchs et al. further teach the suppression of secondary structures in the target polynucleotide enhances signal, and that the most effective enhancement is achieved by directly adjacent helper oligonucleotides and by helpers targeting the region complementary to the probe target site (Fuchs et al., page 3604, column 2, paragraph 4-5). Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have modified the methods taught by Boateng et al. (2012) with the teachings of Fuchs et al. that adding helper oligos to target nucleic acids prior to contacting the target nucleic acids with probes increases the signal of said probes. The ordinary artisan would have been motivated to apply the teachings of Fuchs et al. to the method of Boateng et al. (2012) because of the teaching of Fuchs et al. that helper probes improve “capture of single-stranded DNA on a microchip” (Fuchs et al., page 3604, column 2), and increase prove fluorescence observed for a number of probes to a structured target nucleic acid (Fuchs et al., table 2). Regarding claim 8, as described above, the recited SDS concentration is equivalent to either 1.1g/550 mL or 1.1 g/500 mL SDS. This is equivalent to either 6.911 mM or 7.602 mM SDS. Boateng et al. (2012) teach hybridization buffers comprising 7.0 mM SDS (i.e. an ionic surfactant) (Boateng et al. (2012), page 71). Regarding claim 10, Boateng et al. (2012) teach the detector comprises fewer nucleotides (i.e. 16 nucleotides) that are complementary to the stem region of the captor NEG915 than the total number of nucleotides in the stem region of the captor (17 base pairs) (see annotated sequence from Boateng et al. (2012) Table 1 below). Underlined nucleotides comprise the self-complementary “stem” region. Bold nucleotides are the detector and complementary sequence. Neg915: 5’NH2-agacagacagacagacaTGTAGAAAAATAACCGGTTGAAAAtgtctgtctgtctgtc-3’ Detector: 5’Cy3-GACAGACAGACAGACA-3’ Regarding claim 11, Boateng et al. (2012) teach the assay device is soaked in prehybridization washing solution comprising BSA (bovine serum albumin) (i.e. a “competitive binding inhibitor”) (Boateng et al. (2012), page 41, column 1-2, paragraph 3-column 2, paragraph 1). Claims 1-2, 5, 7-8, and 10-11 are rejected under 35 U.S.C. 103 as being unpatentable over Boateng et al. (2012), “Dendron-modified surfaces provide an ideal environment for stem-loop DNA probes” Analytical Biochemistry 430 (2012) 39-44 in view of Bradley et al., JP 2004500867 A (2004) The teachings of Boateng et al. (2012) related to claims 1-2, 5, 8, and 10-11 are described in the 102(a)(1) and 103 rejections above. Regarding claim 7, Boateng et al. (2012) teaches post-hybridization washing to remove unbound probe using hybridization buffer (saline-sodium phosphate-EDTA), 2x sodium saline citrate (SSC), and 1x SSC. Boateng et al. (2012) does not teach adding a solution comprising ascorbic acid and removing the unbound probe. However, Bradley et al. teach improved methods for hybridization of genomic DNA (i.e. target nucleic acids) to microarrays (Bradley et al., paragraph 003) comprising modified hybridization and/or wash buffers comprising at least one antioxidant that improves signal to noise ratio by inhibiting oxidation of a fluorescent label attached to a detectable probe (Bradley et al., paragraph 0012-0017). Bradley et al. further teach ascorbic acid is an antioxidant suitable for preventing oxidation of a fluorescent probe (Bradley et al., paragraph 0017). Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have modified the methods taught by Boateng et al. (2012) with the teachings of Bradley et al. comprising antioxidant-containing hybridization/wash buffers for improved fluorescent probe signal in nucleic acid assays comprising microarrays (i.e. methods for detecting target molecules comprising capture probes attached to a substrate of an assay device…). The ordinary artisan would have been motivated to modify the wash buffer of Boateng et al. (2012) to further comprise ascorbic acid because of the teaching of Bradley et al. that the signal obtained from fluorescently labeled probes that are protected from oxidation during hybridization and wash steps by the inclusion of ascorbic acid is dramatically increased relative to control (Bradley et al., paragraph 0033). Claims 1-2, 5, 8, 10-11, and 16-18 are rejected under 35 U.S.C. 103 as being unpatentable over Boateng et al. (2012), “Dendron-modified surfaces provide an ideal environment for stem-loop DNA probes” Analytical Biochemistry 430 (2012) 39-44 in view of Boateng et al. (2013) “Novel stem-loop probe DNA arrays: Detection of specific acetotrophic 16S ribosomal RNA signatures” Analytical Biochemistry 435 (2013) 60-67 and Fuchs et al., “Unlabeled Helper Oligonucleotides Increase the In Situ Accessibility to 16S rRNA of Fluorescently Labeled Oligonucleotide Probes” Applied and Environmental Microbiology, Vol. 66, No. 8, p. 3603-3607 (2000). The teachings of Boateng et al. (2012) related to claims 1-2, 5, 8, and 10-11 are described in the 102(a)(1) and 103 rejections above. Regarding claim 16, Boateng et al. (2012) teach the captor molecule NEG915 (see annotated sequence from Boateng et al. (2012) Table 1 below). Underlined nucleotides comprise the self-complementary “stem” region. Bold nucleotides are identical between the claimed captor molecule and the reference (Boateng et al. (2012)). Neg915: 5’NH2-agacagacagacagacaTGTAGAAAAATAACCGGTTGAAAAtgtctgtctgtctgtc-3’ The claimed captor molecule SEQ ID NO: 1 is: 5’ gacagacagacagacactcaagcttgccagtatcagatgctgtctgtctgtctgtc 3’. Boateng et al. (2013) further teaches a set of different captor molecules comprising the same stem sequences and having target-specific loop sequences (Uppercase letters below) (Boateng et al. (2013), table 1), wherein “the target sequences were derived using the online rRNA-targeted oligonucleotide probe database probeBase and verified using the Ribosomal Database project and GenBank (Boateng et al. (2013), page 61, column 2, paragraph 1). PNG media_image6.png 266 720 media_image6.png Greyscale Indeed, the remainder of SEQ ID NO. 1 (that is not the hairpin domain shared among all of the captor molecules taught by Boateng et al. (2012 and 2013) matches exactly with hundreds of known E. coli 16S rRNA sequences in Genbank (See NCBI BLAST result and alignment with Genbank MN208099.1 below). PNG media_image7.png 837 1244 media_image7.png Greyscale PNG media_image8.png 283 839 media_image8.png Greyscale Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have modified the methods taught by Boateng comprising inserting a naturally occurring 16S rRNA target sequence between the hairpin sequences shared among all of the captor probes taught by Boateng with the known, naturally occurring 16S rRNA sequence taught by Genbank (MN208099.1). The ordinary artisan would have been motivated to modify the methods and probes taught by Boateng for detection of E. coli because of the teaching of Boateng (2013) that direct detection of target sequences comprising captor probes allowed for the direct detection of bacterial 16S rRNA in sewage sludge (Boateng et al. (2013), page 66, column 1, paragraph 1). The ordinary artisan would have readily chosen E. coli rRNA sequences for any of a variety of well-known environmental surveillance applications such as: treated effluent from wastewater treatment facilities, beach contamination, contamination of food/food processing equipment, etc.). Regarding claim 17, Boateng et al. (2012) teach a “detector” (i.e. a detectable probe) having the sequence: 5’Cy3-GACAGACAGACAGACA-3’. The claimed sequence SEQ ID NO: 2, 5’ GACAGACAGACAG 3’ is entirely comprised within the sequence of the detector taught by Boateng et al. Absent unexpected results or persuasive secondary considerations, the claimed SEQ ID NO: 2 appears to be a variant of the detector probe taught by Boateng et al. (2012) that one having ordinary skill in the art would have reasonably expected to function similarly to the previously published “detector” because the “detector” probe is a polynucleotide sequence differing from the claimed sequence only in that it comprises 3 additional nucleotides at the 3’ end of the molecule that also are complementary to the stem region taught by both the prior art (Boateng et al.) and the claimed SEQ ID NO: 1. Regarding claim 18, the helper oligonucleotide SEQ ID NO: 324 is 100% identical to hundreds of naturally occurring e. coli genomic DNA corresponding to 16S rRNA. PNG media_image9.png 804 1243 media_image9.png Greyscale PNG media_image10.png 253 797 media_image10.png Greyscale As described above, Fuchs et al. teach selecting naturally occurring 16S rRNA sequences as “helper oligonucleotides”, wherein the use of helpers in microarray methods for detection of 16S rRNA enhanced the fluorescence signal of all six probes examined by at least fourfold (Fuchs et al., Abstract). Absent unexpected results or persuasive secondary considerations, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have selected a naturally occurring 16S rRNA sequence as a “helper oligonucleotide” (e.g. SEQ NO: 324) because of the teaching of Fuchs et al. that the use of helpers enhanced the fluorescence signal of all six probes examined by at least fourfold (Fuchs et al., Abstract). Claims 1-2, 5, 8, and 10-11 are rejected under 35 U.S.C. 103 as being unpatentable over Pusey et al., US 7,291,459 B2 (issued 2007) in view of Boateng et al. (2012), “Dendron-modified surfaces provide an ideal environment for stem-loop DNA probes” Analytical Biochemistry 430 (2012) 39-44. Regarding claim 1, Pusey et al. teach methods for detecting target nucleic acid molecules comprising contacting substrate-bound captor probes with target nucleic acids in buffering conditions allowing for hybridization between the target and captor, adding a detectable probe that binds to a captor molecule, and detecting the detectable probe (Pusey et al., figure 5). PNG media_image11.png 414 476 media_image11.png Greyscale Pusey et al. do not teach using a negative control captor molecule attached to the substrate, nor that the captor molecules are spaced apart at a distance to prevent captor molecule dimers. However, Boateng et al. (2012) teach closely related methods for target nucleic acid detection (Boateng et al. (2012), figure 1 and 2 below). PNG media_image1.png 541 808 media_image1.png Greyscale PNG media_image2.png 395 655 media_image2.png Greyscale Boateng et al. teach an “immobilization control probe” (i.e. a “general control captor molecule attached to the substrate”) (Boateng et al. (2012), table 1). Boateng et al. (2012) further teach hybridizing the target nucleic acids to the captors in buffering conditions allowing hybridization between the target and the captors (Boateng et al. (2012), page 41, column 1-2, bridging paragraph). Boateng et al. (2012) further teach adding a detectable probe that binds to the captor molecule and detecting the detectable probe on the microarray (i.e. amount and location) (Boateng et al. (2012) table 1) and page 41). Boateng et al. (2012) teach the captors are linked to dendrons spaced 4 or 7 nm apart. The captor probes taught by Boateng et al. (2012) are ~57 nucleotides in length. When entirely unfolded (single stranded), this corresponds to approximately 0.64 nm * 57 nucleotides or about 36.5 nanometers. When entirely folded into a closed hairpin, this corresponds to approximately 0.34 nm * 16 nucleotides (the length of the stem) or about 5.44 nanometers. Therefore, “half the length of the closed hairpin” taught by Boateng et al. (2012) is about 2.7 nanometers. As such, Boateng et al. (2012) teach the captors are spaced at either 4 or 7 nm (i.e. at least half the length of the closed hairpin). Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have modified the methods taught by Pusey et al. with the methods of Boateng et al. comprising negative control captor molecules and substrates having spacing preventing captor-captor dimerization because of the teachings of Boateng et al. that the negative control allows for subtraction of non-specific background signals and the substrate spacing allows for a higher capacity for binding captors while not forming dimers (Boateng et al., page 42). Regarding claim 2, Boateng et al. (2012) teach the captors are linked to dendrons spaced 4 or 7 nm apart. The captor probes taught by Boateng et al. (2012) are ~57 nucleotides in length. When entirely unfolded (single stranded), this corresponds to approximately 0.64 nm * 57 nucleotides or about 36.5 nanometers. When entirely folded into a closed hairpin, this corresponds to approximately 0.34 nm * 16 nucleotides (the length of the stem) or about 5.44 nanometers. Therefore, “half the length of the closed hairpin” taught by Boateng et al. (2012) is about 2.7 nanometers. As such, Boateng et al. (2012) teach the captors are spaced at either 4 or 7 nm (i.e. at least half the length of the closed hairpin). Regarding claim 5, Boateng et al. (2012) teach testing a range of target nucleic acid concentrations on the assay device (i.e. concentrating the target nucleic acids) (Boateng et al. (2012), figure 8). Regarding claim 8, as described above, the recited SDS concentration is equivalent to either 1.1g/550 mL or 1.1 g/500 mL SDS. This is equivalent to either 6.911 mM or 7.602 mM SDS. Boateng et al. (2012) teach hybridization buffers comprising 7.0 mM SDS (i.e. an ionic surfactant) (Boateng et al. (2012), page 71). Regarding claim 10, Boateng et al. (2012) teach the detector comprises fewer nucleotides (i.e. 16 nucleotides) that are complementary to the stem region of the captor NEG915 than the total number of nucleotides in the stem region of the captor (17 base pairs) (see annotated sequence from Boateng et al. (2012) Table 1 below). Underlined nucleotides comprise the self-complementary “stem” region. Bold nucleotides are the detector and complementary sequence. Neg915: 5’NH2-agacagacagacagacaTGTAGAAAAATAACCGGTTGAAAAtgtctgtctgtctgtc-3’ Detector: 5’Cy3-GACAGACAGACAGACA-3’ Regarding claim 11, Boateng et al. (2012) teach the assay device is soaked in prehybridization washing solution comprising BSA (bovine serum albumin) (i.e. a “competitive binding inhibitor”) (Boateng et al. (2012), page 41, column 1-2, paragraph 3-column 2, paragraph 1). Double Patenting A rejection based on double patenting of the “same invention” type finds its support in the language of 35 U.S.C. 101 which states that “whoever invents or discovers any new and useful process... may obtain a patent therefor...” (Emphasis added). Thus, the term “same invention,” in this context, means an invention drawn to identical subject matter. See Miller v. Eagle Mfg. Co., 151 U.S. 186 (1894); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Ockert, 245 F.2d 467, 114 USPQ 330 (CCPA 1957). A statutory type (35 U.S.C. 101) double patenting rejection can be overcome by canceling or amending the claims that are directed to the same invention so they are no longer coextensive in scope. The filing of a terminal disclaimer cannot overcome a double patenting rejection based upon 35 U.S.C. 101. Claims 1-2, 5-8, 10-11, and 16-18 are rejected under 35 U.S.C. 101 as claiming the same invention as that of claims 1, 2, 4, 13, 5, 6, 7, 8, 14, 12, and 13 of prior U.S. Patent No. 11,713,482 (herein referred to as ‘482). This is a statutory double patenting rejection. It is noted that the present application is a continuation of 16/310,273, from which 11,713,482 was issued. See 35 U.S.C. 121. Claim 1 of ‘482 reads: PNG media_image12.png 385 409 media_image12.png Greyscale The present claim 1 reads: PNG media_image13.png 241 464 media_image13.png Greyscale Therefore, the present claim 1 and claim 1 of ‘482 are essentially identical, diverging only in that ‘482 recites “detecting… the detectable probe specifically bound to captor-molecules and negative controls…”, while the instant claim does not recite that the detectable probe is “specifically bound to captor-molecules and negative controls”. Present claim 2 is identical to claim 2 of ‘482. Similarly, present claim 5 is identical to claim 4 of ‘482. Present claim 6 is anticipated by claim 13 of ‘482. Present claim 7 is identical to claim 5 of ‘482. Present claim 8 is identical to claim 6 of ‘482. Present claim 10 is identical to claim 7 of ‘482. Present claim 11 is identical to claim 8 of ‘482. Present claim 16 is anticipated by claim 14 of ‘482. Present claim 17 is anticipated by claim 12 of ‘482. Present claim 18 is anticipated by claim 13 of ‘482. The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claim 1 is rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1 of U.S. Patent No. 7,291,459 (herein referred to as ‘459) in view of Boateng et al. (2012), “Dendron-modified surfaces provide an ideal environment for stem-loop DNA probes” Analytical Biochemistry 430 (2012) 39-44. Present claim 1 reads: PNG media_image13.png 241 464 media_image13.png Greyscale Claim 1 of ‘459 reads: PNG media_image14.png 283 412 media_image14.png Greyscale The present claim 1 differs from claim 1 of ‘459 only in that the present claim requires “one or more general negative control captor molecules attached to the substrate” and “individual captors are spaced apart from one another at a distance to prevent captor molecule-dimers”. However, Boateng et al. (2012) teach an “immobilization control probe” (i.e. a “general control captor molecule attached to the substrate”) (Boateng et al. (2012), table 1). Boateng et al. (2012) further teach hybridizing the target nucleic acids to the captors in buffering conditions allowing hybridization between the target and the captors (Boateng et al. (2012), page 41, column 1-2, bridging paragraph). Boateng et al. (2012) further teach adding a detectable probe that binds to the captor molecule and detecting the detectable probe on the microarray (i.e. amount and location) (Boateng et al. (2012) table 1) and page 41). Boateng et al. (2012) teach the captors are linked to dendrons spaced 4 or 7 nm apart. The captor probes taught by Boateng et al. (2012) are ~57 nucleotides in length. When entirely unfolded (single stranded), this corresponds to approximately 0.64 nm * 57 nucleotides or about 36.5 nanometers. When entirely folded into a closed hairpin, this corresponds to approximately 0.34 nm * 16 nucleotides (the length of the stem) or about 5.44 nanometers. Therefore, “half the length of the closed hairpin” taught by Boateng et al. (2012) is about 2.7 nanometers. As such, Boateng et al. (2012) teach the captors are spaced at either 4 or 7 nm (i.e. at least half the length of the closed hairpin). Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have modified the method claimed by ‘459 with the teachings of Boateng et al. (2012) to further comprise a negative control captor molecule and the well-known reagents (also taught by Boateng et al) for spacing probes on an array such that the probes do not hybridize with each other. Conclusion The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. Each of the following references discloses various methods similar to those claimed by the present application for detecting target nucleic acids by DNA microarrays and/or using helper oligonucleotides. Broude et al., “DNA microarrays with stem-loop DNA probes: preparation and applications” Nucleic Acids Research 2001, Vol. 29, No. 19 Kaplinski et al., “Detection of tmRNA molecules on microarrays at low temperatures using helper oligonucleotides” BMC Biotechnology 2010, 10:34 Xia et al., “Evaluating oligonucleotide properties for DNA microarray probe design” Nucleic Acids Research, 2010, Vol. 38, No. 11 Liao et al. “Development of an Advanced Electrochemical DNA Biosensor for Bacterial Pathogen Detection” Journal of Molecular Diagnostics, 2007, Vol. 9, No. 2 Dandy et al., “Array feature size influences nucleic acid surface capture in DNA microarrays” PNAS, 2007, Vol. 104, No. 20, p 8223-8228 Liu et al., “Effects of Target Length on the Hybridization Efficiency and Specificity of rRNA-Based Oligonucleotide Microarrays” Applied and Environmental Microbiology 2007, Vol. 73, No. 1, p. 73-82 Taylor et al., “Impact of surface chemistry and blocking strategies on DNA microarrays” Nucleic Acids Research 2003, Vol. 31, No. 16 Iqbal et al., US 20100201381 A1 Becker et al., US 7070925 B1 Jack US 20150045254 A1 Li et al., US 20040086879 A1 No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ZACHARY MARK TURPIN whose telephone number is (703)756-5917. The examiner can normally be reached Monday-Friday 8:00 am - 5:00 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Winston Shen can be reached at 5712723157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /Z.M.T./Examiner, Art Unit 1682 /WU CHENG W SHEN/Supervisory Patent Examiner, Art Unit 1682
Read full office action

Prosecution Timeline

Jul 25, 2023
Application Filed
Aug 24, 2026
Non-Final Rejection mailed — §101, §102, §103 (current)

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
4%
Grant Probability
-1%
With Interview (-5.0%)
3y 12m (~9m remaining)
Median Time to Grant
Low
PTA Risk
Based on 25 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month