DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant's election with traverse of Invention I (claims 1-16) in the reply filed on 04/02/2026 is acknowledged. The traversal is on the ground(s) that the sgRNA of the instant invention is not suitable for use as a nucleic acid size marker when analyzing nucleic acid samples via agarose gel electrophoresis, as the claimed sgRNA is functionally defined by its specific targeting of human Aqp1 RNA and thus the alleged alternative use is based on a superficial similarity rather than substantive technical analysis. Applicant asserts that the sgRNA and its therapeutic method of use are inextricably intertwined as an integrated invention. This is not found persuasive because while the Examiner acknowledges that the claimed sgRNA is functionally defined by its ability to target human Aqp1 RNA for therapeutic purposes, it is nonetheless a nucleic acid species that may be further analyzed by and/or utilized in agarose gel electrophoresis. As set forth in MPEP § 806.05(h), a product (i.e. the instantly claimed sgRNA) and a process of using said product (i.e. a method for treatment of a disease) can be shown to be distinct inventions if the product as claimed can be used in a materially different process. In the instant case, despite the therapeutic applicability of the sgRNA, it is also a nucleic acid species that can be further analyzed by and/or utilized in agarose gel electrophoresis, meaning the product as claimed can be used in a materially different process, whether or not it is the intended process.
The requirement is still deemed proper and is therefore made FINAL.
Regarding the species election, the requirement set forth in the restriction requirement dated 02/05/2026 is hereby withdrawn following a search of the prior art.
Claims 17 and 18 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 04/02/2026.
Accordingly, claims 1-16 are pending and under consideration.
Priority
Acknowledgment is made of applicant's claim for foreign priority based on an application filed in China on 02/07/2021. It is noted, however, that applicant has not filed a certified copy of the CN202110174416.5 application as required by 37 CFR 1.55.
The earliest effective filing date to which the instant application claims priority is 02/07/2021.
Information Disclosure Statement
Receipt of information disclosure statements on 11/30/2023, 02/19/2025, 05/14/2025, and 04/02/2026 is acknowledged. The signed and initialed PTO-1449‘s have been mailed with this action.
Drawings
The drawings filed 08/07/2023 are acceptable.
Specification
The specification filed 08/07/2023 is acceptable.
Nucleotide and/or Amino Acid Sequence Disclosures
Summary of Requirements for Patent Applications Filed On Or After July 1, 2022, That Have Sequence Disclosures
37 CFR 1.831(a) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.831(b) must contain a “Sequence Listing XML”, as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.831-1.835. This “Sequence Listing XML” part of the disclosure may be submitted:
1. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter “Legal Framework”) in XML format, together with an incorporation by reference statement of the material in the XML file in a separate paragraph of the specification (an incorporation by reference paragraph) as required by 37 CFR 1.835(a)(2) or 1.835(b)(2) identifying:
a. the name of the XML file
b. the date of creation; and
c. the size of the XML file in bytes; or
2. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation by reference statement of the material in the XML format according to 37 CFR 1.52(e)(8) and 37 CFR 1.835(a)(2) or 1.835(b)(2) in a separate paragraph of the specification identifying:
a. the name of the XML file;
b. the date of creation; and
c. the size of the XML file in bytes.
SPECIFIC DEFICIENCIES AND THE REQUIRED RESPONSE TO THIS NOTICE ARE AS FOLLOWS:
►Specific deficiency - Sequences appearing in the drawings are not identified by sequence identifiers in accordance with 37 CFR 1.831(c). Sequence identifiers for sequences (i.e., “SEQ ID NO:X” or the like) must appear either in the drawings or in the Brief Description of the Drawings. See Figures 2-4 and 6.
Required response – Applicant must provide:
Amended drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers;
AND/OR
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required sequence identifiers (i.e., “SEQ ID NO:X” or the like) into the Brief Description of the Drawings, consisting of:
• A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
• A copy of the amended specification without markings (clean version); and
• A statement that the substitute specification contains no new matter.
Claim Objections
Claims 1, 4-6, 8, 11, 13, 15, and 16 are objected to because of the following informalities:
Claim 1 recites “an sgRNA, wherein the sgRNA can target human Aqp1 RNA, the Aqp1 RNA can be any of Aqp1 mRNA…,” which does not comport with standard grammatical and/or linguistic conventions. It would be remedial to amend instant claim 1 such that it properly connects all recited phrases, for example by reciting “an sgRNA, wherein the sgRNA can target human Aqp1 RNA, wherein the Aqp1 RNA can be any of Aqp1 mRNA…” (bolded emphasis added). This is merely an example set forth by the Examiner that is not intended to be limiting.
Claims 4-6 all recite “wherein the targeting domain of the sgRNA comprises any one of sequences shown in…”, which does not comport with standard grammatical and/or linguistic conventions, as it lacks an article properly preceding the recited sequences. It would be remedial to amend instant claims 4-6 to include said article, for example by reciting “wherein the targeting domain of the sgRNA comprises any one of the sequences shown in…” (bolded emphasis added). This is merely an example set forth by the Examiner that is not intended to be limiting.
Claims 8, 11, and 13 are objected to for reciting periods to separate claim components. According to MPEP 608.01(m), “Each claim begins with a capital letter and ends with a period. Periods may not be used elsewhere in the claims except for abbreviations. See Fressola v. Manbeck, 36 USPQ2d 1211 (D.D.C. 1995)”. It would be remedial to replace periods with another punctuation mark or symbol, such as parentheses.
Claim 11 is further objected to for reciting various components in an inconsistent manner. The claimed kit is recited to comprise “an expression vector 1 comprising a nucleotide sequence encoding a Cas protein” at ii, or “an expression vector 4; the expression vector 4 comprising a nucleotide sequence encoding both two sgRNAs in the sgRNA combination of claim 7” at viii. The recitation of expression vector 4, wherein expression vector 4 is clearly and explicitly defined in the claim language is much more clearly interpreted than the recitation of expression vector 1, wherein expression vector 1 is not clearly and explicitly defined in the claim language. It would be remedial to clearly and explicitly define all claim terms in a consistent fashion throughout the instant claim set.
Claim 13 is further objected to for reciting various components in an inconsistent manner. The claimed composition is recited to comprise “a nucleic acid molecule 1 encoding a Cas protein” at II, or “a nucleic acid molecule 4; the nucleic acid molecule 4 encoding both two sgRNAs in the sgRNA combination of claim 7” at VIII. The recitation of nucleic acid molecule 4, wherein nucleic acid molecule 4 is clearly and explicitly defined in the claim language is much more clearly interpreted than the recitation of nucleic acid molecule 1, wherein nucleic acid molecule 1 is not clearly and explicitly defined in the claim language. It would be remedial to clearly and explicitly define all claim terms in a consistent fashion throughout the instant claim set.
Finally, regarding both claims 11 and 13, the recitation of different embodiments is delineated by i-xiii at instant claim 11 and by I-XIII at instant claim 13. For purposes of internal consistency, it would be remedial to amend the instant claim language such that all the various embodiments are recited in a consistent fashion (i.e. either i-xiii or I-XIII). Additionally, both claims 11 and 13 end with a final phrase reciting “the Cas protein can interact with the sgRNA.” This phrase is not clearly connected to the recitation of the rest of the claim language. For purposes of clarity, and in the interest of comporting with standard grammatical and/or linguistic conventions, it would be remedial to amend these recitations such that the phrase “the Cas protein can interact with the sgRNA” is clearly connected to the rest of the instant claim language.
Claim 15 recites “a medicament, wherein the medicament comprises the sgRNA of claim 1, or the sgRNA combination of claim 7, or the DNA molecule of claim 9, or the expression cassette, the expression vector, the recombinant bacterium, the recombinant virus, or the transgenic cell line of claim 10, or the composition of claim 13, and the medicament comprises a pharmaceutically acceptable excipient,” which is not clearly and easily interpretable. While the instant claim encompasses several embodiments of the claimed medicament, the claim language would be much easier to read if the embodiments were separated by semicolons rather than “or,” for example, as follows: “a medicament, wherein the medicament comprises the sgRNA of claim 1; the sgRNA combination of claim 7; the DNA molecule of claim 9; the expression cassette, the expression vector, the recombinant bacterium, the recombinant virus, or the transgenic cell line of claim 10; or the composition of claim 13, and the medicament further comprises a pharmaceutically acceptable excipient” (bolded and underlined emphasis added). This is merely an example set forth by the Examiner that is not intended to be limiting.
Claim 16 recites “the medicament is delivered by following delivery systems,” which lacks an article preceding “following delivery systems.” It would be remedial to amend the instant claim to include this article, for example, by reciting “the medicament is delivered by the following delivery systems” (bolded emphasis added). This is merely an example set forth by the Examiner that is not intended to be limiting.
Appropriate correction is required.
Claim Rejections - 35 USC § 112(a)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 2, 4, 11, and 13 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claims 2, 11, and 13 are drawn to a set of sgRNAs and compositions comprising the same, wherein said sgRNAs target human Aqp1 RNA and can interact with a Cas protein. The rejected claims thus comprise a set of sgRNAs that must interact with any Cas protein to target human Aqp1 RNA.
To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of a complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, and any combination thereof. The specification describes a set of sgRNAs that target human Aqp1 RNA when interacting with Cas13. No description is provided of a set of sgRNAs that target human Aqp1 RNA when interacting with any other Cas protein, such as Cas9 or Cas12.
Even if one accepts that the examples described in the specification meet the claim limitations of the rejected claims with regard to structure and function, the examples are only representative of a set of sgRNAs that target human Aqp1 RNA when interacting with Cas13. The results are not necessarily predictive of a set of sgRNAs that target human Aqp1 RNA when interacting with any other Cas protein, such as Cas9 or Cas12. Thus, it is impossible for one to extrapolate from the Cas13 examples described herein those sgRNAs that would necessarily meet the structural/functional characteristics of the rejected claims.
The prior art does not appear to offset the deficiencies of the instant specification in that it does not describe a set of sgRNAs that target human Aqp1 RNA when interacting with any other Cas protein, such as Cas9 or Cas12. As reviewed in Granados-Riveron and Aquino-Jarquin, 2018 (hereinafter Granados), CRISPR-Cas13 binds and cleaves RNA rather than DNA (abstract), as directed by a single crRNA comprising a stem-loop structure to interact with Cas13 and a target sequence-specific region directing target binding (Figure 1). This is distinct from Type II CRISPR guide RNA structure, which requires two components: a sequence-specific crRNA sequence, and a tracrRNA sequence to bind Type II CRISPR-Cas proteins such as Cas9 (Figure 1). Furthermore, as reviewed in Makarova et al., 2020 (hereinafter Makarova), CRISPR-Cas systems may be classified as class 1 or class 2 systems (Figures 1 and 2). Class 2 CRISPR-Cas systems include Types II, V, and VI, wherein Type VI comprises Cas13 and is the only type of CRISPR-Cas system to exclusively target RNA (Figure 2). Accordingly, it is known in the art that only Type VI CRISPR-Cas systems, such as Cas13, exclusively target RNA and further that these systems exclusively target RNA using guide RNAs that are structurally distinct from those of Type II systems, such as Cas9. Thus, one of ordinary skill in the art would not reasonably expect that any Cas protein, as encompassed by the instant claim language, would be capable of interacting with guide RNAs for targeting human Aqp1 RNA.
Therefore, the skilled artisan would have reasonably concluded applicants were not in possession of the claimed invention for claims 2, 11, and 13.
Claim 4 is drawn to a set of sgRNAs targeting an Aqp1 RNA, said sgRNAs comprising a targeting domain having a sequence identity greater than or equal to 80% with any one of the sequences of SEQ ID NO: 1 to SEQ ID NO: 31, which range in size from 20 to 30 nucleotides. The rejected claims thus comprise a set of sgRNA targeting domain sequences that encompass up to 20% sequence variability, all of which must function to target an Aqp1 RNA.
To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of a complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, and any combination thereof. The specification describes sgRNAs targeting an Aqp1 RNA and comprising a targeting domain of SEQ ID NO: 1 to SEQ ID NO: 31. No description is provided of sgRNAs targeting an Aqp1 RNA in which said sgRNAs comprise a targeting domain having a sequence identity of 80% to the aforementioned sequences.
Even if one accepts that the examples described in the specification meet the claim limitations of the rejected claims with regard to structure and function, the examples are only representative of sgRNAs targeting an Aqp1 RNA and comprising a targeting domain of SEQ ID NO: 1 to SEQ ID NO: 31. The results are not necessarily predictive of sgRNAs targeting an Aqp1 RNA in which said sgRNAs comprise a targeting domain having a sequence identity of 80% to the aforementioned sequences. Thus, it is impossible for one to extrapolate from the examples described herein those sgRNA targeting domain sequences that would necessarily meet the structural/functional characteristics of the rejected claims.
The prior art does not appear to offset the deficiencies of the instant specification in that it does not describe a set of sgRNA targeting domain sequences comprising a targeting domain having 80% sequence identity SEQ ID NOs: 1-31. As is known to those of ordinary skill in the art, guide RNA specificity in CRISPR systems is defined by the sequence of the targeting domain. As depicted in Figure 4 of Bandaru et al., 2020, the system requires the guide RNA to bind to the RNA target region, thereby knocking down the targeted transcript. If this sequence binding is disrupted, the guide RNA cannot effectively knock down the targeted transcript. In the instant case, the guide RNAs range in size from 20 to 30 nucleotides, meaning the instant claim language requiring at least 80% sequence identity to SEQ ID NOs: 1-31 encompasses variation of 4 to 6 nucleotides that would necessarily disrupt guide RNA-target binding, thereby disrupting transcript targeting and knockdown.
Therefore, the skilled artisan would have reasonably concluded applicants were not in possession of the claimed invention for claim 4.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 4-6 and 8 rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 4-6 and 8 all directly or indirectly depend from instant claim 1 and all recite the limitation “the targeting domain” or inherit the recitation of the same. There is insufficient antecedent basis for this limitation in claims 4-6 and 8. Claim 1, from which claims 4-6 and 8 all directly or indirectly depend, does not recite a targeting domain. Claim 2 recites a targeting domain. Accordingly, for purposes of examination and in the interest of compact prosecution, the Examiner has interpreted claims 4-6 and 8 to directly or indirectly depend from claim 2 rather than from claim 1, thereby establishing sufficient antecedent basis. It would be remedial to amend the instant claim set such that there is sufficient antecedent basis for every claim term.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-4, 7, and 9-16 are rejected under 35 U.S.C. 103 as being unpatentable over Wu et al., 2020 (hereinafter Wu) in view of WO 2008/067373 A2 (hereinafter Chatterton), Granados-Riveron and Aquino-Jarquin, 2018 (hereinafter Granados), WO 2019/238692 A1 (hereinafter Chu; as cited in the IDS filed 11/30/2023), and Konermann et al., 2018 (hereinafter Konermann), as evidenced by IDT: Expression Vectors: the what, why, and how (hereinafter IDT).
With regard to claim 1, which recites “an sgRNA, wherein the sgRNA can target human Aqp1 RNA, [wherein] the Aqp1 RNA can be any of Aqp1 mRNA, Aqp1 pre-mRNA or both of Aqp1 mRNA and Aqp1 pre-mRNA,” Wu discloses gene therapy for glaucoma by targeting Aqp1 (Aquaporin 1) for disruption using CRISPR-Cas9 (abstract). However, as shown in Figure 2, the sgRNAs taught in Wu target the genomic sequence of Aqp1 rather than the RNA thereof, as Wu utilizes CRISPR-Cas9, which targets DNA and not RNA (see abstract of Granados). Thus, while Wu discloses CRISPR sgRNAs targeting Aqp1, they do not disclose targeting of Aqp1 RNA.
This deficiency is cured by Chatterton and Granados. Chatterton discloses RNA interference to inhibit Aqp1 by targeting a portion of the mRNA thereof, thereby treating glaucoma (abstract; page 4, lines 24-28). Granados discloses that CRISPR-Cas13 and RNAi both knock down intended cellular RNA targets and further that CRISPR-Cas13 knocks down said RNA targets with greater efficiency than RNAi reagents and that this knockdown is markedly more specific than knockdown achieved with RNAi (section “Common denominators and big differences among CRISPR/Cas13 and RNAI; Table 1). Granados further discloses that Cas13 circumvents known risks of Cas9 genome editing, namely irreversible knockout of the synthesis of the encoded product with no possibility of reversing knockout once induced. Thus, one of ordinary skill in the art would have been motivated prior to the effective filing date of the invention to utilize CRISPR-Cas13 to knock down Aqp1 mRNA in place of the RNAi agents disclosed in Chatterton based on the disclosure of Granados, thereby treating glaucoma while avoiding permanent genomic mutations, as disclosed in both Wu and Chatterton and as set forth in greater detail below.
Thus, it is considered that Chatterton, Wu, and Granados collectively disclose each and every limitation of instant claim 1.
With regard to claim 2, which recites “the sgRNA [of claim 1] has a nucleotide sequence comprising a targeting domain and a framework sequence, and the targeting domain is complementary to a target nucleic acid Aqp1 RNA sequence, and the framework sequence can interact with a Cas protein,” as set forth above, Granados discloses CRISPR-Cas13 systems (abstract). Granados further discloses that Cas13 guide RNAs comprise a single crRNA with a stem-loop structure to interact with Cas13 and a sequence-specific targeting region to bind to a targeted sequence (Figure 1). Thus, it is considered that Granados discloses each and every additional limitation of instant claim 2.
With regard to claim 3, which recites “the Cas protein [of the sgRNA of claim 2] is a Cas13 protein,” as set forth above, Granados discloses CRISPR-Cas13 systems as well as the guide RNAs that interact with the same to target RNA (abstract; Figure 1). Thus, it is considered that Granados discloses each and every additional limitation of instant claim 3.
With regard to claim 4, which recites “the targeting domain [of the sgRNA of claim 1] comprises any one of [the] sequence[s] shown in SEQ ID NO: 1 to SEQ ID NO: 31; or the targeting domain has a sequence having a sequence identity of >80%...with any one of sequences shown in SEQ ID NO: 1 to SEQ ID NO: 31,” Chu discloses guide RNAs targeting genomic Aqp1, including guide RNAs for use in targeting human AQP1 (page 6, lines 24-29). As shown in the alignment below, sequence “CCGCCGTCTGGTTGTTCCCCA” of Chu comprises 91.3% sequence identity to instant SEQ ID NO: 10, which is great than 80%, as required by the
PNG
media_image1.png
156
621
media_image1.png
Greyscale
instant claim language.
Thus, it is considered that Chu discloses each and every additional limitation of instant claim 4.
With regard to claim 7, which recites “an sgRNA combination composed of any two different sgRNAs from claim 1,” as set forth above, Wu discloses gene therapy for glaucoma by targeting Aqp1 (Aquaporin 1) for disruption using CRISPR-Cas9 (abstract). Furthermore, Wu discloses that combining two CRISPR-Cas9 guide RNAs leads to efficient Aquaporin 1 disruption (see section Combining Two CRISPR-Cas9 Short Guide RNAs Leads to Efficient Aquaporin 1 Disruption). While Wu does not disclose RNA targeting via CRISPR-Cas13, Konermann discloses that Type VI CRISPR effectors such as Cas13 are particularly well-suited to multiplexing, as multiple guide RNAs can be expressed as a single array and subsequently be processed into individual guide RNAs (Figure 5). Thus, it is considered that Wu and Konermann collectively disclose each and every additional limitation of instant claim 7.
With regard to claim 9, which recites “a DNA molecule encoding the sgRNA of claim 1 or the sgRNA combination of claim 7,” as set forth above, Chu discloses guide RNAs targeting genomic Aqp1, including guide RNAs for use in targeting human AQP1 (page 6, lines 24-29). Chu further discloses AAV vector virions comprising a DNA sequence encoding said guide RNA (page 3, lines 25-61; page 4, line 34-page 6, line 5). Thus, it is considered that Chu discloses each and every additional limitation of instant claim 9.
With regard to claim 10, which recites “an expression cassette, an expression vector, a recombinant bacterium, a recombinant virus or a transgenic cell line containing the DNA molecule of claim 9,” as set forth above, Chu discloses guide RNAs targeting genomic Aqp1, including guide RNAs for use in targeting human AQP1 (page 6, lines 24-29). Chu further discloses AAV vector virions comprising a DNA sequence encoding said guide RNA (page 3, lines 25-61; page 4, line 34-page 6, line 5). Thus, it is considered that Chu discloses each and every additional limitation of instant claim 10.
With regard to claim 11, which recites “a kit, comprising any one of the following:
a Cas protein, and the sgRNA of claim 1;
an expression vector 1 comprising a nucleotide sequence encoding a Cas protein, and the sgRNA of claim 1;
a Cas protein, and an expression vector comprising a nucleotide sequence encoding the sgRNA of claim 1;
the expression vector 1 and the expression vector 2…
the Cas protein can interact with the sgRNA,” under broadest reasonable interpretation, the term “expression vector” refers to a type of DNA plasmid or other DNA molecule used to shuttle or introduce a specific gene into a target cell (as set forth in IDT). Therefore, in the absence of any particular definition in the instant specification, the Examiner has interpreted the term “expression vector” to refer to any type of DNA molecule used to shuttle or introduce a specific gene into a target cell. As set forth above, Chu discloses guide RNAs targeting genomic Aqp1, including guide RNAs for use in targeting human AQP1 (page 6, lines 24-29). Chu further discloses therapeutic kits comprising first and second AAV vector virions (which are considered to read on the instantly claimed “expression vector”), wherein said first and second AAV vector virions comprise a nucleic acid sequence encoding an RNA-guided endonuclease and a nucleic acid sequence encoding a guide RNA complementary to a target sequence from an aquaporin gene (page 48, lines 2-6; page 51, lines 8-11). Chu further discloses that the RNA-guided endonuclease taught therein may be a Cas protein such as a Cas9 (page 5, lines 7-10). Thus, it is considered that Chu discloses each and every additional limitation of instant claim 11.
With regard to claim 12, which recites “the Cas protein [of the kit of claim 11] is a Cas13 protein,” as set forth above, Chu further discloses that the RNA-guided endonuclease taught therein may be a Cas protein such as a Cas9 (page 5, lines 7-10). However, Chu does not disclose that the RNA-guided endonuclease taught therein may be a Cas13 protein. This deficiency is cured by Granados, which discloses that Cas13 knocks down RNA targets with greater efficiency and higher specificity than RNAi (section “Common denominators and big differences among CRISPR/Cas13 and RNAI; Table 1). Therefore, in order to target RNA with a Cas protein, as instantly claimed, one of ordinary skill in the art would turn to Cas13 for targeted knockdown. Thus, it is considered that Granados discloses each and every additional limitation of instant claim 12.
With regard to claim 13, which recites “a composition, selected from any one of the following:
a composition, comprising: a Cas protein and the sgRNA of claim 1;
a composition, comprising: a nucleic acid molecule 1 encoding a Cas protein, and the sgRNA of claim 1;
a composition, comprising: a Cas protein, and a nucleic acid molecule 2 encoding the sgRNA of claim 1;
a composition, comprising: the nucleic acid molecule 1 and the nucleic acid molecule 2…
the Cas protein can interact with the sgRNA,” as set forth above, Chu discloses guide RNAs targeting genomic Aqp1, including guide RNAs for use in targeting human AQP1 (page 6, lines 24-29). Chu further discloses pharmaceutical compositions comprising an AAV vector virion, wherein said AAV vector virion comprises a nucleic acid sequence encoding an RNA-guided endonuclease and a nucleic acid sequence encoding a guide RNA complementary to a target sequence from an aquaporin gene (page 48, lines 2-6; page 50, lines 24-25). Chu further discloses that the RNA-guided endonuclease taught therein may be a Cas protein such as a Cas9 (page 5, lines 7-10). Thus, it is considered that Chu discloses each and every additional limitation of instant claim 13.
With regard to claim 14, which recites “the Cas protein [of the composition of claim 13] is a Cas13 protein,” as set forth above, Chu further discloses that the RNA-guided endonuclease taught therein may be a Cas protein such as a Cas9 (page 5, lines 7-10). However, Chu does not disclose that the RNA-guided endonuclease taught therein may be a Cas13 protein. This deficiency is cured by Granados, which discloses that Cas13 knocks down RNA targets with greater efficiency and higher specificity than RNAi (section “Common denominators and big differences among CRISPR/Cas13 and RNAI; Table 1). Therefore, in order to target RNA with a Cas protein, as instantly claimed, one of ordinary skill in the art would turn to Cas13 for targeted knockdown. Thus, it is considered that Granados discloses each and every additional limitation of instant claim 14.
With regard to claim 15, which recites “a medicament, wherein the medicament comprises the sgRNA of claim 1, or the sgRNA combination of claim 7, or the DNA molecule of claim 9…and the medicament comprises a pharmaceutically acceptable carrier,” as set forth above, Chu discloses pharmaceutical compositions comprising an AAV vector virion, wherein said AAV vector virion comprises a nucleic acid sequence encoding an RNA-guided endonuclease and a nucleic acid sequence encoding a guide RNA complementary to a target sequence from an aquaporin gene (i.e. Aqp1) (page 48, lines 2-6; page 50, lines 24-25). Said pharmaceutical compositions are further disclosed to comprise a pharmaceutically acceptable excipient or carrier (page 36, lines 12-16), as instantly claimed. Thus, it is considered that Chu discloses each and every additional limitation of instant claim 15.
With regard to claim 16, which recites “the medicament [of claim 15] is delivered by [the] following delivery systems: RNP delivery, liposome delivery, nanoparticle delivery, virus delivery or extracellular vesicle delivery,” as set forth above, Chu discloses pharmaceutical compositions comprising an AAV vector virion, wherein said AAV vector virion comprises a nucleic acid sequence encoding an RNA-guided endonuclease and a nucleic acid sequence encoding a guide RNA complementary to a target sequence from an aquaporin gene (i.e. Aqp1) (page 48, lines 2-6; page 50, lines 24-25). Said pharmaceutical compositions are further disclosed to comprise a pharmaceutically acceptable excipient or carrier (page 36, lines 12-16). Additionally, these compositions are disclosed to comprise the viral vector virions set forth above, as demonstrated by AAV injection into mice (page 38, lines 18-26). Thus, it is considered that Chu discloses each and every additional limitation of instant claim 16.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1 and 2 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 11, 16, 18, and 19 of U.S. Patent No. 12,297,450 B2. Although the claims at issue are not identical, they are not patentably distinct from each other.
Patent ‘450 is drawn to a CRISPR-Cas13 system and use thereof (abstract), said system comprising a guide polynucleotide targeting Aqp1 RNA (recited at claims 16 and 19). This guide polynucleotide is further recited to hybridize with a target RNA and form a CRISPR complex with a Cas13 protein (recited at claims 11 and 18).
This is not patentably distinct from the recitations of instant claim 1 and 2, which respectively recite “an sgRNA, wherein the sgRNA can target human Aqp1 RNA…” and “wherein the sgRNA has a nucleotide sequence comprising a targeting domain and a framework sequence, and the targeting domain is complementary to a target nucleic acid Aqp1 RNA sequence, and the framework sequence can interact with a Cas protein.”
Thus, the subject matter of patent ‘450 and that of the instant application are not patentably distinct.
Claims 1 and 2 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 6, 7, and 17 of copending Application No. 19/194,365 (corresponds to US 2025/0250590 A1; reference application). Although the claims at issue are not identical, they are not patentably distinct from each other.
MPEP 804 II B 1 states:
The specification can be used as a dictionary to learn the meaning of a term in the patent claim. Toro Co. v. White Consol. Indus., Inc., 199 F.3d 1295, 1299, 53 USPQ2d 1065, 1067 (Fed. Cir. 1999)… Further, those portions of the specification which provide support for the patent claims may also be examined and considered when addressing the issue of whether a claim in the application defines an obvious variation of an invention claimed in the patent. In re Vogel, 422 F.2d 438, 441-42, 164 USPQ 619, 622 (CCPA 1970).
The following rejections are in view of the decision of the Court of Appeals for the Federal Circuit in Pfizer Inc, v Teva pharmaceuticals USA Inc., 86 USPQ2d 1001, at page 1008 (March 2008), which indicates that there is no patentable distinction between claims to a product and a method of using that product disclosed in the specification of the application and that the preclusion of such a double patenting rejection under 35 USC 121 does not apply where the present application is other than a divisional application of the patent application containing such patentably indistinct claims.
Copending application ‘365 is drawn to a non-naturally occurring or engineered guide polynucleotide, wherein the guide polynucleotide can form a CRISPR complex with a Cas13 protein and guide the sequence-specific binding of the CRISPR complex to the target RNA, such as Aqp1 RNA (recited at claims 1 and 6). Furthermore, copending claim 17 recites “a method for diagnosing, treating, or preventing diseases or disorders associated with a target RNA, comprising administering the CRISPR-Cas13 system according to claim 7 to a sample of a subject in need thereof, or to a subject in need thereof; wherein the target RNA is…Aqp1 RNA…”. The system of claim 7 is recited to comprise a guide polynucleotide as set forth above, such that the guide polynucleotide can form a CRISPR complex with the Cas13 protein and guide a sequence-specific binding of the CRISPR complex to the target RNA.
This is not patentably distinct from the recitations of instant claim 1 and 2, which respectively recite “an sgRNA, wherein the sgRNA can target human Aqp1 RNA…” and “wherein the sgRNA has a nucleotide sequence comprising a targeting domain and a framework sequence, and the targeting domain is complementary to a target nucleic acid Aqp1 RNA sequence, and the framework sequence can interact with a Cas protein.”
Thus, the subject matter of copending application ‘365 and that of the instant application are not patentably distinct.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Conclusion
No claims are allowed.
Claims 1, 4-6, 8, 11, 13, and 15-16 are objected to.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Sarah E Allen whose telephone number is (571)272-0408. The examiner can normally be reached M-F 8-5.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/SARAH E ALLEN/Examiner, Art Unit 1637
/J. E. ANGELL/Primary Examiner, Art Unit 1637