Prosecution Insights
Last updated: August 12, 2026
Application No. 18/366,306

IMMUNOSTIMULATORY OLIGONUCLEOTIDES

Non-Final OA §103§112
Filed
Aug 07, 2023
Priority
Dec 15, 2017 — EU 17207746.3 +5 more
Examiner
RAHMAN, MASUDUR
Art Unit
1633
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Elanco Animal Health GmbH
OA Round
1 (Non-Final)
72%
Grant Probability
Favorable
1-2
OA Rounds
10m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 72% — above average
72%
Career Allowance Rate
89 granted / 124 resolved
+11.8% vs TC avg
Strong +32% interview lift
Without
With
+32.1%
Interview Lift
resolved cases with interview
Typical timeline
3y 11m
Avg Prosecution
39 currently pending
Career history
151
Total Applications
across all art units

Statute-Specific Performance

§101
4.4%
-35.6% vs TC avg
§103
45.5%
+5.5% vs TC avg
§102
20.2%
-19.8% vs TC avg
§112
23.1%
-16.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 124 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claim status In this prosecution, examiner is pursuing the claims dated 07 August 2023, in which Applicant claims 1-20. Therefore, claims 1-20 are herein pending. Accordingly, claims 1-20 are under current examination. Priority This application was filed 08/07/2023 is a divisional of 16772541, filed 06/12/2020 (now U.S. Patent # 11932857) and having 1 RCE-type filing therein 16772541 is a National Stage entry of PCT/EP2018/084019 filed on 12/07/2018. This National Stage claims benefit to the foreign application EP17207740.6; EP17207746.3 and EP17207750.5, filed on 12/15/2017. Filing of a certified translated copy of the EP17207740.6; EP17207746.3 and EP17207750.5, filed on 06/12/2020 with parent application 16772541 is acknowledged. Thus, the earliest possible priority for the instant application is 12/15/2017. Information Disclosure Statement The information disclosure statement (IDS) submitted on 10/15/2025, 07/09/2024, 05/17/2024, 04/02/2024, 09/19/2024 and 08/07/2023 are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner and the signed and initialed PTO Forms 1449 are mailed with this action. Abstract Objection The abstract of the disclosure filed 08/07/2023 is objected to because the abstract is only 31 words in length. Therefore, submitted abstract is considered non-compliant. Applicant is reminded of the proper language and format for an abstract of the disclosure. MPEP §608.01(b) states that the abstract should be in narrative form and generally limited to a single paragraph on a separate sheet within the range of 50 to 150 words in length. The abstract should describe the disclosure sufficiently to assist readers in deciding whether there is a need for consulting the full patent text for details. The language should be clear and concise and should not repeat information given in the title. It should avoid using phrases which can be implied, such as, “The disclosure concerns,” “The disclosure defined by this invention,” “The disclosure describes,” etc. In addition, the form and legal phraseology often used in patent claims, such as “means” and “said,” should be avoided. Therefore, appropriate correction is required. Title Objection The title of the invention is not descriptive. A new title is required that is clearly indicative of the invention to which the claims are directed. See MPEP 606.01. This invention discloses an immunostimulatory oligonucleotides for stimulating toll-like receptor 9 (TLR9). Therefore, the following title is suggested: “An immunostimulatory oligonucleotides for stimulating toll-like receptor 9 (TLR9).” Claim Rejections - 35 USC § 112 (a) (Written description) The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1-20 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim contains subject matter that was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor, at the time the application was filed, had possession of the claimed invention. Under the written description guidelines (see MPEP 2163), the Examiner is directed to determine whether one skilled in the art would recognize that the Applicant was in possession of the claimed invention as a whole at the time of filing. The following considerations are critical to this determination. To satisfy the written description requirement, a patent specification must describe the claimed invention in sufficient detail so that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention. See, e.g., Moba, B.V. v. Diamond Automation, Inc., 325 F.3d 1306, 1319, 66 USPQ2d 1429, 1438 (Fed. Cir. 2003); Vas-Cath, Inc. v. Mahurkar, 935 F.2d at 1563, 19 USPQ2d at 1116. An original claim may lack written description support when (1) the claim defines the invention in functional language specifying a desired result but the disclosure fails to sufficiently identify how the function is performed or the result is achieved or (2) a broad genus claim is presented but the disclosure only describes a narrow species with no evidence that the genus is contemplated. See Ariad Pharms., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1349-50 (Fed. Cir. 2010) (en banc). The written description requirement is not necessarily met when the claim language appears in ipsis verbis in the specification. "Even if a claim is supported by the specification, the language of the specification, to the extent possible, must describe the claimed invention so that one skilled in the art can recognize what is claimed. The appearance of mere indistinct words in a specification or a claim, even an original claim, does not necessarily satisfy that requirement." Enzo Biochem, Inc. v. Gen-Probe, Inc., 323 F.3d 956, 968, 63 USPQ2d 1609, 1616 (Fed. Cir. 2002). Accordingly, to satisfy the written description requirement, the specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention. Vas-Cath, Inc. v. Mahurkar, 935 F.2d 1555, 1562-63, 19 USPQ2d 1111 (Fed. Cir. 1991). See also MPEP 2163. Claim 1 encompasses a genus of any immunostimulatory oligonucleotide comprising any CpG motif. However, the specification doesn't have adequate support in the disclosure for the any immunostimulatory oligonucleotide comprising any CpG motif. The specification discloses for enhancing the immunogenicity of a TLR9 ligand comprising attaching a cholesteryl moiety to the ligand [0008]-[0009], wherein the ligand is an immunostimulatory oligonucleotide having specific CpG motif (SEQ ID NO: 1, Table 1 and 24, known as “PTO-2006”) and wherein the cholesteryl moiety is attached, via a linker, to the 3’ and/or 5’ terminal nucleotide of the oligonucleotide [0026], [0042], [0051], [0082], [0085]. Wherein the linker is a 3' TTTTGGGGGTTTT (SEQ ID NO: 9, [0012]). Therefore, SPEC has explicit support for a specific immunostimulatory oligonucleotide comprising specific CpG motif (SEQ ID NO: 1) and attached with and without a 5'- and/or 3'-cholesteryl moiety as discloses in SEQ ID NOs: 2-9. However, specification does not disclose any immunostimulatory oligonucleotide comprising any CpG motif as claimed in the instant product of claim 1. Accordingly, the specification fails to identify the any immunostimulatory oligonucleotide comprising any CpG motif. The teaching of Krieg et al. (US20030212026A1; published on Nov. 13, 2003; cited in PTO892; hereinafter “Krieg”), teaches immunostimulatory oligodeoxynucleotides (ODN) compositions and methods thereof (abstract). The immunostimulatory ODN are T-rich containing poly T sequences and encompass a plurality of CpG nucleic acids ([0006]-[0009] ¶), and the CpG-dependent stimulation of human B cells depends on methylation and ODN length (example 1, [0315]-[0316]). Krieg also teaches the structure function analysis of phosphorothioate oligonucleotides containing the 5' GTCGTT 3' (SEQ ID NO: 1144) and 5'TCGTCGTT 3' (SEQ ID NO:1145) motifs, which showed that additional CpG motifs (2006 (SEQ ID NO. 246)) tended to increase the activity of phosphorothioate oligo nucleotides [0363]. The immunostimulatory ODN may be directly administered to the subject or may be administered in conjunction (e.g. ionically or covalently bound to) with a nucleic acid delivery complex include nucleic acids associated with a sterol (e.g. cholesterol) [0283]. Therefore, it is obvious that immunostimulatory ODN of Krieg comprising a specific CpG motif and attached with cholesteryl moiety for treating or preventing a parasite infection by administering to a Subject having or at risk of having a parasite infection [0065]. With these additional evidences, the product of any immunostimulatory ODN comprising any CpG motif is not well established at the time of filling and the ordinary artisan cannot predictably identify any immunostimulatory ODN comprising any CpG motif. Furthermore, the method making an any immunostimulatory ODN comprising any CpG motif is not well established at the time of filling and the ordinary artisan cannot predictably identify any CpG motif that can produce any immunostimulatory ODN. Therefore, one of skill in the art would neither expect nor predict the appropriate method of developing the instantly claimed genus any immunostimulatory ODN comprising any CpG motif. Therefore, it concludes that the claimed genus of any immunostimulatory ODN comprising any CpG motif doesn't have an adequate written description. It concludes that a skilled artisan would find the specification inadequately described. Therefore, the Applicant did not sufficiently possess the broader invention as claimed in claim 1 and dependent claims 2-20. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-20 are rejected under 35 U.S.C. 103 as being unpatentable over the combined teachings of Krieg et al. (US20030212026, Pub. Date: Nov. 13, 2003, cited in PTO892, hereinafter “Krieg”), Spiller et al. (Blood, The Journal of the American Society of Hematology, 91(12), pp.4738-4746, 1998, cited in PTO892, hereinafter “Spiller”), Kim et al. (US7408050B2; pub. Date: Aug. 5, 2008; cited in PTO892; hereinafter “Kim”), French et al. (US20160289761A1; pub date: Oct. 6, 2016; cited in PTO892; hereinafter “French”) and Krieg et al. (Nature reviews Drug discovery, 5(6), pp.471-484, 2006; cited in PTO892; hereinafter “Krieg’2006”). Regarding claims 1, 2 4-6, 7, 11 and 19, Krieg discloses an immunostimulatory oligonucleotide (ODN) compositions a plurality of CpG nucleic acids (abstract, [0006]-[0009]), wherein the ODN comprises a phosphodiester backbone or linkages ([0033]-[0035]), and the CG dinucleotide comprises a phosphorothioate linkage ([0044]. Furthermore, Krieg teaches the SEQ ID NO: 305 (TCGTCGTTTTGTCGTTTTGTCG TTTTTTT) which comprising a 3’-terminal sequence comprising a plurality of thymine nucleotides. The immunostimulatory composition comprises a pharmaceutically acceptable carrier ([0033]- [0036] for the mucosal administration [0052] of a composition to a subject (i.e., human, a dog, fish, pig [283]). Although regarding claims 1 and 3, Krieg discloses nucleic acids associated with a sterol, including a cholesterol [0283], however, does not explicitly express that the 3’ cholesteryl moiety is covalently attached to the 3’-terminal nucleotide of the immunostimulatory ODN via a linker; wherein the immunostimulatory oligonucleotide comprises a 3’ terminal sequence GGGGG and comprises the sequence set forth by SEQ ID NO: 7 (instant claims 8-10); wherein the linker is a hexanediol or a hexaethylene glycol (instant claims 12-18); and method of eliciting a TLR9-mediated immune response in a subject comprising administering to the subject using immunostimulatory composition (instant claim 20). However, such was known in the prior art. Spiller discloses the improved intracellular delivery of oligonucleotides and lipophilic conjugation therefore, it will enhance intracellular delivery of ODNs and introduction of a cholesterol at the 3’ end increased cellular uptake by up to 2 orders of magnitude (The title, abstract, p. 4739, col. 1; which necessarily renders obvious claims 1 and 3). Kim discloses a modified CpG oligodeoxynucleotide (ODN), wherein the 3' terminal sequence is GGGGG (abstract, SEQ ID NO: 3 (Table 1)), which provides the sequence set forth by instant SPEC SEQ ID NO: 7 wherein 3' terminal sequence is the plurality of guanine nucleotides comprises consecutive guanine nucleotides (2006-05: TCGTCGTTTTGT CGTTTTGTCGTTGGGGGG) (Col 4 lns 61-66, Col 5 lns 1-16 and Table 1). This is necessarily rendering obvious claims 8-10. French is disclosing that linkers hexanediol and hexaethylene glycol are known linkers for oligonucleotides ([0060] ¶ of French), which necessarily renders obvious claims 12-18. Krieg’2006 discloses the mechanisms and therapeutic applications of activating TLR9 with synthetic CpG oligodeoxynucleotide (ODN) agonists, which are currently in human clinical trials in the fields of infectious disease, cancer and asthma/allergy (p. 472 left-hand col. 1st ¶). which necessarily renders obvious claim 20. It would have been obvious for one of ordinary skill in the art at the time of the invention to combine the teachings above and modify an immunostimulatory ODN to comprise a 3’ cholesteryl moiety. One would have been motivated to do so for the gain of enhancing intracellular delivery of immunostimulatory oligonucleotides, allowing for the binding of the immunostimulatory oligonucleotide to intracellular TLR9. It would have been obvious for one of ordinary skill in the art at the time of the invention to combine the teachings above and use known linkers, including hexanediol and hexaethylene glycol, for attaching a 3’ cholesteryl moiety to an oligonucleotide. One would have been motivated to do so for the advantage reducing steric hindrance. It would have been obvious for one of ordinary skill in the art at the time of the invention to combine the teachings above and modify known immunostimulatory oligonucleotides, including that set forth by instant SEQ ID NO: 7, wherein modifications include attaching a 3’ cholesteryl moiety via a linker. One would have been motivated to do so for the gain of enhancing intracellular delivery of the oligonucleotide and reducing steric hindrance using a linker. The invention as a whole was clearly prima facie obvious to one of ordinary skill in the art at the time the invention was made. Conclusion No claims are allowed. Examiner Contact Information Any inquiry concerning this communication or earlier communications from the examiner should be directed to MASUDUR RAHMAN whose telephone number is (571)272-0196. The examiner can normally be reached M-F 8-5 (EST). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher Babic can be reached on (571) 272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /MASUDUR RAHMAN/ Patent Examiner, Art Unit 1633 /JEREMY C FLINDERS/ Primary Examiner, Art Unit 1684
Read full office action

Prosecution Timeline

Aug 07, 2023
Application Filed
Apr 01, 2026
Non-Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12698475
LYMPHOCYTES LACKING PERFORIN FUNCTION
3y 9m to grant Granted Aug 04, 2026
Patent 12686853
METHODS AND COMPOSITIONS FOR TREATMENT OF MUSCLE DISEASE WITH IPSC-INDUCED HUMAN SKELETAL MUSCLE STEM CELLS
3y 2m to grant Granted Jul 21, 2026
Patent 12679902
METHOD FOR PRODUCING CELL POPULATION CONTAINING CAR-EXPRESSING IMMUNE CELLS
4y 6m to grant Granted Jul 14, 2026
Patent 12679879
NR4A-DEFICIENT CELLS EXPRESSING C-JUN AND USES THEREOF
4y 1m to grant Granted Jul 14, 2026
Patent 12677811
Method for Constructing Murine Model with Mutations in Csf1r Gene and Application thereof
2y 6m to grant Granted Jul 14, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
72%
Grant Probability
99%
With Interview (+32.1%)
3y 11m (~10m remaining)
Median Time to Grant
Low
PTA Risk
Based on 124 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month