DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
The Final Office action of 09/08/2025 is hereby vacated based on the argument related to rejection of claim 7 put forth by the Applicant in the response dated 12/08/2025 (page 4, last para; page 5, first para).
The Applicant’s response dated 12/02/2025 is acknowledged and entered.
Following is the second Final Office action.
The delay in prosecution is regretted.
Claim Status
The amendments of 12/02/2025 and have been entered.
Claims 2-3, 5-6, and 8 are cancelled by the Applicant.
Claims 1, 4, 7, and 9-11 are pending and are being examined.
All previous objections and rejections not set forth below have been withdrawn in view
of applicant’s amendments to the claims.
Claim Rejections - 35 USC § 112(a), § 101, and § 102
Response to Applicants’ arguments: Amendments made to the claims filed in Applicant’s response submitted on 07/01/2025 (which are maintained in the claims submitted on 12/02/2025) overcame the rejections of record.
Claim Interpretation
Claims 10-11 are broadly directed to a genome-edited rice plant with enhanced nitrogen utilization efficiency under nitrogen deficient condition and a seed thereof produced by the method of claim 7. The genome edited plant achieves enhanced nitrogen utilization efficiency (NUE) by upregulating NF-YA5 gene expression. These are product-by-process claims.
“[E]ven though product-by-process claims are limited by and defined by the process, determination of patentability is based on the product itself. The patentability of a product does not depend on its method of production. If the product in the product-by-process claim is the same as or obvious from a product of the prior art, the claim is unpatentable even though the prior product was made by a different process.” In re Thorpe, 777 F.2d 695, 698, 227 USPQ 964, 966 (Fed. Cir. 1985). The structure implied by the process steps should be considered when assessing the patentability of product-by-process claims over the prior art, especially where the product can only be defined by the process steps by which the product is made, or where the manufacturing process steps would be expected to impart distinctive structural characteristics to the final product. In re Garnero, 412 F.2d 276, 279, 162 USPQ 221, 223 (CCPA 1979).
Claims 10-11 are interpretated as a genome-edited or transgenic rice plant and a seed thereof containing the trait of enhanced nitrogen utilization efficiency by upregulating NF-YA5 expression under nitrogen deficient condition.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 1 and 4 are rejected under 35 U.S.C. 103 as being unpatentable over Maor et al. (US 2014/0298541 A1) in view of Li et al. (The Arabidopsis NFYA5 Transcription Factor Is Regulated Transcriptionally and Posttranscriptionally to Promote Drought Resistance, 2008, The Plant Cell, 20: 2238–2251).
Maor et al. discloses a method of improving nitrogen use or utilization efficiency (NUE) in plants (page 1, abstract) by using microRNAs (miRNAs) (page 20, para 0077) under nitrogen deficient condition (page 69-70, para 0239). It describes making a microRNA-resistant target gene by introducing a mutation in the miRNA binding site of the target gene, so that the DNA and resulting RNA sequences are changed in a way that prevents miRNA binding, but the amino acid sequence of the protein encoded by the target gene is unchanged (page 7, para 0117; page 70, para 0243). It describes several miR169a sequences which are orthologues of maize miRNAs (page 24, para 0224; table 6) involved in NUE. Maor et al. also describes rice miR169a, OsmiR169a (page 38, table 6), and a nucleotide sequence comprising 100% sequence identity to instant SEQ ID NO: 37, as shown below.
RESULT 6
US-14-438-763-359/c
Sequence 359, US/14438763
Patent No. 10190126
GENERAL INFORMATION
APPLICANT: A.B. SEEDS LTD.
APPLICANT: MAOR, Rudy
APPLICANT: NESHER, Iris
TITLE OF INVENTION: TRANSGENIC PLANTS WITH MODIFIED SUGAR CONTENT
TITLE OF INVENTION: AND METHODS OF GENERATING SAME
FILE REFERENCE: P34093US00
CURRENT APPLICATION NUMBER: US/14/438,763
CURRENT FILING DATE: 2015-04-27
PRIOR APPLICATION NUMBER: PCT/IL13/50880
PRIOR FILING DATE: 2013-10-28
PRIOR APPLICATION NUMBER: US 61/719,415
PRIOR FILING DATE: 2012-10-28
NUMBER OF SEQ ID NOS: 543
SEQ ID NO 359
LENGTH: 82
TYPE: DNA
ORGANISM: Medicago truncatula
Query Match 100.0%; Score 21; Length 82; Best Local Similarity 100.0%;
Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CAGCCAAGGATGACTTGCCGA 21
|||||||||||||||||||||
Db 82 CAGCCAAGGATGACTTGCCGA 62
However, Maor et al. does not describe any target gene for miR169a or use any gene editing system.
Li et al. teaches that NF-YA5 is a target gene for miR169a (abstract), as recited in claim 4. It explains the post-transcriptional regulation by which degradation of NF-YA5 transcript (mRNA) is regulated by miR169a (page 2244, left column, para 1). Li et al. also describes the method to identify and delete the exact upstream sequence of NF-YA5 transcript where miR169a binds and target the NF-YA5 transcript for cleavage (page 2242, Fig. 3).
Before the effective filing date of the claimed invention, it would have been obvious to
one of ordinary skill in the art to improve nitrogen utilization efficiency in plants using miR169a, as taught by Maor et al., by knocking-out the activity of miR169a using the well-known gene editing system such as CRISPR/Cas9 by mutating or deleting the binding site of miR169a in NF-YA5 in a plant. The CRISPR/Cas9 based targeted gene editing system is routine and efficient method which overcomes the challenges of random mutagenesis (e.g., by using transposons, T-DNA, physical, or chemical mutagenesis) by reducing random off-target mutations while deleting/mutating a specific target sequence in genome.
Before the effective filing date, an ordinarily skilled artisan would be motivated to knock-out the activity of miR169a using a targeted gene editing system by mutating the miR169a binding site of its target gene, NF-YA5, with a reasonable expectation of success to increase nitrogen use efficiency.
Claims 7 and 9-11 are rejected under 35 U.S.C. 103 as being unpatentable Cheng et al. (A miR169c-NFYA10 module confers tolerance to low-nitrogen stress to Betula luminifera, 2021, Industrial Crops & Products, 172:113988), in view of Li et al. (The Arabidopsis NFYA5 Transcription Factor Is Regulated Transcriptionally and Posttranscriptionally to Promote Drought Resistance, 2008, The Plant Cell, 20: 2238–2251) and Singroha et al. (Current status of microRNA-mediated regulation of drought stress responses in cereals, 2021, Physiologia Plantarum, 172:1808–1821), and in further view of Huynh et al. (US 8795987 B2). The rejection is modified based on the rejection of claims 7-11 under USC 103 set forth in the Non-Final Office action dated 03/04/2025.
Claim 7 is drawn to a method of producing a genome-edited rice plant with enhanced nitrogen utilization efficiency under a nitrogen-deficient condition using genome editing; and regenerating a rice plant from the rice plant cell that is obtained after the genome editing wherein the target nucleotide sequence of NF-YA5 gene derived from rice consists of the nucleotide sequence of SEQ ID NO: 41.
Cheng et al. teaches describes a method wherein nitrogen availability or nitrogen utilization efficiency in the plant is controlled by two members of the miR169 multigene family comprisng BlmiR169a, in Betula luminifera (page 4, right column, para 1). Cheng et al. also teaches that NF-YA5 is one of the target genes for miR169a. Overexpression of miR169a suppresses expression of NF-YA5 expression (page 6, left column, para 2). It teaches that downregulation of miR169a is correlated with low nitrogen availability (page 4, right column, para 1) implying that downregulation of expression or activity of miR169a is part of the process by which the plant responds to low nitrogen availability condition and try to increase nitrogen use efficiency or nitrogen availability. In other words, Cheng et al. teaches that controlling the activity of miR169a by downregulating its inhibiting activity on its target genes including NF-YA5 would overexpress NFYA5 resulting in increased nitrogen utilization efficiency. Cheng et al. also teaches regeneration of transgenic plants leading to development of T3 homozygous lines (page 3, left column, para 2, last 2 lines).
However, Cheng et al. does not teach introducing any guide RNA or an endonuclease or any gene editing to increase nitrogen utilization efficiency.
Li et al. teaches post-translational regulation by which degradation of NF-YA5 transcript is regulated by miR169a (page 2244, left column, para 1). Li et al. also teaches the method to identify and delete the exact upstream sequence of NF-YA5 transcript where miR169a binds and targets the NF-YA5 transcript for cleavage (Fig. 3). It also teaches regeneration of genome edited or transgenic plants (page 2249, left column, para 2).
Singroha et al. teaches the CRISPR-CAS9 gene editing system that includes introducing guide RNAs and endonucleases for introducing double stranded break at any target site of a gene (page 1815, left column, para 2).
Huynh et al. teaches techniques for regulating gene expression using RNAi molecules (abstract) that either induce mRNA degradation or inhibiting translation of the mRNA (column 1, last 3 lines; and column 2, first 2 lines). It also teaches SEQ ID NO: 7287 from rice (as recited in claim 9) which maintains 100% identity to instant SEQ ID NO: 41, as shown below.
RESULT 1
US-12-183-204-7287/c
Sequence 7287, US/12183204
Patent No. 8795987
GENERAL INFORMATION
APPLICANT: International Business Machines Corporation
APPLICANT: Huynh, Tien
APPLICANT: Rigoutsos, Isidore
TITLE OF INVENTION: Ribonucleic Acid Interference Molecules of Oryza Sativa
FILE REFERENCE: YOR920070097US2
CURRENT APPLICATION NUMBER: US/12/183,204
CURRENT FILING DATE: 2008-07-31
NUMBER OF SEQ ID NOS: 24555
SEQ ID NO 7287
LENGTH: 96
TYPE: DNA
ORGANISM: Oryza sativa
Query Match 100.0%; Score 20; Length 96; Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CGCCGGTGGCAATTCATCCT 20
||||||||||||||||||||
Db 46 CGCCGGTGGCAATTCATCCT 27
Before the effective filing date of the claimed invention, it would have been obvious to one of ordinary skill in the art to modify to enhance nitrogen utilization efficiency by overexpressing NF-YA5 as taught by Cheng et al. by abolishing the post-transcriptional repression of NF-YA5 by knocking-out the target binding site for miR169a in NFYA5 as taught by Li et al. using a gene editing system comprising a guide RNA (gRNA) and an endonuclease as taught by Singroha et al. to increase expression and activity of NF-YA5 gene. It is also prudent to mention here that designing a guide RNA (gRNA) to mutate and/or knock-out any specific target sequence in a genome is a routine and standard practice in the art1, which can be used by an ordinarily skilled artisan. Using any specific gRNA comprising instant SEQ ID NO: 41 to downregulate a mRNA having the same sequence, as taught by Huynh et al., is an experimental design choice of the artisan.
Before the effective filing date of the claimed invention, one of ordinary skill in the art would have been motivated to downregulate the inhibiting activity of miR169a to upregulate the expression of its target gene NF-YA5 using a gene editing system with a reasonable expectation to increase nitrogen use efficiency in a plant, as discussed above.
Claims 10 and 11, which are dependent from claim 7, are drawn to a genome-edited rice plant and seed thereof produced by the method of claim 7.
The genome edited rice plants and seeds thereof produced by the modified method including regeneration of genome edited or transgenic plants, as described above while rejecting claims 7-9 under 35 U.S.C. 103, are not patentably distinct and would satisfy all the claim limitations of claim 10-11, as explained in the Claim Interpretation section.
Response to Applicant’s Arguments
The argument set forth in the Applicant’s reply on 6/17/2025 and 12/02/2025 to the rejection of relevant claims under 35 U.S.C. 103 has been fully considered but is not found persuasive.
Initially, it is noted that this is new rejection is necessitated by the claim amendments, as submitted on 07/01/2025 and which are maintained in the claims submitted on 12/02/2025. Notwithstanding previous Office actions containing claim objections and/or rejections therewith, the responses to Applicant’s argument dated 07/01/2025, as discussed below.
The Applicant argues that rejection of claim 7 under 35 USC § 103 lacks articulated reasoning because- (i) “Li et al. does not teach or suggest manipulation of the miRNA169a binding site in NFYA5” (page 9, para 5; page 10, para 7); (ii) “there is no motivation to modify the other cited references in view of Huynh as- Huynh does not teach targeted (gene) editing of miRNA169a binding site or SEQ ID NO” 41 (page 10, para 2-3); no motivation from Singroha et al or Cheng et al. to use CRISPR/Cas9 systems of gene editing (page 10, last para). The Applicant also argues that there is, “no reasonable expectation of success, as the claimed approach involves a non-obvious mechanism of gene regulation and an unexpected result- enhanced NUE- confirmed only through the Applicants’ own experimentation.” (page 11 last 2 lines, and page 12 first line).
The Examiner disagrees. As discussed above, Moar et al. describes a method of improving nitrogen use or utilization efficiency (NUE) in plants by making a miRNA-resistant target gene by introducing mutation(s) in the miRNA binding site of the target gene, so that the target gene can be overexpressed, as discussed above. On the other hand, Li et al. teaches that NFYA5 is a target gene for miR169a. It also describes a method to identify and delete the exact upstream sequence of NF-YA5 transcript where miR169a binds and target the NF-YA5 transcript for cleavage, as discussed above. Identifying a specific gene, including NFYA5, based on several methods including homology search, especially in plant species with published genome and/or published cDNA sequences (as in rice2), is a routine practice in the art. Using CRISPR/Cas based gene editing technique to delete/mutate any specific sequence is a well-known and a standard practice in the art. Targeted gene editing as CRISPR/Cas technique has many benefits over more traditional/older mutagenesis techniques, as described above. It would have been obvious to any ordinarily skilled artisan to use CRISPR/Cas based gene editing technique to delete the miR169a binding site in NF-YA5 gene to overexpress NF-YA5 gene with a realistic motivation to increase NUE in rice.
There would have been a realistic expectation of success in rice if a method to increase NUE works in Arabidopsis or maize. The Applicant does not provide any evidence to show the contrary. Applicant’s opinion cannot take the place of evidence (MPEP 716.01(c)(II), 2145(I)).
Applicant is reminded that the test for obviousness is not whether the features of a secondary reference may be bodily incorporated into the structure of the primary reference; nor is it that the claimed invention must be expressly suggested in any one or all of the references. Rather, the test is what the combined teachings of the references would have suggested to those of ordinary skill in the art. In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981).
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 10 and 11 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3 of Kim et al. (U.S. Patent No. 11674148).
Instant claims 10 and 11 are directly or indirectly dependent from claim 7, and product-by-process claims as explained in Claim Interpretation section. Claims 10 and 11 are drawn to a genome-edited rice plant and a seed thereof to enhance nitrogen utilization efficiency produced by upregulating NF-YA5 gene expression and regenerating genome edited or transgenic plants. Claims 2 and 3 in Kim et al. recite transformed rice plants and its seeds produced by upregulating NF-YA5 gene expression and regenerating genome edited or transgenic plants as disclosed in claim 1. A transformed plant of claim 2 in Kim et al. is not patentably distinct from a genome-edited rice plant of claim 10 in this instant application. Similarly, a seed of the said genome-edited plant in claim 11 in this instant application is not patentably distinct from a seed of the transformed plant recited in claim 3 of Kim et al.
Conclusion
All claims are rejected.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Correspondence
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAY CHATTERJEE whose telephone number is (703)756-1329. The examiner can normally be reached (Mon - Fri) 8.30 am to 5.30 pm..
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Shubo (Joe) Zhou can be reached at 571-272-0724. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
Jay Chatterjee
Patent Examiner
Art Unit 1662
/Jay Chatterjee/Examiner, Art Unit 1662
/BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1661 & 1662
1 Cui et al. (Review of CRISPR/Cas9 sgRNA Design Tools, 2018, Interdisciplinary Sciences: Computational Life Sciences, 10:455–465) provides the evidence that designing a guide RNA (gRNA) to mutate or knock-out any specific target sequence in a genome is a routine and standard practice in the art (abstract).
2 Kikuchi et al. (GenBank Accession No. CI115347; published on 4th Mar. 2006) provides the evidence of a rice cDNA having 100% sequence identity to instant SEQ ID NO: 41