Prosecution Insights
Last updated: September 19, 2026
Application No. 18/368,607

NF-YA5/miR169a MODULE CONTROLLING NITROGEN UTILIZATION EFFICIENCY OF PLANT AND USES THEREOF

Non-Final OA §103
Filed
Sep 15, 2023
Examiner
CHATTERJEE, JAYANTA
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Lasemilla Co. Ltd.
OA Round
4 (Non-Final)
46%
Grant Probability
Moderate
4-5
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 46% of resolved cases
46%
Career Allowance Rate
10 granted / 22 resolved
-14.5% vs TC avg
Strong +80% interview lift
Without
With
+80.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 7m
Avg Prosecution
56 currently pending
Career history
80
Total Applications
across all art units

Statute-Specific Performance

§101
3.9%
-36.1% vs TC avg
§103
41.9%
+1.9% vs TC avg
§102
17.4%
-22.6% vs TC avg
§112
29.5%
-10.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 22 resolved cases

Office Action

§103
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 03/30/2026 has been entered. Claim Status The amendments of 03/30/2026 have been entered. Claims 1, 4, 7, and 10-11 are pending and are being examined. All previous objections and rejections not set forth below have been withdrawn in view of applicant’s amendments to the claims. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claims 1 and 4 are rejected under 35 U.S.C. 103 as being unpatentable over Maor et al. (US 2014/0298541 A1) in view of Li et al. (The Arabidopsis NFYA5 Transcription Factor Is Regulated Transcriptionally and Posttranscriptionally to Promote Drought Resistance, 2008, The Plant Cell, 20: 2238–2251) and in evidence of Chen et al. (CRISPR/Cas Genome Editing and Precision Plant Breeding in Agriculture, 2019, Annu. Rev. Plant Biol., 70:667–97 15:16). Maor et al. discloses a method of improving nitrogen use or utilization efficiency (NUE) in plants (page 1, abstract) by using microRNAs (miRNAs) (page 20, para 0077) under nitrogen deficient condition (page 69-70, para 0239). It describes making a microRNA-resistant target gene by introducing a mutation in the miRNA binding site of the target gene, so that the DNA and resulting RNA sequences are changed in a way that prevents miRNA binding, but the amino acid sequence of the protein encoded by the target gene is unchanged (page 7, para 0117; page 70, para 0243). Such mutation(s) abolish(es) binding of specific miRNA to its specific target gene in the genome. Maor et al. describe several miR169a sequences which are orthologues of maize miRNAs (page 24, para 0224; table 6) and involved in NUE. Maor et al. also describes rice miR169a, OsmiR169a (page 38, table 6), and a nucleotide sequence comprising 100% sequence identity to instant SEQ ID NO: 37, as shown below. RESULT 6 US-14-438-763-359/c Sequence 359, US/14438763 Patent No. 10190126 GENERAL INFORMATION APPLICANT: A.B. SEEDS LTD. APPLICANT: MAOR, Rudy APPLICANT: NESHER, Iris TITLE OF INVENTION: TRANSGENIC PLANTS WITH MODIFIED SUGAR CONTENT TITLE OF INVENTION: AND METHODS OF GENERATING SAME FILE REFERENCE: P34093US00 CURRENT APPLICATION NUMBER: US/14/438,763 CURRENT FILING DATE: 2015-04-27 PRIOR APPLICATION NUMBER: PCT/IL13/50880 PRIOR FILING DATE: 2013-10-28 PRIOR APPLICATION NUMBER: US 61/719,415 PRIOR FILING DATE: 2012-10-28 NUMBER OF SEQ ID NOS: 543 SEQ ID NO 359 LENGTH: 82 TYPE: DNA ORGANISM: Medicago truncatula Query Match 100.0%; Score 21; Length 82; Best Local Similarity 100.0%; Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CAGCCAAGGATGACTTGCCGA 21 ||||||||||||||||||||| Db 82 CAGCCAAGGATGACTTGCCGA 62 However, Maor et al. does not describe any target gene for miR169a or use any gene editing system. Li et al. teaches that NF-YA5 is a target gene for miR169a (abstract), as recited in claim 4. It explains the post-transcriptional regulation by which degradation of NF-YA5 transcript (mRNA) is regulated by miR169a (page 2244, left column, para 1). Li et al. also describe the method to identify and to delete the exact upstream sequence of NF-YA5 transcript where miR169a binds and target the NF-YA5 transcript for cleavage (page 2242, Fig. 4). Before the effective filing date of the claimed invention, it would have been obvious to one of ordinary skill in the art to improve nitrogen utilization efficiency in plants using miR169a, as taught by Maor et al., by knocking-out the activity of miR169a using the well-known and standard gene editing system such as CRISPR/Cas9 (Chen et al., title and Abstract) by mutating, including deleting, the binding site of miR169a in the NF-YA5 gene in a plant. The CRISPR/Cas9 based targeted gene editing system is routine and efficient method which overcomes the challenges of random mutagenesis (e.g., by using transposons, T-DNA, physical, or chemical mutagenesis) by reducing random off-target mutations while deleting/mutating a specific target sequence in genome. Before the effective filing date, an ordinarily skilled artisan would have been motivated to knock-out the activity of miR169a using a targeted gene editing system by mutating the miR169a binding site of its target gene, NF-YA5, with a reasonable expectation of success to increase nitrogen use efficiency. Claims 7 and 10-11 are rejected under 35 U.S.C. 103 as being unpatentable over Maor et al. in view of Li et al. as applied to claims 1 and 4 above, and further in view of Huynh et al. (US 8795987 B2) and in evidence of Cui et al. (Review of CRISPR/Cas9 sgRNA Design Tools, 2018, Interdisciplinary Sciences: Computational Life Sciences, 10:455–465). Claim 7 is drawn to a method of producing a genome-edited rice plant with enhanced nitrogen utilization efficiency under a nitrogen-deficient condition using genome editing; and regenerating a rice plant from the rice plant cell that is obtained after the genome editing wherein the target nucleotide sequence of NF-YA5 gene derived from rice consists of the nucleotide sequence of SEQ ID NO: 41. Claim 10 is drawn to the genome-edited rice plant produced by the said method. Maor et al. in view of Li et al. describe a method of enhancing nitrogen use/utilization efficiency (NUE) in a plant under a nitrogen-deficient condition, by inhibiting the activity of miR169a based on a mutation/deletion of the miR169a binding site in its target gene, NFYA5, as discussed above. Maor et al. also describes regenerating transformed plants into maturity (page 11, para 0165-0166). Maor et al. teaches that a plant's nitrogen use efficiency (NUE) is a result of an alteration in at least one of the traits including the uptake (as recited in claim 7), spread, absorbance and use (read on to “assimilation”, as recited in claim 7), accumulation, relocation of nitrogen absorbed by the plant (page 4, para 0053, line 1-4). However, Maor et al. in view of Li et al. do not explicitly describe any gene editing system wherein the target nucleotide sequence of NF-YA5 gene derived from rice comprising the nucleotide sequence of SEQ ID NO: 41. Huynh et al. teaches techniques for regulating gene expression using RNAi molecules (abstract) that either induce mRNA degradation or inhibiting translation of the mRNA (column 1, last 3 lines; and column 2, first 2 lines). It also teaches SEQ ID NO: 7287 from rice which maintains 100% identity to instant SEQ ID NO: 41, as shown below. RESULT 1 US-12-183-204-7287/c Sequence 7287, US/12183204 Patent No. 8795987 GENERAL INFORMATION APPLICANT: International Business Machines Corporation APPLICANT: Huynh, Tien APPLICANT: Rigoutsos, Isidore TITLE OF INVENTION: Ribonucleic Acid Interference Molecules of Oryza Sativa FILE REFERENCE: YOR920070097US2 CURRENT APPLICATION NUMBER: US/12/183,204 CURRENT FILING DATE: 2008-07-31 NUMBER OF SEQ ID NOS: 24555 SEQ ID NO 7287 LENGTH: 96 TYPE: DNA ORGANISM: Oryza sativa Query Match 100.0%; Score 20; Length 96; Best Local Similarity 100.0%; Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CGCCGGTGGCAATTCATCCT 20 |||||||||||||||||||| Db 46 CGCCGGTGGCAATTCATCCT 27 Before the effective filing date of the claimed invention, it would have been obvious to one of ordinary skill in the art to modify the method, as described by Maor et al in view of Li et al., by abolishing the repression of NF-YA5 gene, a target gene of miR169a, by mutating or knocking-out the target binding site of miR169a in NF-YA5 in rice, as described by Huynh et al. Identifying a specific gene, including NFYA5, based on several methods including homology search, especially in plant species with published genome (as in rice), is a routine practice in the art. It is also prudent to mention here that designing a guide RNA (gRNA) to mutate or knock-out any specific target sequence in a genome is also a routine and standard practice in the art (Cui et al., abstract), which can be used by an ordinarily skilled artisan. Using any specific sequence, including instant SEQ ID NO: 41 comprising 100% identity to the SEQ ID NO: 7287 as taught by Huynh et al., to mutate or knocking-out the miR169a binding site in the NF-YA5 gene in plants including in rice is an experimental design choice of any ordinarily skilled artisan without changing the outcome while mutating/deleting the miR169a binding site in NFYA5, as taught by Li et al, to increase NUE (which includes nitrogen uptake and/or nitrogen assimilation), as described by Maor et al. It is known in the art that the genome edited rice plants and the seeds from the plants (as recited in claims 10-11) produced by the said method would maintain/inherit the trait of enhanced nitrogen utilization efficiency under nitrogen deficient condition. Before the effective filing date, an ordinarily skilled artisan would have been motivated to mutate or knock-out the target binding site for miR169a in NF-YA5 gene using a gene editing system to increase nitrogen utilization efficiency in rice. Regarding claim 11, Maor et al. discloses regenerating transgenic T0 plants to maturity and harvesting seeds (page 69, para 0233). Response to Applicant’s Arguments The argument set forth in the Applicant’s reply on 3/30/2026 to the rejection of claims under 35 U.S.C. 103 has been fully considered but is not found persuasive. In regard to USC 103 ejections, the Applicant argues that “the amendments to claims 1, 7, and 10 overcome the rejections by: (1) Explicitly reciting the functional requirement that the mutation abolishes miR169a binding (claims 1, 7, 10); (2) Specifying the enhanced NUE phenotype in measurable terms (increased nitrogen uptake/assimilation) (claim 7); (3) Identifying the target sequence as a miR169a binding site in NF-YA5 (claim 7); 3) Specifying the enhanced NUE phenotype in measurable terms (increased nitrogen uptake/assimilation) (claim 7); (4) Converting claim 10 from product-by-process to a structural claim explicitly reciting a genome-edited mutation at the endogenous NF-YA5 locus (response, page 13, para 7, line 2-7). The Examiner disagrees. As discussed above, Moar et al. describes a method of improving nitrogen use or utilization efficiency (NUE) in plants by making a miRNA-resistant target gene by introducing mutation(s) in the miRNA binding site of the target gene, so that the target gene can be overexpressed, as discussed above. On the other hand, Li et al. teaches that NFYA5 is a target gene for miR169a. Li et al. also describes a method to identify and delete the exact upstream sequence of NF-YA5 transcript where miR169a binds and target the NF-YA5 transcript for cleavage, as discussed above. Nitrogen uptake and/or assimilation is part of NUE, as taught by Maor et al (page 4, para 0053, line 1-4). Identifying a specific gene, including NFYA5, based on several methods including homology search, especially in plant species with published genome and/or published cDNA sequences (as in rice1), verifying target sequences of any miRNA molecule in a plant are routine practices in the art. Using CRISPR/Cas based gene editing technique to delete/mutate any specific sequence is also a well-known and a standard practice in the art. Targeted gene editing as CRISPR/Cas technique has many benefits over more traditional/older mutagenesis techniques, as described above. It would have been obvious to any ordinarily skilled artisan to use CRISPR/Cas based gene editing technique to delete the miR169a binding site in NF-YA5 gene to overexpress NF-YA5 gene with a realistic motivation to increase NUE in rice. There would have been a realistic expectation of success in rice if a method to increase NUE works in Arabidopsis or maize (which is also a monocot as rice). The Applicant does not provide any evidence to show the contrary. Applicant’s opinion cannot take the place of evidence (MPEP 716.01(c)(II), 2145(I)). Conclusion All claims are rejected. Correspondence Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAY CHATTERJEE whose telephone number is (703)756-1329. The examiner can normally be reached (Mon - Fri) 8.30 am to 5.30 pm.. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /Jay Chatterjee/ Examiner, Art Unit 1662 /BRATISLAV STANKOVIC/ Supervisory Patent Examiner, Art Units 1661 & 1662 1 Kikuchi et al. (GenBank Accession No. CI115347; published on 4th Mar. 2006; and Kikuchi et al., Collection, Mapping, and Annotation of over 28,000 cDNA Clones from Japonica Rice. 2003, Science, 301: 376–379) provide the evidence of a rice genome project sequencing 28,000 cDNA clones including the cDNA having 100% sequence identity to instant SEQ ID NO: 41.
Read full office action

Prosecution Timeline

Show 1 earlier event
Mar 04, 2025
Non-Final Rejection mailed — §103
Jul 01, 2025
Response Filed
Sep 08, 2025
Final Rejection mailed — §103
Dec 02, 2025
Response after Non-Final Action
Dec 29, 2025
Final Rejection mailed — §103
Mar 30, 2026
Request for Continued Examination
Apr 01, 2026
Response after Non-Final Action
May 05, 2026
Non-Final Rejection mailed — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12703870
REGULATION OF ROOT DEVELOPMENT
2y 2m to grant Granted Aug 11, 2026
Patent 12662514
METHODS TO BLOCK APHID TRANSMISSION OF POLEROVIRUSES AND TO DEVELOP VIRUS MANAGEMENT TOOLS
3y 6m to grant Granted Jun 23, 2026
Patent 12649926
USE OF MfERF026 GENE REGULATION IN GROWTH, DEVELOPMENT, AND STRESS TOLERANCE OF MEDICAGO SATIVA
2y 1m to grant Granted Jun 09, 2026
Patent 12642203
TOMATO PLANTS RESISTANT TO TOBRFV, TMV, TOMV AND TOMMV AND CORRESPONDING RESISTANCE GENES
2y 12m to grant Granted Jun 02, 2026
Patent 12635627
PLANTS RESISTANT TO INFECTION BY PEPINO MOSAIC VIRUS
2y 5m to grant Granted May 26, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

4-5
Expected OA Rounds
46%
Grant Probability
99%
With Interview (+80.0%)
2y 7m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 22 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month