Prosecution Insights
Last updated: October 04, 2026
Application No. 18/373,605

NUCLEIC ACID DELIVERY SYSTEM AND APPLICATION THEREOF

Non-Final OA §101§102§103§112§DP
Filed
Sep 27, 2023
Priority
Mar 29, 2021 — CN 202110335617.9 +3 more
Examiner
TATGE, LEXUS MARC
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Nanjing University
OA Round
1 (Non-Final)
50%
Grant Probability
Moderate
1-2
OA Rounds
4m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 50% of resolved cases
50%
Career Allowance Rate
1 granted / 2 resolved
-10.0% vs TC avg
Strong +100% interview lift
Without
With
+100.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 5m
Avg Prosecution
55 currently pending
Career history
37
Total Applications
across all art units

Statute-Specific Performance

§101
8.8%
-31.2% vs TC avg
§103
26.7%
-13.3% vs TC avg
§102
16.6%
-23.4% vs TC avg
§112
25.4%
-14.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 2 resolved cases

Office Action

§101 §102 §103 §112 §DP
DETAILED ACTION The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claim(s) 1-14 are pending. Preliminary Amendments Applicant’s preliminary amendment(s) filed on 01/08/2024 for replacing the drawings, on 03/27/2024 for adding a sequence listing incorporation by reference statement, and on 05/26/2026 for adding sequence identifiers throughout the specification where there were non-compliant listings, are all acknowledged. Priority Acknowledgment is made of applicant's claim for foreign priority based on an application filed in CN202110335617.9, CN202110336982.1, and CN202110336983.6 on 03/29/2021. It is noted, however, that applicant has not filed a certified copy of the three applications as required by 37 CFR 1.55. All claims are given the priority date of PCT/CN2022/083876 filed on 03/29/2022. Information Disclosure Statement Receipt of the information disclosure statement(s) on 09/27/2023 is acknowledged. The signed and initialed PTO-1449 form(s) has/have been mailed with this action. Drawings The drawings are objected to because the following: At least one component of the drawing is illegible: 1A; 10A-F; 10H-J; 11D-F; 13A; 13D-G; 14C-E; 15A-F; 17A-C; 18A-B; 20B-C; 26B-D; 30A-F; 31A-D; 32A-C; 33A-D; 34A-C; 35A-C; 36A-C; 37A-C; 40A-B; 42A-E; 43A-E; 49A-B; 50A-D; 54A-F; 55A-B; 56A-F; 58A-G; 59A-B; 60A-C; 61A-G; 62A-F; 63A-B; 67A-C; 68A; 69A-C; 70A-C; 71A-B; 72A-C; 73A-C; 74A-C; 75A-B; 76A-C; 77A-C; 82A-D; 83A-C; 84A-C; 85A-C; 86A-C; 97A-D; 119B-D; 120B; 120D-F; 121B-D; 143A-B; 144A-B; 15A-B; 146A-B; 147A-B; 148A-B; 149A-B; 150A-B; 151A-B; 161A-M; 162A-E; 163A-F; 164A-E; 169A-C; 174A-H; 175A-F; 176A-I; 177B-F; 178A-F; 197A-D; 198, 199; 227; 232A; 232B-J; 233; Cannot differentiate the conditions within the graph: 4A; 7A; 11B; 13B; 25A; 26A; 40B; 42A-E; 43A-E; 54A-F; 56A-F; 58C; 60B; 68B; 81B; 99A-B; 100A-D; 109A-D; 111A-B; 112A-D; 120C; 139A; 140A-B; On page 64, it says “Figure 19” in the middle of the page, however, all of the figures correspond to either Figure 76 or Figure 77 on this page; The following figures are duplicates of each other: 98A and 110A; 98B and 110B; 99A and 111A; 98B and 111B; 100A and 112A; 100B and 112B; 100C and 112C; 100D and 112D; 101A and 113A; 101B and 113B; 101C and 113C; 101D and 113D; 102 and 114; 103 and 115; 104 and 116; 105A and 117A; 105B and 117B; and 106 and 118. Figure 198 has a white box over shRNA2, miRNA1, and miRNA2 box plots. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Nucleotide and/or Amino Acid Sequence Disclosures Summary of Requirements for Patent Applications Filed On Or After July 1, 2022, That Have Sequence Disclosures 37 CFR 1.831(a) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.831(b) must contain a “Sequence Listing XML”, as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.831-1.835. This “Sequence Listing XML” part of the disclosure may be submitted: 1. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter “Legal Framework”) in XML format, together with an incorporation by reference statement of the material in the XML file in a separate paragraph of the specification (an incorporation by reference paragraph) as required by 37 CFR 1.835(a)(2) or 1.835(b)(2) identifying: a. the name of the XML file b. the date of creation; and c. the size of the XML file in bytes; or 2. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation by reference statement of the material in the XML format according to 37 CFR 1.52(e)(8) and 37 CFR 1.835(a)(2) or 1.835(b)(2) in a separate paragraph of the specification identifying: a. the name of the XML file; b. the date of creation; and c. the size of the XML file in bytes. SPECIFIC DEFICIENCIES AND THE REQUIRED RESPONSE TO THIS NOTICE ARE AS FOLLOWS: Specific deficiency #1 - This application contains sequence disclosures in accordance with the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.821(a)(1) and (a)(2). However, this application fails to comply with the requirements of 37 CFR 1.821 - 1.825. The sequence disclosures are located on page 11 in [0063]: RVG targeting peptide as SEQ ID NO: 1; GE11 peptide as SEQ ID NO: 2; PTP targeting peptide as SEQ ID NO: 3; TCP-1 targeting peptide as SEQ ID NO: 4; MSP targeting peptide as SEQ ID NO: 5; and The respective LAMP2B fusion proteins as SEQ ID NOs: 6-10. Wherein, SEQ ID NOs: 1-10 in the sequence listing correspond to siRNA targeting EGFR and KRAS; The sequence disclosures are located on page 50 in [00336]: “Wherein, the amino acid sequence of RVG is shown in SEQ ID NO:17. The amino acid sequence of the entire RVG-Lamp2b fusion protein is shown in SEQ ID NO:18.” Wherein, SEQ ID NOs: 17-18 in the sequence listing correspond to siRNA targeting mTOR. Required response – Applicant must provide: A "Sequence Listing" part of the disclosure, as described above in item 1); as well as An amendment specifically directing entry of the "Sequence Listing" part of the disclosure into the application in accordance with 1.825(b)(2); A statement that the "Sequence Listing" includes no new matter in accordance with 1.825(b)(5); and A statement that indicates support for the amendment in the application, as filed, as required by 37 CFR 1.825(b)(4). If the "Sequence Listing" part of the disclosure is submitted according to item 1) a) or b) above, Applicant must also provide: A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter; If the "Sequence Listing" part of the disclosure is submitted according to item 1) b), c), or d) above, Applicant must also provide: A replacement CRF in accordance with 1.825(b)(6); and Statement according to item 2) a) or b) above. Specification The disclosure is objected to because of the following informalities: SEQ ID NOs: 1-10 and 17-18, recited on pages 11 [0063] and 50 [00336] respectively, are listed in the sequence listing as siRNAs, not peptides or fusion proteins. The specification does not enumerate the sequences of, RVG, GE11, PTP, TCP-1, MSP, and the LAMP2B fusion proteins. Thus, the specification should not refer to these peptides or fusion proteins without proper sequence identifiers, or if shorter than 10 nucleotides or 4 amino acids, the enumeration of said sequence(s). [00495] contains reference to colors in drawings, e.g., red part and blue part. Appropriate correction is required. The specification contains brief descriptions for Figures 112-118, however, these are duplicate Figures of 100-106. Claim Objections Claim 9 is objected to because of the following informalities: The preamble recites, “The isolate nucleic acid according to claim 7. . .”. It would be remedial to amend the claim to recite, “The isolated nucleic acid according to claim 7. . .”. Claim 10 is objected to because of the following informalities: “A vector of RNA that inhibits expression, comprising: . . .” reads as a vector composed of RNA. However, the specification, at multiple locations, provides guidance that claim 10 is “a vector (in this example, a plasmid) that comprises a nucleic acid encoding RNA that inhibits gene expression and/or a protein that targets a tissue. . .”, (see para [00328]) or “The vector plasmids pAAV-RC and pHelper provided by Hanheng Biotechnology (Shanghai) Co., Ltd., as well as the vector plasmid AAV051 carrying the target nucleic acid construct fragment were used, in which the nucleic acid construct fragment was cloned from plasmids CMV-siRn or CMV-siRn comprising the nucleic acid fragment encoding the siRNA initiated by CMV as described above, wherein the siRNA sequence. . .”, (see para [00399]). Thus, it would be remedial to amend the claim to recite “A vector comprising a nucleic acid encoding RNA that inhibits gene expression, comprising. . .” Appropriate correction is required. Claim Interpretation Wherein “compensation sequence” is defined in the specification at [0048] to be “[T]he reverse complementary sequence of the RNA fragment sequence. In one embodiment of the present invention, the compensation sequence is the reverse complementary sequence of the RNA fragment sequence with any 1-5 bases deleted.” Thus, the “compensation sequence” is being interpreted as an “antisense sequence”. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claim(s) 1-6, 8, and 13 rejected under 35 U.S.C. 101 because the claimed invention is directed to product(s) of nature without significantly more. Regarding the first and second embodiment (bolded to distinguish) of claim 1 (and claim 13) which recites, “An isolated nucleic acid comprising a nucleotide sequence encoding an RNA capable of inhibiting expression of a gene, comprising: a first nucleotide sequence encoding: one or more RNAs that inhibit gene expression, and the RNA is selected from the group consisting of miRNA, shRNA, siRNA, mRNA, ncRNA, sgRNA, and a combination thereof; wherein, the nucleotide sequence comprises an RNA fragment sequence targeting the gene, and one or more of a flanking sequence, a stem-loop sequence, and a compensation sequence of the RNA fragment sequence; or wherein, the nucleotide sequence encodes one or more RNAs that inhibit gene expression comprises successively: 5' flanking sequence, RNA fragment sequence, stem-loop sequence, compensation sequence and 3' flanking sequence; or a second nucleotide encoding a targeting protein.” Claims 2-5 are dependent upon claim 1 and recite: “wherein the first nucleotide sequence encodes an RNA that inhibits gene expression.”, (claim 2); “wherein the first nucleotide sequence encodes a plurality of RNAs that inhibit gene expression, wherein the plurality of RNAs that inhibit gene expression are 2-4 RNAs that inhibit gene expression.”, (claim 3); “wherein the RNA is siRNA.”, (claim 4); and “wherein the first nucleotide sequence that encodes one or more RNAs that inhibit gene expression is 15-29 nucleotides in length, or 21-23 nucleotides in length.”, (claim 5). Claim(s) 1-5 and 13 are not markedly different from the product’s naturally occurring counterpart in the natural state because Starega-Roslan et al (The role of the precursor structure in the biogenesis of microRNA, Cell. Mol. Life Sci. Vol 68, pages 2859-2871, published May 24th, 2011) teaches miRNA. More specifically, Starega-Roslan et al teaches miRNA wherein the nucleotide sequence comprises an RNA fragment sequence targeting the gene, and one or more of a flanking sequence (5' flanking sequence), a stem-loop sequence, a compensation sequence of the RNA fragment sequence (reading on the antisense and/or miRNA* strand) and a 3' flanking sequence (see figure 1 below). PNG media_image1.png 337 468 media_image1.png Greyscale Regarding claim(s) 1 and 2, Starega-Roslan et al teaches, “MiRNAs downregulate gene expression in several ways; in animal cells, the downregulation is usually achieved by translational arrest, mRNA deadenylation and degradation, or less frequently by mRNA cleavage (reviewed in [1]). More recently, mRNA destabilization and degradation have been proposed to constitute the predominant mechanism of gene expression regulation by miRNAs [53].”, (see page 2860, col 2, line 18-25). Regarding claim 3, Marco et al (Multiple products from microRNA transcripts, Biochemical Society Transactions, Vol 41, Part 4, pages 850-854, published 07/18/2013) teaches “As soon as miRNAs were characterized as a widespread class of molecules, it became apparent that their loci were often close to each other in genome sequences [23–25]. According to miRBase [26], approximately one-third of miRNAs are closer than 10 kb to another miRNA in animal genomes. miRNAs that are clustered are usually assumed to be co-expressed from a single transcript [27–33]. For instance, Ryazansky et al. [33] have shown that, in Drosophila melanogaster, highly co-expressed miRNAs are most likely to be separated by less than 1 kb.”, (see page 851, col 2, para 1). Regarding claim 1 and 4, Piatek et al (Endogenous siRNAs, regulators of internal affairs, Biochemical Society Transactions, Vol 42, part 4, pages 1174-1179, published 02/01/2015) teaches, “This brief review focusses on the third family of short naturally occurring RNAs, namely endo-siRNAs. These are 20-23 nucleotides long and are synthesized from double-stranded RNAs such as hairpins with a long, perfect stem or sense-antisense transcript hybrids. Endo-siRNAs have a 3′ 2 nucleotide overhang, are produced by Dicer and form an effector complex with an Argonaute protein. The existence of endo-siRNAs has long been debated in flies and vertebrates that lack a siRNA specific amplification mechanism; only powerful parallel sequencing techniques have convincingly demonstrated endo-siRNAs, i.e. Dicer products that reliably mapped to the host genome.”, (see page 1174, col 1, line 30-32 to col 2, lines 1-10). Regarding claim 5, Starega-Rolan et al teaches “These 20- to 24-nucleotide (nt)-long RNAs regulate numerous physiological processes, including cell proliferation, differentiation, apoptosis and development.”, (see page 2859, col 2, lines 3-6 of para 1). Regarding the third embodiment (bolded to distinguish) of claim 1 which recites, “An isolated nucleic acid comprising a nucleotide sequence encoding an RNA capable of inhibiting expression of a gene, comprising: a first nucleotide sequence encoding: one or more RNAs that inhibit gene expression, and the RNA is selected from the group consisting of miRNA, shRNA, siRNA, mRNA, ncRNA, sgRNA, and a combination thereof; wherein, the nucleotide sequence comprises an RNA fragment sequence targeting the gene, and one or more of a flanking sequence, a stem-loop sequence, and a compensation sequence of the RNA fragment sequence; or wherein, the nucleotide sequence encodes one or more RNAs that inhibit gene expression comprises successively: 5’ flanking sequence, RNA fragment sequence, stem-loop sequence, compensation sequence and 3’ flanking sequence; or a second nucleotide encoding a targeting protein.” Claim(s) 6 and 8 depend from claim 1 and further limit “a second nucleotide encoding a targeting protein” embodiment, “wherein the targeting protein is a target tissue-specific targeting peptide.”, (claim 6); and “wherein the target tissue-specific targeting peptide is selected from the group consisting of RVG targeting peptide, GEl1 targeting peptide, PTP targeting peptide, TCP-1 targeting peptide, and MSP targeting peptide.”, (claim 8). Claim(s) 1, 6, 8, and 13 are not markedly different from the product’s naturally occurring counterpart in the natural state because Biotechne (Macrophage Stimulating Protein (MSP) | R&D Systems, First printed in R&D Systems’ 1998 Catalog, pages 1-7, Accessed 06/17/2026) teaches, “Human MSP is an 85 kDa, disulfide-linked, heterodimeric glycoprotein that shares considerable homology with hepatocyte growth factor (HGF).7-10 MSP is synthesized initially as a prepropeptide. Following cleavage of the signal peptide, the 693 amino acid (aa) residue propeptide is proteolytically cleaved at an Arg-Val bond to generate two polypeptide chains that remain associated to form a heterodimeric protein. . . Although a number of enzymes are known that can potentially cleave MSP,18, 19 it has recently been suggested that physiologically important MSP is only generated at the surface of macrophages (or other target cells), resulting in locally restricted levels of the cytokine.20 Cells known to produce MSP are limited and include hepatocytes,21 developing sperm,9 plus embryonic floor plate and myotome cells.12”, (see page 2-3 under Structural information). This judicial exception is not integrated into a practical application because claim(s) 1-6, 8 and 13 do not include any element in addition to the judicial exception. Claim 13 recites, “A pharmaceutical composition including a nucleic acid comprising: . . .” A “pharmaceutical composition” of claim 13 reads on a cell and/or cytoplasm, which Starega-Roslan et al teaches, “In cooperation with the guanine triphosphatase (GTPase) Ran, Exp-5 transports the pre-miRNA from the nucleus to the cytoplasm irrespective of its nucleotide sequence and the presence of various structural motifs.”, (see page 2860, col 1, lines 16-20; and see figure 1 annotated above). The claim(s) does/do not include additional elements that are sufficient to amount to significantly more than the judicial exception because the claimed invention does not have any elements in addition to the judicial exception. Thus, the claims are directed to a product of nature without significantly more. Claim Rejections - 35 USC § 112(b) – indefiniteness The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim(s) 1-12 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claim 1, the preamble requires An isolated nucleic acid comprising a nucleotide sequence encoding an RNA capable of inhibiting expression of a gene. The body of the claim contains three alternative embodiments: (1) a first nucleic acid sequence encoding: one or more RNAs that inhibit gene expression, and the RNA is selected from the group consisting of miRNA, shRNA, siRNA, mRNA, ncRNA, sgRNA, and a combination thereof; wherein, the nucleotide sequence comprises an RNA fragment sequence targeting the gene, and one or more of a flanking sequence, a stem-loop sequence, and a compensation sequence of the RNA fragment sequence; (2) a first nucleic acid sequence encoding: one or more RNAs that inhibit gene expression, and the RNA is selected from the group consisting of miRNA, shRNA, siRNA, mRNA, ncRNA, sgRNA, and a combination thereof; wherein, the nucleotide sequence encodes one or more RNAs that inhibit gene expression comprises successively: 5' flanking sequence, RNA fragment sequence, stem-loop sequence, compensation sequence and 3' flanking sequence; or (3) a second nucleotide encoding a targeting protein. Regarding claim 10, the preamble requires A vector of RNA that inhibits gene expression. The body of the claim contains two alternative embodiments: a first nucleotide sequence encoding one or more RNAs that inhibit gene expression, and the RNA is selected from the group consisting of miRNA, shRNA, siRNA, mRNA, ncRNA, sgRNA, and a combination thereof; or a second nucleotide sequence encoding a targeting protein. The specification defines “targeting protein” as the following: “In one embodiment of the present invention, the targeting protein is a target tissue-specific targeting peptide. In one embodiment of the present invention, the targeting protein is a fusion protein of a target tissue-specific targeting peptide and a membrane protein. . . In one embodiment of the present invention, the targeting protein is a membrane protein, which is, for example, selected from the group consisting of a receptor protein (such as a growth factor receptor), LAMP1 or LAMP2 (such as LAMP2B), and an antibody or an antigen-binding fragment thereof. In one embodiment of the present invention, the targeting protein is RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP-1-LAMP2B fusion protein, or MSP-LAMP2B fusion protein.”, (paras [0056]-[0060]). Moreover, the specification discloses, “In practical applications, the targeting protein can be combined with various RNAs that inhibit gene expression to inhibit their specific target genes in different tissues.”. Thus, the specification is silent on the capability of a targeting protein to inhibit expression of a gene unless the targeting protein is combined with various RNAs that inhibit gene expression. Therefore, the claims are considered indefinite because there is a question or doubt as to whether the claim requires a nucleic acid comprising a sequence encoding an RNA capable of inhibiting expression of a gene, because the claims include an embodiment which is only “a second nucleotide sequence encoding a targeting protein.” Accordingly, claim(s) 2-9, and 11-12 are rejected for being dependent upon claim(s) 1 and 10, respectively. Claim Rejections - 35 USC § 112(d) – Improper Dependent The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claim 2 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 2 recites, The isolated nucleic acid according to claim 1, wherein the first nucleotide sequence encodes an RNA that inhibits gene expression. Claim 2 merely recites what is required from the preamble of claim 1, and therefore does not further limit claim 1. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 112(a) – Written Description The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claim(s) 1-3 and 5-14 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The fundamental factual inquiry is whether the specification conveys with reasonable clarity to those skilled in the art that, as of the filing date sought, Applicant was in possession of the invention as now claimed. See, e.g., Vas-Cath, Inc., 935 F.2d at 1563-64, 19 USPQ2d at 1117. Claim(s) 1-3, 5-14 are drawn to a genus of “mRNA” for inhibiting expression of a gene. The rejected claims thus comprise a genus of mRNA and are defined as belonging to the broad class of mRNA that must be capable of inhibiting expression of a gene. Claim 9 is drawn to a genus of “antigen-binding fragment” for functioning as a membrane protein. The rejected claim thus comprises a genus of antigen-binding fragment and are defined as belonging to the broad class of antigen-binding fragments and must be capable of being a membrane protein. To satisfy the written description requirement, MPEP §2163 states, in part “… a patent specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention.” Moreover, the written description requirement for a genus may be satisfied through sufficient description of a representative number of species by “… disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between functional and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus.” Description from the specification The specification discloses measuring mRNA levels numerous times throughout the working examples and figures. The specification envisions the mRNA as “The efficiency of the promoters in initiating the expression of the RVG-Lamp2b fusion protein was assessed. The CMV promoter generates RVG-Lamp2b mRNA and marker protein eGFP in HEK293T cells.”, (see [00337]). These results are not necessarily predictive of any/all “mRNAs” capable of inhibiting gene expression. Thus, it is impossible for one to extrapolate that the genus of mRNAs would necessarily meet the structural/functional characteristics of the rejected claims. The specification discloses describing immunohistochemistry and the role of antigen-binding [00324]. The specification envisions the antigen-binding fragment as, “In one embodiment of the present invention, the targeting protein is a membrane protein, which is, for example, selected from the group consisting of a receptor protein (such as a growth factor receptor), LAMP1 or LAMP2 (such as LAMP2B), and an antibody or an antigen-binding fragment thereof.”, (see [0059]). These results are not necessarily predictive of any/all “antigen-binding fragments” capable of functioning as a membrane protein. Thus, it is impossible for one to extrapolate from the genus of antigen-binding fragments would necessarily meet the structural/functional characteristics of the rejected claims. Description from the prior art The prior art does not appear to offset the deficiencies of the instant specification in that it does not describe a set of “mRNA(s)” capable of inhibiting gene expression. NIH (Messenger RNA (mRNA), Genetics-Glossary, National Human Genome Research Institute, pages 1-4, accessed 06/17/2026) teaches the definition of mRNA, “Messenger RNA (abbreviated mRNA) is a type of single-stranded RNA involved in protein synthesis. mRNA is made from a DNA template during the process of transcription. The role of mRNA is to carry protein information from the DNA in a cell’s nucleus to the cell’s cytoplasm (watery interior), where the protein-making machinery reads the mRNA sequence and translates each three-base codon into its corresponding amino acid in a growing protein chain.”, (see page 2). PNG media_image2.png 308 746 media_image2.png Greyscale Haseltine et al (The RNA Revolution in the Central Molecular Biology Dogma Evolution, Int J Mol Sci, Vol 25, Issue 23, pages 1-23, published 11/26/2024) teaches that there are coding RNA genes and noncoding RNA genes. Messenger RNA (mRNA) is known to be coding (see figure 2 below) unlike microRNAs which are noncoding. Moreover, Haseltine et al teaches, “While RNA does not directly bind to DNA to regulate it in the same way proteins like transcription factors do, in RNA-directed DNA methylation in plants, for instance, noncoding RNAs direct the addition of methyl groups to specific DNA sequences, leading to the silencing of genes involved in abiotic stress responses, development, and the suppression of transposable elements.”, (see page 7, para 8). Therefore, the art does not appear to offset the deficiencies of the specification. Merely describing a “mRNAs” capable of inhibiting gene expression without sufficient detail relating to the genus of mRNAs in inhibiting does not allow the skilled artesian to reasonably conclude that the Applicants were in possession of the claimed invention in claim(s) 1-3, 5-14. The prior art does not appear to offset the deficiencies of the instant specification in that it does not describe a set of “antigen-binding fragments” capable of functioning as a membrane protein. Looking to a review article on antigen-binding fragments, Janeway et al (The structure of a typical antibody molecule, Immunobiology: The Immune System in Health and Disease, 5th edition, New York: Garland Science, pages 1-8, published in 2001) describes antigen-binding -fragment structure: PNG media_image3.png 206 222 media_image3.png Greyscale Janeway et al teaches, “An antibody is identical to the B-cell receptor of the cell that secretes it except for a small portion of the C-terminus of the heavy-chain constant region. In the case of the B-cell receptor the C-terminus is a hydrophobic membrane-anchoring sequence, and in the case of antibody it is a hydrophilic sequence that allows secretion.”, (see page 1, para 1). Further, Janeway et al teaches, “The association of the heavy and light chains is such that the VH and VL domains are paired, as are the CH1 and CL domains. The CH3 domains pair with each other but the CH2 domains do not interact; carbohydrate side chains attached to the CH2 domains lie between the two heavy chains. The two antigen-binding sites are formed by the paired VH and VL domains at the ends of the two arms of the Y (see Fig. 3.1b).”, (see page 3, para 2). Lastly, Janeway et al teaches, “Two fragments are identical and contain the antigen-binding activity. These are termed the Fab fragments, for Fragment antigen binding. The Fab fragments correspond to the two identical arms of the antibody molecule, which contain the complete light chains paired with the VH and CH1 domains of the heavy chains. The other fragment contains no antigen-binding activity but was originally observed to crystallize readily, and for this reason was named the Fc fragment, for Fragment crystallizable. This fragment corresponds to the paired CH2 and CH3 domains and is the part of the antibody molecule that interacts with effector molecules and cells.”, (see page 3, para 3). Thus, the art does not appear to offset the deficiencies of the specification. The portion of an antibody that associates with and anchors to the membrane of a cell is the C-terminus/ CH2 and CH3 domains. Whereas an antigen-binding fragment lacks such domains. Therefore, merely describing a “antigen-binding fragment” capable of functioning as a membrane protein without sufficient detail relating to the genus of antigen-binding fragments functioning as a membrane protein does not allow the skilled artesian to reasonably conclude that the Applicants were in possession of the claimed invention in claim 9. Claim Rejections - 35 USC § 112(a) – Scope of Enablement The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claim 14 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for, A method of treating oncogene-driven cancer, comprising: administering to a subject an effective amount of an oncogene-targeting nucleic acid via intravenous (IV) injection; wherein the oncogene-targeting nucleic acid includes: a first oncogene-targeting nucleotide sequence encoding an RNA capable of inhibiting the expression of an oncogene, or a first target-protein nucleotide sequence encoding a first target protein; wherein the first oncogene-targeting nucleotide sequence encodes one or more RNAs that inhibit oncogene expression, and wherein the RNA is selected from a group consisting of miRNA, shRNA, and siRNA, or a combination thereof; wherein the first oncogene-targeting nucleotide sequence comprises an RNA fragment sequence targeting the oncogene, and one or more of a flanking sequence, a stem-loop sequence, and a compensation sequence of the RNA fragment sequence; or wherein the first oncogene-targeting nucleotide sequence encodes one or more RNAs that inhibit oncogene expression comprises successively: 5' flanking sequence, RNA fragment sequence, stem-loop sequence, compensation sequence, and 3' flanking sequence; or a vector comprising: a second oncogene-targeting nucleotide sequence encoding one or more RNAs that inhibit oncogene expression, wherein the RNA is selected from a group consisting of miRNA, shRNA, and siRNA, or a combination thereof; or a second target-protein nucleotide sequence encoding a second targeting protein; A method of treating pulmonary fibrosis, comprising: administering to a subject an effective amount of a nucleic acid via intravenous (IV) injection; wherein the nucleic acid includes: a first nucleotide sequence encoding an RNA capable of inhibiting the expression of PTP1B, TGFb-1 or MiR-21, or a first target-protein nucleotide sequence encoding a first target protein; wherein the first nucleotide sequence encodes one or more RNAs that inhibit PTP1B, TGFb-1 or MiR-21 expression, and wherein the RNA is selected from a group consisting of miRNA, shRNA, and siRNA, or a combination thereof; wherein the first nucleotide sequence comprises an RNA fragment sequence targeting the PTP1B gene, TGFb-1 gene, or MiR-21, and one or more of a flanking sequence, a stem-loop sequence, and a compensation sequence of the RNA fragment sequence; or wherein the first nucleotide sequence encodes one or more RNAs that inhibit PTP1B gene, TGFb-1 gene, or MiR-21 expression comprises successively: 5' flanking sequence, RNA fragment sequence, stem-loop sequence, compensation sequence, and 3' flanking sequence; or a vector comprising: a second nucleotide sequence encoding one or more RNAs that inhibit PTP1B, TGFb-1, or MiR-21 expression, wherein the RNA is selected from a group consisting of miRNA, shRNA, and siRNA, or a combination thereof; or a second target-protein nucleotide sequence encoding a second targeting protein; A method of treating diabetes and/or diabetes symptoms thereof, comprising: administering to a subject an effective amount of a nucleic acid via intravenous (IV) injection; wherein the nucleic acid includes: a PTP1B nucleotide sequence encoding an RNA capable of inhibiting the expression of PTP1B, or a first target-protein nucleotide sequence encoding a first target protein; wherein the first PTP1B nucleotide sequence encodes one or more RNAs that inhibit PTP1B gene expression, and wherein the RNA is selected from a group consisting of miRNA, shRNA, and siRNA, or a combination thereof; wherein the first PTP1B nucleotide sequence comprises an RNA fragment sequence targeting the PTP1B gene, and one or more of a flanking sequence, a stem-loop sequence, and a compensation sequence of the RNA fragment sequence; or wherein the PTP1B nucleotide sequence encodes one or more RNAs that inhibit PTP1B gene expression comprises successively: 5' flanking sequence, RNA fragment sequence, stem-loop sequence, compensation sequence, and 3' flanking sequence; or a vector comprising: a second PTP1B nucleotide sequence encoding one or more RNAs that inhibit PTP1B gene expression, wherein the RNA is selected from a group consisting of miRNA, shRNA, and siRNA, or a combination thereof; or a second target-protein nucleotide sequence encoding a second targeting protein; A method of treating Huntington’s disease, comprising: administering to a subject an effective amount of a nucleic acid via intravenous (IV) injection; wherein the nucleic acid includes: a first nucleotide sequence encoding an RNA capable of inhibiting the expression of the Huntingtin gene (htt), or a first target-protein nucleotide sequence encoding a first target protein; wherein the nucleotide sequence encodes one or more RNAs that inhibit htt gene expression, and wherein the RNA is selected from a group consisting of miRNA, shRNA, and siRNA, or a combination thereof; wherein the first nucleotide sequence comprises an RNA fragment sequence targeting htt, and one or more of a flanking sequence, a stem-loop sequence, and a compensation sequence of the RNA fragment sequence; or wherein the first nucleotide sequence encodes one or more RNAs that inhibit htt expression comprises successively: 5' flanking sequence, RNA fragment sequence, stem-loop sequence, compensation sequence, and 3' flanking sequence; or a vector comprising: a second nucleotide sequence encoding one or more RNAs that inhibit htt gene expression, wherein the RNA is selected from a group consisting of miRNA, shRNA, and siRNA, or a combination thereof; or a second target-protein nucleotide sequence encoding a second targeting protein; and, A method of treating Parkinson’s disease, comprising: administering to a subject an effective amount of a nucleic acid via intravenous (IV) injection; wherein the nucleic acid includes: a first nucleotide sequence encoding an RNA capable of inhibiting the expression of Leucine-Rich Repeat Kinase 2 (LRRK2), or a first target-protein nucleotide sequence encoding a first target protein; wherein the nucleotide sequence encodes one or more RNAs that inhibit LRRK2 gene expression, and wherein the RNA is selected from a group consisting of miRNA, shRNA, and siRNA, or a combination thereof; wherein the first nucleotide sequence comprises an RNA fragment sequence targeting LRRK2, and one or more of a flanking sequence, a stem-loop sequence, and a compensation sequence of the RNA fragment sequence; or wherein the first nucleotide sequence encodes one or more RNAs that inhibit LRRK2 expression comprises successively: 5' flanking sequence, RNA fragment sequence, stem-loop sequence, compensation sequence, and 3' flanking sequence; or a vector comprising: a second nucleotide sequence encoding one or more RNAs that inhibit LRRK2 gene expression, wherein the RNA is selected from a group consisting of miRNA, shRNA, and siRNA, or a combination thereof; or a second target-protein nucleotide sequence encoding a second targeting protein; does not reasonably provide enablement for the treatment of all diseases with any/all siRNA, miRNA, shRNA, mRNA, ncRNA, or sgRNA capable of inhibiting expression of a gene and/or a nucleic acid that encodes a targeting protein. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims. Enablement is considered in view of the Wands factors (MPEP 2164.01(A)). These include: the breadth of the claims, the nature of the invention, the state of the prior art, the level of one of ordinary skill, the level of predictability in the art, the amount of direction provided by the inventor, the existence of working examples, and the quantity of experimentation needed to make or use the invention. All of the Wands factors have been considered with regard to the instant claims, with the most relevant factors discussed below. Nature of the invention: Claim 14 is drawn to a method of treating a disease comprising: administering to a subject a nucleic acid; wherein the nucleic acid includes: a first nucleotide sequence encoding an RNA capable of inhibiting expression of a gene, or a second nucleotide sequence encoding a target protein; wherein the first nucleotide sequence encodes one or more RNAs that inhibit gene expression, and wherein the RNA is selected from the group consisting of miRNA, shRNA, siRNA, mRNA, ncRNA, sgRNA, or a combination thereof; wherein the first nucleotide sequence comprises an RNA fragment sequence targeting the gene, and one or more of a flanking sequence, a stem-loop sequence, and a compensation sequence of the RNA fragment sequence; or wherein the first nucleotide sequence encodes one or more RNAs that inhibit gene expression comprises successively: 5' flanking sequence, RNA fragment sequence, stem-loop sequence, compensation sequence, and 3' flanking sequence; or a vector comprising: a third nucleotide sequence encoding one or more RNAs that inhibit gene expression, wherein the RNA is selected from the group consisting of miRNA, shRNA, siRNA, mRNA, ncRNA, sgRNA, or a combination thereof; or a fourth nucleotide sequence encoding a targeting protein. The nature of the invention is complex in that it the first nucleotide sequence must be capable of inhibiting any/all gene expression and treating any/all diseases, the second nucleotide encoding a target protein must be capable of treating any/all diseases, a vector comprising a third nucleotide must be capable of inhibiting any/all gene expression and treating any/all diseases, and a fourth nucleotide encoding a targeting protein must be capable of treating any/all diseases. Breadth of the claims: The broadest reasonable interpretation of claim 14 is that it encompasses a method of treating any/all diseases by administering any/all nucleic acids capable of inhibiting expression of any/all genes and/or a nucleic acid encoding any/all targeting protein nucleic acid sequences. The complex nature of the subject matter of this invention is greatly exacerbated by the breadth of the claims. Guidance of the specification and existence of working examples: Applicant provides examples for construction and use of a promoter-driven plasmid (e.g., CMV or ALB) and AAVs that contain one or more siRNAs (e.g., EGFR, KRAS, TNC, mTOR, VEGFR; TNFa; B7, integrin a; PTP1B; HTT; LRRK2) inserted into a specific microRNA backbone (see Figure 3A-C; 8;). Applicant demonstrates in tissue culture and in injections (e.g., IV) into mice that this construct (i.e., promoter + siRNA inserted into a microRNA backbone) can utilize the cell’s own exosomal packaging machinery to broadly target tissues/organs or with the combination of a targeting peptide (e.g., RVG, GE11, PTP, GEPTP, TCP-1, MSP) with or without a membrane protein (i.e., LAMP2B) can be directed to specific tissues/organs of the body (see Fig.4A-B; 5A-B; 6; 7A-B; all of 10; ). Applicant demonstrates (1) treatment of EGFR mutant lung cancer tumors (Figure 11A-F) with an EGFR siRNA inserted into the microRNA backbone promoted by a CMV or ALB in a non-viral vector (Figure 15A) or by AAV (figures 26A-E); (2) treatment of KRAS mutant lung cancer tumors (Figures 13A-G) with a KRAS siRNA inserted into the microRNA backbone promoted by CMV in a non-viral vector or by AAV (Figures 25A-D); (3) treatment of kidney cancer tumors using VEGFR and/or mTOR siRNA (Figure 39 and 40A-B); (4) treatment of pancreatic cancer with AAV-PTP-siR-KRAS (Figure 49A); (5) treatment of glioma with AAV-RVG-siR-EGFR+TNC (Figure 49B; 120A-F); (6) treatment of colitis or colon cancer with AAV-CMV-TNFa+B7+integrin siRNA (Figure 60B-C;63A-B); (7) Treatment of pulmonary fibrosis with CMV-siRNA or shRNA or miRNA targeting PTP1B with and without a GE11 targeting peptide (Figures 98-100) and AAVs with miRNA-21 and/or TGFb1 siRNA (Figures 107) and a Lentivirus (Figures 108-109); (8) Treatment of obesity-related diseases with nonviral CMV-PVG-siRNA-PTP1B (Figure 160A-C; all of 161) and in an AAV (all of figure 163); (9) Treatment of Huntington’s disease with nonviral CMV-RVG-siRNA-HTT (all of figures 176 and 177) and in an AAV (all of figure 178) and in a lentiviral (figures 179 and 180); and (10) treatment of Parkinson’s disease with nonviral CMV-RVG-siRNA-LRRK2 (all of Figure 197) and lentiviral (Figure 215) and AAV (Figure 216). Applicant uses various promoters (ALB or CMV), uses bother siRNA and shRNA, and microRNAs such as miR7 and miR-133b separate or in combination with siRNA or shRNA (see all of Figures 15-17). Applicant uses lentivirus with TNF-siRNA (figure 64A-C; 65; 66A-C). Applicant uses different targeting peptides when treating Huntington’s disease or Parkinson’s disease, i.e., GEPTP, GE11, TCP-1, MSP, and RVG, all conjugated to LAMPB2 (Figure 194 and Figure 210). Applicant tested vectors in Macaca Fascicularis (Figures 230 and 231). Applicant does not provide working examples of a nucleic acid encoding a targeting protein treating a disease on its own. Predictability and state of the art: Matharu et al (Modulating gene regulation to treat genetic disorders, Nature Reviews Drug Discovery, volume 19, pages 757-775, published 10/05/2020) teaches that not all diseases require the inhibition of gene expression for treatment of said disease. Many diseases require the restoration of protein function, overexpression of missing/downregulated proteins, or post-translational regulation of proteins. More specifically, Matharu et al teaches, “According to the ClinVar database1, it is estimated that 516 genes lead to human disease in a recessive manner due to loss-of-function mutations in both copies, whereas an estimated 660 genes are known to cause disease when haploinsufficient2. In addition, the ClinVar1 and ClinGen3 databases indicate that mutations in 65 genes are known to be pathogenic due to gain of function.”, (page 757, col 1, para 1). “There are an estimated 660 genes that when haploinsufficient lead to human diseases, ranging from epilepsy to cancer, polycystic kidney disease, blindness and many others2. Analyses of large-scale sequencing studies24,25 estimate this number to be much higher, finding 3,230 loss-of-function intolerant genes, 88% of which are predicted to be due to severe haploinsufficiency. A CRT approach to upregulate the expression of the existing normal gene copy could be a potential treatment for these diseases. . . The feasibility of using a CRT approach to upregulate gene expression for an haploinsufficient disease was initially demonstrated by the rescue of haploinsufficiency-caused obesity in mice2. Heterozygous loss-of-function mutations (haploinsufficiency) in the genes single-minded family basic helix–loop–helix (bHLH) transcription factor 1 (SIM1) or melanocortin 4 receptor (MC4R) are a major cause of human obesity26.”, (page 759, col 1, para 1 to para 2; see Figure 2). “Aberrant levels of DNA methylation can lead to abnormal gene dosage and are associated with many neurological diseases69. For example, Fragile X syndrome (FXS; OMIM 300624) is caused by a CGG trinucleotide repeat expansion of over 200 copies in the 5′UTR of the FMRP translational regulator 1 (FMR1) gene promoter, which leads to hypermethylation of the FMR1 promoter, subsequently silencing gene expression70. Demethylation of the FMR1 promoter can reactivate gene function and rescue FXS-associated phenotypes71,72,73. Modulating the levels of DNA methylation could be possible using CRT tools that alter the disease-associated gene expression levels.”, (page 764, col 2, para 2 to page 765, col 1, para 1 and see figure 4). “Chromatin structure and organization can discretely modulate the activity of CREs that regulate gene expression. Several studies have implicated aberrant chromatin structure and histone modifications in organism development, cell differentiation and human disease12,79,80.”, (page 767, col 1 para 4 to page 768, col 2, para 1). Amount of experimentation necessary: The quantity needed to carry out the scope of the invention is large. (1) One would need to test whether inhibiting expression of genes related to loss-of-function mutations would result in the treatment of said diseases; (2) One would need to test whether inhibiting expression of genes related to DNA methylation or histone modifications result in treatment of diseases related to such genes; and lastly, (3) One would need to test whether a genus of targeting proteins is capable of treating a genus of diseases. This type of experimentation is not routine in the art and would require a large amount of inventive effort. Further considering that any positive results (e.g., successful treatment of any/all diseases by gene inhibition any/or administering a nucleic acid encoding a targeting protein) would amount to a significant advancement in the state of the art, additional experimentation required is considered undue. In view of the breadth of the claims and the lack of guidance provided by the specification as well as the unpredictability of the art, the skilled artisan would have required an undue amount of experimentation to make and/or use the claimed invention. Therefore, claim 14 is not considered to be enabled by the instant disclosure for the treatment of all diseases but is scoped to the enablement of the embodiments above. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claim(s) 1-11 and 13-14 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Fu et al (In vivo self-assembled small RNAs as a new generation of RNAi therapeutics, Cell Research, volume 31, pages 631-648, published 03/29/2021). Regarding claim(s) 1-4, 10, and 13 Fu et al teaches, “As an example, two types of composable parts were incorporated to optimize the siRNA effects: one modifying the membrane-anchored proteins of exosomes to enable tissue selectivity; the other enabling the co-expression of a second siRNA for the simultaneous downregulation of two molecular targets (Fig. 1a).”, (page 632, col 1, para 2); see Fig. 1a and Fig. 1b below). Wherein Fig. 1a demonstrates two siRNAs. Wherein “cell chassis” in Fig. 1a reads on a pharmaceutical composition. PNG media_image4.png 542 450 media_image4.png Greyscale PNG media_image5.png 147 384 media_image5.png Greyscale Wherein “guiding tag” reads on a targeting protein in Fig. 1a. Regarding claim 5, Fu et al teaches, “The CMV-siRE circuit was generated by inserting an EGFR siRNA sequence (5′-TGTGGCTTCTCTTAACTCCT-3′) into a 166-bp pre-miR-155 backbone. . . The fused tag-Lamp2b and two tandem pre-miR-155 backbones carrying the EGFR siRNA sequence (5′-TGTGGCTTCTCTTAACTCCT-3′) and the TNC siRNA sequence (5′-CACACAAGCCATCTACACATG-3′) were then cloned downstream of the CMV promoter, resulting in the generation of a circuit that simultaneously encodes EGFR and TNC siRNAs and the tag-Lamp2b fusion protein. . .”, (page 648, col 2, para 3). Wherein the siRNA bolded above are 20 nucleotides, 20 nucleotides, and 21 nucleotides, respectively. Regarding claim(s) 6-9, Fu et al teaches, “For the design of composable guidance part, a sequence encoding a tissue-targeting tag fused to the N-terminus of Lamp2b (a canonical exosome membrane protein) was inserted downstream of the CMV promoter (Fig. 1a). This tag should be anchored to the exosome surface via Lamp2b, thus guiding the delivery of the exosomal cargo to the desired tissue. Specifically, a central nervous system-targeting RVG peptide was chosen as the tag to direct exosomes to the brain (RVG has been shown to facilitate transcytosis of exosomes across the blood-brain barrier and into neuronal cells).”, (see page 632, col 2, para 2). Regarding claim 11, Fu et al teaches, “Genetic circuits were present in the form of DNA plasmids and were dissolved in PBS without additional formulations.”, (see page 648, col 2, para 4). Regarding claim 14, Fu et al teaches, two different models of lung cancer, an EGFR-driven and a KRAS-driven lung cancer models (non-small cell lung cancer and lung adenocarcinoma). Fu et al teaches in Figures 3 and 4 the ability to diminish tumor size and promote survival with the gene circuit described in Fig. 1a (see image above). More specifically, Fu et al teaches, “Overall, these results indicate that intravenous injection of the core circuit effectively induced functional siRNA in vivo, and this approach may serve as a potential therapeutic regimen for lung cancer.”, (see page 638, col 1, para 1; also see figures 3 and 4). Further, Fu et al teaches inhibiting tumor growth and promoting survival in glioblastoma mouse models with the combination of EGFR and TNC siRNAs (see figure 5). Lastly, Fu et al teaches treating obesity and diabetes by restoring leptin and insulin sensitivity, decreasing adiposity, and increasing energy expenditure (see figure 6). More specifically, “Overall, these results suggest that the inhibition of central and peripheral PTP1B using genetic circuits may overcome leptin and insulin resistance and provide an attractive strategy to combat obesity.”, (see page 641, col 1, para 1). Accordingly, claim(s) 1-11 and 13-14 are anticipated by Fu et al. Applicant cannot rely upon the certified copy of the foreign priority application to overcome this rejection because a translation of said application has not been made of record in accordance with 37 CFR 1.55. When an English language translation of a non-English language foreign application is required, the translation must be that of the certified copy (of the foreign application as filed) submitted together with a statement that the translation of the certified copy is accurate. See MPEP §§ 215 and 216. Claim(s) 1-14 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Zhang et al (CN 109971756A, published 07/05/2019; IDS filed 09/27/2023 citation 1 under Foreign Patents as evidenced by the machine translation has been submitted with this action - all paragraph citations refer to the machine translation). PNG media_image8.png 60 128 media_image8.png Greyscale Regarding claim(s) 1-2 and 4-5, Zhang et al teaches, “This invention provides a novel siRNA that inhibits EGFR gene expression, its precursor, and its application in tumor treatment. In a first aspect, the present invention provides a precursor sequence having a structure shown in Formula I at its 5' to 3' ends”, (see para [0010]-[0011]; and formula I below). Moreover, Zhang et al teaches, “B1 is the required first ribonucleic acid sequence, wherein the first ribonucleic acid sequence includes the EGFR siRNA positive strand sequence, and the nucleotide sequence of the EGFR siRNA positive strand is shown in SEQ ID NO:1; B2 is a sequence that is either substantially complementary or completely complementary to B1, and B2 is not complementary to C; C represents the stem-loop structure sequence; A1 and A2 are either empty or optional RNA sequences consisting of bases; The precursor sequence can be processed in the host to form EGFR siRNA.”, (see paras [0013] to [0017]). Wherein SEQ ID NO: 1 is uguugcuucucuuaauuccu (see para [0210]). Regarding claim 3, Zhang et al teaches combining two siRNAs, EGFR and TNC in figure 3B-I for the treatment of glioblastoma. Regarding claim(s) 6-9, Zhang et al teaches, “Considering that EGFR also plays a key role in glioma formation, a plasmid was constructed that simultaneously expresses the MLFEGFR fragment and Lamp2b protein (a membrane protein widely expressed in exosomes) and is fused with a short peptide of rabies virus surface glycoprotein (RVG peptide binds to acetylcholine receptors expressed by nerve cells) (Figure 2A).”, (see para [0180]). Regarding claim(s) 10-11, Zhang et al teaches, “In another preferred embodiment, the expression vector further contains (i) a polynucleotide encoding a short peptide (RVG peptide) of rabies virus surface glycoprotein, and (ii) a precursor sequence of TNC siRNA or a polynucleotide that can be transcribed by the host to form a precursor sequence of TNC siRNA. In another preferred embodiment, the expression vector includes a viral vector and a non viral vector. In another preferred embodiment, the expression vector is a plasmid.”, (see para [0035]-[0037]). Regarding claim 12, Zhang et al teaches, “In this invention, the expression vector is not particularly limited and includes commercially available or conventionally prepared expression vectors. Representative examples include (but are not limited to): pcDNATM6.2-GW/miR, pcDNA3, . . , pshRNA-copGFP Lentivector, GV317, GV309, GV253, GV250, GV249, GV234, GV233, GV232, GV201, GV159 or other GV series eukaryotic expression vectors.”, (see para [0123]). Regarding claim 13, Zhang et al teaches, “In a fourth aspect, the present invention provides a pharmaceutical formulation comprising: (a) An expression vector for expressing siRNA that represses EGFR gene expression; and (b) A pharmaceutically acceptable carrier. . .”, (see paras [0039]-[0041]). Regarding claim 14, Zhang et al teaches treating lung cancer in Figures 1A-K. Zhang et al teaches treating glioblastoma in Figures 3A-I. Accordingly, claims 1-14 are anticipated by Zhang et al. Claim(s) 1-2, 4-5, and 10-14 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by 173 (US 10,533,173 B2; published 01/14/2020). Regarding claim 1, 173 discloses a precursor formula at col 6, lines 30 that reads on 5’ flanking sequence, RNA targeting sequence, stem loop, compensation sequence, and 3’ flanking sequence. 173 also discloses a polynucleotide encoding the precursor (see col 7, lines 15-16). Regarding claim 2 and 4-5, 173 discloses EGFR siRNA and its corresponding sequences (col 6, lines 34, and 43-49). Regarding claim 10-11, 173 discloses an expression vector containing the precursor, wherein the vector can be viral or nonviral or a plasmid (col 7, lines 24-31). Regarding claim 12, 173 discloses use of lentivector as the expression vector (col 14, line 2). Regarding claim 13, 173 discloses pharmaceutical composition comprising the precursor sequence (col 7, lines 49-53). Regarding claim 14, 173 discloses treating malignant tumors related to cancer with high expression of miRNA-214 (col 8, lines 9-21). Accordingly, claim(s) 1-2, 4-5, and- 10-14 are rejected as being anticipated by 173. Claim(s) 1-5, 10-11, and 13-14 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by 481 (US 10,273,481 B2; published 04/30/2019). Regarding claim(s) 1-5 and 10, 481 discloses figure 1, which contains at least one flanking region, an RNA fragment and its corresponding compensation sequence and a stem loop. Figure 1 discloses three RNAs. 481 more specifically discloses the formula, (formula V) of the RNA used to inhibit Bruton's agammaglobulinemia tyrosine kinase (BTK) (see col 1, line 61- PNG media_image9.png 260 436 media_image9.png Greyscale 67 to col 2, line 1-11). Regarding claim 11, 481 discloses the use of a plasmid carrying the siRNA in Figure 7. Regarding claim 13, 481 discloses pharmaceutical composition with the precursor RNAs (col 2, lines 40-44 and 48-50). Regarding claim 14, 481 discloses a method for treating Chronic Lymphocytic Leukemia (CLL) comprising administering the BTK-inhibiting nucleotide (col 5, lines 9-14). Accordingly, claim(s) 1-5, 10-11, and 13-14 are anticipated by 481. Claim(s) 1, 5, 10, and 13-14 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by 441 (US 10,519,441 B2; published 12/31/2019) as evidenced by Starega-Roslan et al (The role of the precursor structure in the biogenesis of microRNA, Cell. Mol. Life Sci. Vol 68, pages 2859-2871, published May 24th, 2011). Regarding claim 1, “The miRNA of the present invention refers to the microRNA-214 family, and said miRNA-214 family includes: miRNA-214 or modified miRNA-214 derivatives, which perform the same or basically the same functions as miRNA-214”, (col 9, lines 55-59). Further, “MiRNAs can be processed with precursor miRNAs (pre-miRNAs). Said pre-miRNAs can fold into a stable stem-loop (hairpin) structure, of which the length is usually within 50-100 bp. Said pre-miRNA can fold into a stable stem-loop structure, and the two sides of the stem part of said stem-loop structure comprise two sequences that are substantially complementary.”, (col 9, lines 5-11). 441 does not explicitly teach 5’ and/or 3’ flanking sequences on miRNA. Starega-Roslan et al teaches microRNA structure wherein the nucleotide sequence comprises an RNA fragment sequence targeting the gene, and one or more of a flanking sequence (5' flanking sequence), a stem-loop sequence, a compensation sequence of the RNA fragment sequence (reading on the antisense and/or miRNA* strand) and a 3' flanking sequence (see figure 1 below). PNG media_image1.png 337 468 media_image1.png Greyscale Regarding claim 5, 441 teaches, “The present invention provides a type of miRNA relating to the immune evasion of tumors. As used herein, said ‘miRNA’ refers to a type of RNA molecules that can be processed with the transcription product that can turn into the miRNA precursors. Mature miRNAs usually comprise 18-26 nucleotides (nt) (more particularly, 19-22 nt), not excluding other numbers of nucleotides.”, (col 8, lines 55-61). Regarding claim 10, 441 teaches vectors, i.e., expression vectors containing the miRNA (col 3, lines 25-27). Regarding claim 13, 441 teaches, “In the first aspect of the present invention, provided is a use of inhibitors of miRNA-214 or precursor thereof for preparing a pharmaceutical composition for inhibiting Treg cells and thereby promoting T cells-induced immune responses.”, (col 2, lines 12-17). Regarding claim 14, 441 teaches, “The miRNA-214 and its precursor of the present invention can be used to inhibit the immune response, so as to treat auto-immune diseases caused by immune hyperfunction”, (col 11, lines 11-14). Accordingly, claim(s) 1, 5, 10, and 13-14 are anticipated by 441. Claim(s) 1-2, 10-11, and 13-14 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by 603 (US 10,227,603 B2; published 03/12/2019) as evidenced by Starega-Roslan et al (The role of the precursor structure in the biogenesis of microRNA, Cell. Mol. Life Sci. Vol 68, pages 2859-2871, published May 24th, 2011). Regarding claim(s) 1-2, 603 teaches knocking down alanine aminotransferase with microRNA from a transgenic plant in figure 4. 603 also teachings microRNA to interfere with the NDRG1 gene (col 21, lines 17-18). 603 does not explicitly teach miRNA structure. PNG media_image1.png 337 468 media_image1.png Greyscale Starega-Roslan et al teaches microRNA structure wherein the nucleotide sequence comprises an RNA fragment sequence targeting the gene, and one or more of a flanking sequence (5' flanking sequence), a stem-loop sequence, a compensation sequence of the RNA fragment sequence (reading on the antisense and/or miRNA* strand) and a 3' flanking sequence (see figure 1 below). Regarding claim(s) 10-11, 603 teaches the construction of vectors (plasmids) stably expression exogenous microRNA (col 21, see example 2.1). Regarding claim 13, 603 teaches a pharmaceutical composition comprising exogenous functional microRNA (col 6, lines 40-45, and 49-56) Regarding claim 14, 603 teaches, “In another one preferred example, said method is also used for treating microRNA targeted gene-related diseases.”, (col 6, lines 17-18). Accordingly, claim(s) 1-2, 10-11, and 13-14 are anticipated by 603. Claim(s) 1-2, 4-5, 10-12, and 13-14 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by 932 (US 10,308,932 B2; published 06/04/2019) as evidenced by Starega-Roslan et al (The role of the precursor structure in the biogenesis of microRNA, Cell. Mol. Life Sci. Vol 68, pages 2859-2871, published May 24th, 2011). Regarding claim(s) 1-2, 4, 932 teaches, “In a second aspect of the present invention, provided is a use of a functional microRNA and/or siRNA for preparing a composition to be applied to mammals, said composition forms cell microvesicles at a first site in the body of an animal and is delivered to a second site so as to regulate the expression of the target genes of the functional microRNA and/or siRNA at the second site, in which the second site is different from the first site. In another preferred example, said target genes include MYC, K-ras, CCND2, cdk6, E2F3, MEK2, ERK5, PTGS2, and DFF45.”, (col 2, lines 51-61). 932 does not explicitly teach 5’ and/or 3’ flanking sequences on miRNA. PNG media_image1.png 337 468 media_image1.png Greyscale Starega-Roslan et al teaches microRNA structure wherein the nucleotide sequence comprises an RNA fragment sequence targeting the gene, and one or more of a flanking sequence (5' flanking sequence), a stem-loop sequence, a compensation sequence of the RNA fragment sequence (reading on the antisense and/or miRNA* strand) and a 3' flanking sequence (see figure 1 below). Regarding claim 5, 932 teaches that microRNAs are about 19-23 nucleotides (col 1, line 18). Regarding claim 10, 932 teaches the preparation of vectors expressing microRNA of the invention (col 12, lines 8-12). Regarding claim(s) 11-12, 932 teaches constructing a plasmid and an adenovirus overexpression miR-145 (col 17, lines 8-14) Regarding claim 13, 932 teaches a pharmaceutical composition comprising the functional microRNA of the invention (col 4, lines 10-15). Regarding claim 14, 932 teaches that one of the objects of the invention is to use a functional microRNA to treat a disease (col 2, lines 26-33). Accordingly, claim(s) 1-2, 4-5, 10-12, and 13-14 are anticipated over 932. Claim(s) 1-2, 4-5, and 10-14 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by 970 (US 11,304,970 B2, published 04/19/2022, filing date of 05/05/2016). The applied reference has two common inventors with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2). This rejection under 35 U.S.C. 102(a)(2) might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C. 102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B) if the same invention is not being claimed; or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed in the reference and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. Regarding claim(s) 1-2 and 4-5, 970 teaches, “The present invention provides a novel siRNA that inhibits the EGFR gene, and precursors and applications thereof in the treatment of tumours.”, (col 2, lines 9-12). PNG media_image10.png 60 94 media_image10.png Greyscale Moreover, “siRNAs can be obtained by processing the precursor siRNAs, and the said precursor siRNAs can be folded into a stable stem-loop (hairpin) structure having a general length of 50-100 bp. The said precursor siRNAs can be folded into a stable stem-loop structure, and two sides of the stem of the stem-loop structure contain two sequences substantially complementary to each other. In the present invention, the said precursor siRNAs are artificially synthesised precursor siRNAs, and the said precursor siRNAs have the structure as shown in formula I: As a representative example, B1 is EGFR siRNA sense strand sequence; B2 is a sequence with complementarity (including substantial and complete complementarity) to B1; C can be a sequence: 5′-3′, GUUUUGGCCACUGACUGAC (SEQ ID NO: 202); A1 and A2 are null or optionally nucleotide sequences consisting of 4-5 bases respectively; Wherein, the precursor siRNA as shown can be processed in the host to form the EGFR siRNA. In the present invention, the precursor miRNA forming the EGFR siRNA can be spliced to generate an siRNA regulating the EGFR gene, i.e. the EGFR siRNA (for example, SEQ ID NO.: 197).”, (col 6, lines 28-60). Regarding claim(s) 10-11, 970 teaches, expression vectors, viral or nonviral (plasmid), containing the precursor siRNA (col 2, lines 60-63). Regarding claim 12, 970 teaches using Lentivector as an expression vector (col 8, line 37) Regarding claim 13, 970 teaches a pharmaceutical preparation comprising: (a) an expression vector for expression of a EGFR siRNA sequence; and (b) a pharmaceutically acceptable carrier (col 3, lines 1-5). Regarding claim 14, 970 teaches treating diseases associated with highly expressed EGFR (col 5, lines 1-3). Accordingly, claim(s) 1-2, 4-5, and 10-14 are anticipated by 970. Claim(s) 1-2, 4-5, and 10-14 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by 213 (US 10,982,213 B2, published 04/20/2021, filing date of 05/05/2016). The applied reference has two common inventors with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2). This rejection under 35 U.S.C. 102(a)(2) might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C. 102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B) if the same invention is not being claimed; or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed in the reference and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. Regarding claim(s) 1-2 and 4-5, 213 teaches, “The present invention provides a novel siRNA that inhibits the K-RAS gene, and precursors and applications thereof in the treatment of tumours.”, (col 2, lines 36-38). PNG media_image10.png 60 94 media_image10.png Greyscale Moreover, “siRNAs can be obtained by processing the precursor siRNAs, and the said precursor siRNAs can be folded into a stable stem-loop (hairpin) structure having a general length of 50-100 bp. The said precursor siRNAs can be folded into a stable stem-loop structure, and two sides of the stem of the stem-loop structure contain two sequences substantially complementary to each other. In the present invention, the said precursor siRNAs are artificially synthesised precursor siRNAs, and the said precursor siRNAs have the structure as shown in formula I: As a representative example, B1 is K-RAS siRNA sense strand sequence; B2 is a sequence with complementarity (including substantial and complete complementarity) to B1; C is a sequence as shown (GUUUUGGCCACUGACUGAC); A1 and A2 are null or optionally nucleotide sequences consisting of 4-5 bases respectively; wherein the precursor siRNA as shown can be processed in the host to form the K-RAS siRNA.”, (see col 7, lines 58-67 to col 8, lines 1-17). Regarding claim(s) 10-11, 213 teaches, expression vectors, viral or nonviral (plasmid), containing the precursor siRNA (col 3, lines 13-21). Regarding claim 12, 213 teaches using Lentivector as an expression vector (col 8, line 63) Regarding claim 13, 213 teaches a pharmaceutical preparation comprising: (a) an expression vector for expression of a K-RAS siRNA sequence; and (b) a pharmaceutically acceptable carrier (col 3, lines 25-29). Regarding claim 14, 213 teaches treating diseases associated with highly expressed KRAS (col 5, lines 41-44). Accordingly, claim(s) 1-2, 4-5, and 10-14 are anticipated by 213. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claim(s) 1-14 are rejected under 35 U.S.C. 103 as being unpatentable over Claim(s) 1-14 are rejected under 35 U.S.C. 103 as being obvious over 048 (US 12,553,048 B2, published 02/17/2026, filing date of 12/17/2019) in view of 213 (US 10,982,213 B2, published 04/20/2021, filing date of 05/05/2016). The applied reference has a common inventor(s) and Applicant/Assignee with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2). Regarding claim(s) 1-2 and 4-5, 048 teaches a first siRNA molecule capable of reducing the expression of EGFR or KRAS with SEQ ID NO: 1 or 2 (col 6, lines 29-39). Regarding claim 3, 048 teaches using multiple RNA targets, i.e., two, to target EGFR and TNC at the same time in the same plasmid (Figures 1 and 2D-E). Regarding claim(s) 6-9, 048 teaches “In a preferred embodiment, the targeting peptide element of the present invention is RVG-LAMP2B, that is, a fusion protein consisting of RVG and LAMP2B.”, (col 7, lines 39-41). Regarding claim 10, 048 teaches a vector comprising the siRNA of the present invention (figure 1, and col 7, lines 2-3). Regarding claim 11-12, 048 teaches an viral and non-viral vectors comprising siRNA sequences of the invention, more specifically, retro-, lenti-, and adenovirus, and a plasmid (col 3, lines 36-41). Regarding claim 13, 048 teaches a pharmaceutical composition comprising a vector of the invention (col 3, liens 61-67). Regarding claim 14, 048 teaches using the invention for treatment of cancer (col 3, lines 43-47 and 52-56). 048 does not teach a 5’ and/or 3’ flanking sequence, a stem loop, and a compensation sequence. 213 teaches, “siRNAs can be obtained by processing the precursor siRNAs, and the said precursor siRNAs can be folded into a stable stem-loop (hairpin) structure having a general length of 50-100 bp. The said precursor siRNAs can be folded into a stable stem-loop structure, and two sides of the stem of the stem-loop structure contain two sequences substantially complementary to each other. In the present invention, the said precursor siRNAs are artificially synthesised precursor siRNAs, and the said precursor siRNAs have the structure as shown in formula I: PNG media_image10.png 60 94 media_image10.png Greyscale As a representative example, B1 is K-RAS siRNA sense strand sequence; B2 is a sequence with complementarity (including substantial and complete complementarity) to B1; C is a sequence as shown (GUUUUGGCCACUGACUGAC); A1 and A2 are null or optionally nucleotide sequences consisting of 4-5 bases respectively; wherein the precursor siRNA as shown can be processed in the host to form the K-RAS siRNA.”, (see col 7, lines 58-67 to col 8, lines 1-17). Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the siRNA of 048 to be a precursor siRNA as taught by 213 to yield the predictable results of obtaining stable hairpin structures that contain the siRNA of interest with 5’ and 3’ flanking regions, a stem loop, and a compensation sequence. Accordingly claim(s) 1-14 are unpatentable over 048 in view of 213. This rejection under 35 U.S.C. 103 might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C.102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B); or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. See generally MPEP § 717.02. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claim(s) 1-2, 4-5, 10, and 13-14 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim 3-4, 7, and 11 of U.S. Patent No. 11,304,970 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because of the following: Claim 3 of the ‘970 patent recites, “A polynucleotide wherein the polynucleotide can be transcribed by a host to form the precursor sequence of claim 1”, wherein claim 1 recites, “A precursor sequence, wherein the sequence has a structure from the 5′ terminus to the 3′ terminus as shown in formula I; wherein B1 is a first ribonucleic acid sequence comprising an EGFR siRNA sense strand sequence; B2 is a sequence substantially or completely complementary to B1, and B2 is not complementary to C, wherein substantially complementary means there are 2-8 non-complementary bases between B2 and B1; C is a stem-loop structure sequence; and A1 is UGCUG and/or A2 is CAGG or CAGGA, wherein, the nucleotide sequence of the EGFR siRNA sense strand is selected from the group consisting of: SEQ ID NO: 197, SEQ ID NO: 17, SEQ ID NO: 20, SEQ ID NO: 35, SEQ ID NO: 42, SEQ ID NO: 47, SEQ ID NO: 52, SEQ ID NO: 59, SEQ ID NO: 63, SEQ ID NO: 68 and SEQ ID NO: 72; and the precursor sequence as shown can be processed in a host to form the EGFR siRNA.” (see formula I below). Claim 3 of ‘970 anticipates instant claim(s) 1-2 and 4-5. Claim 4 of the ‘970 patent recites, “An expression vector containing the precursor sequence of claim 1 or a polynucleotide which can be transcribed by a host to form said precursor sequence.” Claim 4 of ‘970 anticipates instant claim 10. Claim 7 of the ‘970 patent recites, “A pharmaceutical composition, comprising the precursor sequence of claim 1 or an expression vector comprising said precursor sequence or a polynucleotide which can be transcribed by a host to form said precursor sequence, and a pharmaceutically acceptable carrier.” Claim 7 of ‘970 anticipates instant claim 13. Claim 11 of the ‘970 patent recites, “A method for inhibiting EGFR or for treating a malignant tumour highly expressing EGFR, wherein the malignant tumour is selected from the group consisting of liver cancer, lung cancer, stomach cancer, oesophageal cancer, ovarian cancer, colorectal cancer, cervical cancer, pancreatic cancer, prostatic cancer, leukaemia, breast cancer, kidney cancer, bladder cancer, oral epithelial cancer, head and neck cancer, brain tumour and glioblastoma, comprising administering to a subject in need thereof, an effective amount of the precursor sequence of claim 1, or an expression vector comprising said precursor sequence or a polynucleotide which can be transcribed by a host to form said precursor sequence.” Claim 11 of ‘970 anticipates instant claim 14. Claim(s) 1, 10, and 12-14 rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1 of U.S. Patent No. 10,308,932 B2 as evidenced by Starega-Roslan et al (The role of the precursor structure in the biogenesis of microRNA, Cell. Mol. Life Sci. Vol 68, pages 2859-2871, published May 24th, 2011). Claim 1 of the ‘932 patent recites, “A method for treating a disease in the colorectum of a mammal subject, comprising: intravenously administering to the mammal subject a composition comprising a recombinant expression vector that expresses functional microRNA in the mammal subject, wherein said functional microRNA is miR-143; said recombinant expression vector is adenovirus vector, and; the disease is colorectal cancer.” Claim 1 of the ‘932 patent does explicitly teach that the microRNA has an RNA fragment sequence targeting a gene, and one or more of a flanking sequence (5' flanking sequence), a stem-loop sequence, a compensation sequence of the RNA fragment sequence (reading on the antisense and/or miRNA* strand) and a 3' flanking sequence. Starega-Roslan et al teaches microRNA structure wherein the nucleotide sequence comprises an RNA fragment sequence targeting the gene, and one or more of a flanking sequence (5' flanking sequence), a stem-loop sequence, a compensation sequence of the RNA fragment sequence (reading on the antisense and/or miRNA* strand) and a 3' flanking sequence (see figure 1 below). PNG media_image1.png 337 468 media_image1.png Greyscale Accordingly, claim 1 of the ‘932 patent anticipates instant claim(s) 1, 10, and 12-14. Claim(s) 1 and 13-14 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim 7 of U.S. Patent No. 10,227,603 B2 as evidenced by Starega-Roslan et al (The role of the precursor structure in the biogenesis of microRNA, Cell. Mol. Life Sci. Vol 68, pages 2859-2871, published May 24th, 2011). Claim 7 of ‘603 recites, “A method for ameliorating or treating a microRNA target gene-related disease, comprising administering a composition including a carrier, wherein said carrier includes at least one product selected from the group consisting of: (a) a plant or an edible part thereof, said plant or edible part thereof expressing and carrying said exogenous functional microRNA, and (b) an extract of said plant or edible part thereof, said extract containing said exogenous functional microRNA, wherein said exogenous functional microRNA consists of SEQ ID NO:14, said plant is leaf lettuce, said exogenous functional microRNA regulates expression of a microRNA targeted gene, and said carrier carrying said exogenous functional microRNA ameliorates or treats a microRNA targeted gene-related disease in an animal, and said gene-related disease is a viral infectious disease or cancer.” Claim 7 of the ‘603 patent does explicitly teach that the microRNA has an RNA fragment sequence targeting a gene, and one or more of a flanking sequence (5' flanking sequence), a stem-loop sequence, a compensation sequence of the RNA fragment sequence (reading on the antisense and/or miRNA* strand) and a 3' flanking sequence. Starega-Roslan et al teaches microRNA structure wherein the nucleotide sequence comprises an RNA fragment sequence targeting the gene, and one or more of a flanking sequence (5' flanking sequence), a stem-loop sequence, a compensation sequence of the RNA fragment sequence (reading on the antisense and/or miRNA* strand) and a 3' flanking sequence (see figure 1 above in ‘932 DP rejection). Accordingly claim 7 of ’603 anticipates instant claim(s) 1 and 13-14. Claim(s) 1 and 13-14 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1 of U.S. Patent No. 10,519,441 B2 as evidenced by Starega-Roslan et al (The role of the precursor structure in the biogenesis of microRNA, Cell. Mol. Life Sci. Vol 68, pages 2859-2871, published May 24th, 2011). Claim 1 of the ‘441 patent recites, “A method for treating sarcoma or lung cancer by administering a safe and effective dose of microvesicles to a subject in need thereof so as to treat the sarcoma or lung cancer by inhibiting Treg cells, wherein said microvesicles contain a miRNA-214 inhibitor which is an anti-sense nucleotide sequence of miRNA-214 or a precursor thereof.” Claim 1 of the ‘441 patent does explicitly teach that the microRNA has an RNA fragment sequence targeting a gene, and one or more of a flanking sequence (5' flanking sequence), a stem-loop sequence, a compensation sequence of the RNA fragment sequence (reading on the antisense and/or miRNA* strand) and a 3' flanking sequence. Starega-Roslan et al teaches microRNA structure wherein the nucleotide sequence comprises an RNA fragment sequence targeting the gene, and one or more of a flanking sequence (5' flanking sequence), a stem-loop sequence, a compensation sequence of the RNA fragment sequence (reading on the antisense and/or miRNA* strand) and a 3' flanking sequence (see figure 1 above in ‘932 DP rejection). Claim 1 of ‘441 anticipates instant claim(s) 1 and 13-14. Claim(s) 1-2, 4-5, 10, and 13 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim(s) 1 and 3 of U.S. Patent No. 10,273,481 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because of the following: Claim 1 of the ‘481 patent recites, “A recombinant nucleic acid molecule for inhibiting Bruton's agammaglobulinemia tyrosine kinase (BTK), wherein the recombinant nucleic acid molecule comprises Formula V: A-(B-L)p-Z, wherein A is an optional sequence of 0-50 nucleotides (nts) at 5′ end, B is either of (1) a BTK-targeted siRNA sequence selected from SEQ ID NO: 1, SEQ ID NO:2, and SEQ ID NO:3, or (2) a precursor RNA molecule of Formula II Seqforward-X-Seqbackward, wherein Seqforward or Seqbackward comprises SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, Seqforward and Seqbackward are capable of hybridizing to each other, and X is a loop sequence not complementary to Seqforward or Seqbackward; L is an optional interval sequence of 0-50 nts; p is a positive integer of 2, 3, 4, or 5; Z is an optional sequence of 0-50 nts at 3′ end.” Claim 1 of ‘481 anticipates instant claim(s) 1-2 and 4-5. Claim 3 of ‘481 recites, “A pharmaceutical composition comprising a pharmaceutically acceptable carrier and an effective amount of one or more active agents selected from the group consisting of: (a) the recombinant nucleic acid molecule of claim 1, (b) a polynucleotide that encodes the nucleic acid molecule of claim 1, and (c) an expression vector comprising the polynucleotide of (b).” Claim 3 of ‘481 anticipates instant claim(s) 10 and 13. Claim(s) 1-2, 4-5, 10, and 13-14 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim(s) 2 and 9 of U.S. Patent No. 10,533,173 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because of the following: PNG media_image10.png 60 94 media_image10.png Greyscale Claim 2 of the ‘173 patent recites, “The pharmaceutical preparation of “A pharmaceutical preparation, wherein the preparation comprises: (a) an expression vector for expressing anti-miRNAs and/or siRNAs; and (b) a pharmaceutically acceptable carrier; wherein the expression vector comprise precursor sequence having a structure from the 5′ terminus to the 3′ terminus as shown in formula I: wherein B1 is a first ribonucleic acid sequence, and comprises an anti-miRNA sequence form or an siRNA sequence form; B2 is a second ribonucleic acid sequence substantially or completely complementary to B1, and B2 is not complementary to C; wherein substantially complementary is that there are 2-8 non-complementary bases between B2 and B1; C is a stem-loop structure sequence; and A1 and A2 are null or are optionally RNA sequences consisting of 4-5 bases respectively; wherein the precursor can express the first ribonucleic acid sequence in a host, but cannot express the second ribonucleic acid sequence complementary to the first ribonucleic acid sequence” wherein the anti-miRNA and/or siRNA is a RNA selected from the group consisting of anti-miRNA-214, K-RAS siRNA, EGFR siRNA, PDL1 siRNA, PDCD1 siRNA, ALK siRNA and IDO1 siRNA; the K-RAS siRNA has a sequence selected from the group consisting of SEQ ID NO: 12,. . .” Claim 2 of ‘173 anticipates instant claim(s) 1-2, 4-5, 10, and 13. PNG media_image10.png 60 94 media_image10.png Greyscale Claim 9 of ‘173 recites, “A method for inhibiting miRNA-214; and/or treating a malignant tumor highly expressing miRNA-214; comprising administering to a subject in need thereof an effective amount of the pharmaceutical preparation of “The pharmaceutical preparation sequence of claim 1 (see above), wherein the sequence has a structure from the 5′ terminus to the 3′ terminus as shown in formula I: wherein B1 is anti-miRNA-214-5p; B2 is a sequence substantially or completely complementary to B1, and B2 is not complementary to C; C is a stem-loop structure sequence, and A1 and A2 are null or are optionally RNA sequences consisting of 4-5 bases respectively; wherein the sequence of B1 as shown can be processed in the host to form anti-miRNA-214, and only the anti-miRNA-214-5p, rather than the anti-miRNA-214-3p, in the anti-miRNA-214 is expressed, wherein the precursor cannot express the ribonucleic acid of B2.” Claim 9 of ‘173 anticipates instant claim 14. Claim(s) 1-5, and 10-14 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim(s) 4, 5, 8, and 12 of U.S. Patent No. 10,982,213 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because of the following: Claim 4 of ‘213 recites, “A polynucleotide, which can be transcribed by a host to form the precursor sequence of “A precursor sequence having a structure from the 5′ terminus to the 3′ terminus as shown in formula I: PNG media_image10.png 60 94 media_image10.png Greyscale wherein, B1 is a first ribonucleic acid sequence comprising a K-RAS siRNA sense strand sequence; B2 is a sequence substantially or completely complementary to B1, and B2 is not complementary to C; wherein substantially complementary means there are 2-8 non-complementary bases between B2 and B1; C is a stem-loop structure sequence; and A1 is UGCUG; and/or A2 is CAGG or CAGGA; wherein the nucleotide sequence of the K-RAS siRNA sense strand is selected from the following sequences as shown in the sequence listing: SEQ ID NO: 263; and the precursor sequence can be processed in a host to form the K-RAS siRNA (claim 1).”.” Claim 4 of ‘213 anticipates instant claim(s) 1-5. Claim 5 of ‘213 recites, “An expression vector, comprising the precursor sequence of claim 1 (above) or a polynucleotide that can be transcribed by a host to form said precursor sequence.” Claim 5 of ‘213 anticipates instant claim(s) 10-12. Claim 8 of ‘213 recites, “A pharmaceutical composition, comprising the precursor sequence of claim 1 or an expression vector, which comprises said precursor sequence or a polynucleotide that can be transcribed by a host to form said precursor sequence, and a pharmaceutically acceptable carrier.” Claim 8 of ‘213 anticipates instant claim 13. Claim 12 of ‘213 recites, “A method for inhibiting K-RAS or for treating a malignant tumour highly expressing K-RAS; wherein the malignant tumour is selected from the group consisting of kidney cancer, oral epithelial cancer, head and neck cancer, bladder cancer, brain tumour, glioblastoma, liver cancer, lung cancer, stomach cancer, oesophageal cancer, ovarian cancer, colorectal cancer, cervical cancer, pancreatic cancer, prostatic cancer, leukaemia and breast cancer, comprising administering to a subject in need thereof an effective amount of the precursor sequence of claim 1, or an expression vector, comprising said precursor sequence or a polynucleotide that can be transcribed by a host to form said precursor sequence, or an siRNA capable of inhibiting expression of a K-RAS gene, wherein the nucleotide sequence of the sense strand of the siRNA is SEQ ID NO: 263, and to which directly or indirectly a sequence A1 and/or A2 is attached, wherein A1 is UGCUG and A2 is CAGG or CAGGA.” Claim 12 of ‘213 anticipates instant claim 14. Claim(s) 1-11 and 13 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim 2, 7, and 13 of U.S. Patent No. 12,553,048 B2 in view of ‘213 (US 10,982,213 B2, published April 20, 2021, Effective filing date of May 5th, 2016). Claim 2 of ‘048 recites, “The siRNA composition of “A siRNA composition, comprising: a first siRNA molecule that reduces the expression of a first target gene; an optional coding sequence for a targeting peptide element; and a second siRNA molecule that reduces the expression of a second target gene, wherein the first siRNA molecule has a sequence as shown in SEQ ID NO: 1 and/or SEQ ID NO: 2, and the first target gene is selected from the group consisting of EGFR, KRAS, or a combination thereof; and wherein the second siRNA molecule has a sequence as shown in SEQ ID NO: 3, and the second target gene is TNC”, wherein the siRNA composition comprises the coding sequence for the targeting peptide element, and the targeting peptide element is selected from the group consisting of RVG, LAMP2B, or a combination thereof.” Claim 7 of ‘048 recites, “The vector of “A vector, comprising: a promoter element; a first siRNA molecule that reduces the expression of a first target gene; an optional coding sequence for a targeting peptide element; and a second siRNA molecule that reduces the expression of a second target gene, wherein the first siRNA molecule has a sequence as shown in SEQ ID NO: 1 and/or SEQ ID NO: 2, and the first target gene is selected from the group consisting of EGFR, KRAS, or a combination thereof; and wherein the second siRNA molecule has a sequence as shown in SEQ ID NO: 3, and the second target gene is TNC”, wherein the vector comprises the coding sequence for the targeting peptide element, and the targeting peptide element is selected from the group consisting of RVG, LAMP2B, or a combination thereof.” Claim 13 of ‘048 recites, “The pharmaceutical preparation of “A pharmaceutical preparation, comprising: (a) a vector; and (b) a pharmaceutically acceptable carrier, wherein the vector comprises: a promoter element; a first siRNA molecule that reduces the expression of a first target gene; an optional coding sequence for a targeting peptide element; and a second siRNA molecule that reduces the expression of a second target gene, wherein the first siRNA molecule has a sequence as shown in SEQ ID NO: 1 and/or SEQ ID NO: 2, and the first target gene is selected from the group consisting of EGFR, KRAS, or a combination thereof; and wherein the second siRNA molecule has a sequence as shown in SEQ ID NO: 3, and the second target gene is TNC”, wherein the vector comprises the coding sequence for the targeting peptide element, and the targeting peptide element is selected from the group consisting of RVG, LAMP2B, or a combination thereof.” Claim 2, 7, and 13 of ‘048 does not explicitly teach a precursor nucleotide with a 5’ or 3’ flanking region, a stem loop, or a compensation sequence. PNG media_image10.png 60 94 media_image10.png Greyscale ‘213 teaches, “siRNAs can be obtained by processing the precursor siRNAs, and the said precursor siRNAs can be folded into a stable stem-loop (hairpin) structure having a general length of 50-100 bp. The said precursor siRNAs can be folded into a stable stem-loop structure, and two sides of the stem of the stem-loop structure contain two sequences substantially complementary to each other. In the present invention, the said precursor siRNAs are artificially synthesised precursor siRNAs, and the said precursor siRNAs have the structure as shown in formula I: As a representative example, B1 is K-RAS siRNA sense strand sequence; B2 is a sequence with complementarity (including substantial and complete complementarity) to B1; C is a sequence as shown (GUUUUGGCCACUGACUGAC); A1 and A2 are null or optionally nucleotide sequences consisting of 4-5 bases respectively; wherein the precursor siRNA as shown can be processed in the host to form the K-RAS siRNA.”, (see col 7, lines 58-67 to col 8, lines 1-17). Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify claim 2 of ‘048 to be a precursor siRNA as taught by ‘213 to yield the predictable results of obtaining stable hairpin structures that contain the siRNA of interest with 5’ and 3’ flanking regions, a stem loop, and a compensation sequence. Instant claim(s) 1-11 and 13, are unpatentable over claim 2 of ‘048 in view of ‘213. Claim(s) 1, 3, 6, 7, 10, and 12 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 7 of copending Application No. 18/374,253 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because of the following: Claim 7 of ‘253 recites, “The viral vector-based RNA delivery system according to claim “The viral vector-based RNA delivery system according to “The viral vector-based RNA delivery system according to “A viral vector-based RNA delivery system, comprising a viral vector carrying an RNA fragment to be delivered, wherein the viral vector is capable of enriching and endogenously spontaneously forming a complex comprising the RNA fragment in a host organ or tissue, and the complex is capable of entering and binding to a target tissue, and delivering the RNA fragment into the target tissue”, wherein the viral vector comprises a promoter and a targeting tag, wherein the targeting tag is capable of forming a targeting structure of the complex in the host organ or tissue, the targeting tag is located on the surface of the complex, and the complex seeks for and binds to the target tissue through the targeting structure, and delivers the RNA fragment into the target tissue”, wherein the viral vector comprises a circuit selected from the group consisting of promoter-RNA fragment, promoter-targeting tag, and promoter-RNA fragment-targeting tag, or a combination thereof; and the viral vector comprises at least an RNA fragment and a targeting tag, wherein the RNA fragment and the targeting tag are located in the same circuit or in different circuits”, wherein the viral vector further comprises a flanking sequence, a compensation sequence and a loop sequence that facilitate the correct folding and expression of the circuit, and the flanking sequence comprises 5' flanking sequence and 3' flanking sequence; and the viral vector comprises a circuit selected from the group consisting of 5' promoter-5' flanking sequence-RNA fragment-loop sequence-compensation sequence-3' flanking sequence, 5'-promoter-targeting tag, and 5' promoter-targeting tag-5' flanking sequence-RNA fragment-loop sequence-compensation sequence-3' flanking sequence, or a combination thereof.” Claim 14 of ‘253 anticipates instant claim(s) 1, 3, 6, 7, 10, and 12. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claim(s) 1, 3, 6, 7, and 10-11 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 5 of copending Application No. 18/374,242 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because of the following: Claim 5 of ‘242 recites, “The RNA plasmid delivery system as claimed in “The RNA plasmid delivery system as claimed in “The RNA plasmid delivery system as claimed in “An RNA plasmid delivery system, wherein the system comprises a plasmid carrying a RNA fragment required to be delivered, the plasmid can be enriched in an organ tissue of a host, and spontaneously forms a complex structure containing the RNA fragment in the organ tissue of the host, the complex structure can enter and be combined with a target tissue to deliver the RNA fragment into the target tissue”, wherein the plasmid further comprises a promoter and a targeting tag, the targeting tag can form a targeting structure of the complex structure in the organ tissue of the host, the targeting structure is located on the surface of the complex structure, and the complex structure can search for and be combined with the target tissue through the targeting structure to deliver the RNA fragment into the target tissue”, wherein the plasmid comprises any one or a combination of the following circuits: promoter-RNA fragment, promoter-targeting tag, promoter-RNA fragment-targeting tag; wherein each of the plasmid comprises at least one RNA fragment and one targeting tag, the RNA fragment and targeting tag are located in the same circuit or in different circuits”, wherein the plasmid further comprises a flanking sequence, a compensation sequence, and a loop sequence that facilitate the correct folding and expression of the circuit, wherein the flanking sequence comprises a 5' flanking sequence and a 3' flanking sequence; and the plasmid comprises any one or a combination of the following circuits: 5' promoter-5' flanking sequence-RNA fragment-loop sequence-compensation sequence-3' flanking sequence, 5'- promoter-targeting tag, and 5' promoter-targeting tag-5' flanking sequence-RNA fragment-loop sequence-compensation sequence-3' flanking sequence.” Claim 5 of ‘242 anticipates instant claim(s) 1, 3, 6, 7, and 10-11. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claim(s) 1, 3, 6, 7, 10, and 12 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 7 of copending Application No. 18/477,107 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because of the following: Claim 7 of ‘107 recites, “The RNA delivery system for the treatment of Huntington's disease according to “The RNA delivery system for the treatment of Huntington's disease according to claim “The RNA delivery system for the treatment of Huntington's disease according to “An RNA delivery system for the treatment of Huntington's disease, wherein the system comprises a viral vector, the viral vector carries RNA fragments capable of treating Huntington's disease, the viral vector is capable of enrichment in organ tissues of a host and endogenously and spontaneously forming a complex containing the RNA fragments capable of treating Huntington's disease in the organ tissues of the host, and the complex is capable of delivering the RNA fragments into a target tissue to treat Huntington's disease”, wherein the viral vector comprises a promoter and a targeting tag, the targeting tag is capable of forming a targeting structure for the complex in the organ tissues of the host, the targeting structure is located on the surface of the complex, the complex is capable of finding and binding to target tissues through the targeting structure, to deliver the RNA fragments into the target tissues.”, wherein the viral vector comprises any one of the following circuits or the combination of several circuits: promoter-RNA fragment, promoter-targeting tag, promoter-RNA fragment-targeting tag; each viral vector comprises at least one RNA fragment and one targeting tag, and the RNA fragment and targeting tag are located in the same circuit or different circuits.”, wherein the viral vector further comprises a flanking sequence, a compensation sequence and a loop sequence that facilitate the folding into a correct structure and the expression of the circuit, the flanking sequences comprises 5' flanking sequences and 3' flanking sequences; the viral vector comprises any one of the following circuits or the combination of several circuits: 5'-promoter-5' flanking sequence-RNA fragment-loop sequence-compensation sequence-3' flanking sequence, 5'-promoter-targeting tag, 5'-promoter-targeting tag-5' flanking sequence-RNA fragment-loop sequence-compensation sequence-3' flanking sequence.” Claim 7 of ‘107 anticipates instant claim(s) 1, 3, 6, 7, 10 and 12. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claim(s) 1-4, 6, and 10 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 4 of copending Application No. 18/374,236 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because of the following: Claim 4 of ‘236 recites, “The gene circuit according to “The gene circuit according to “The gene circuit according to “A gene circuit, comprising at least one RNA fragment capable of inhibiting gene expression and/or at least one targeting tag with targeting function, wherein the gene circuit is a sequence capable of enriching and self-assembling in a host organ or tissue to form a complex, and the gene circuit treats a disease by inhibiting gene expression with the RNA fragment.”, wherein the RNA fragment comprises one, two or more RNA sequences that have medical significance and are capable of being expressed, and the RNA sequence is an siRNA sequence, shRNA sequence or miRNA sequence”, wherein the gene circuit further comprises a promoter, and the gene circuit has types of promoter-RNA fragment, promoter-targeting tag, and promoter- targeting tag-RNA fragment; and the gene circuit comprises at least one RNA fragment capable of inhibiting gene expression and at least one targeting tag with targeting function, wherein the RNA fragment and the targeting tag are located in the same gene circuit or in different gene circuits.”, wherein the gene circuit further comprises a flanking sequence, a loop sequence and a compensation sequence that facilitate the correct folding and expression of the gene circuit, and the flanking sequence comprises 5' flanking sequence and 3' flanking sequence; andthe gene circuit has types of 5' promoter-5' flanking sequence-RNA fragment-loop sequence- compensation sequence-3' flanking sequence, 5'-promoter-targeting tag, and 5' promoter-targeting tag-5' flanking sequence-RNA fragment-loop sequence-compensation sequence-3' flanking sequence.” Claim 4 of ‘236 anticipates instant claim(s) 1-4, 6, and 10. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Conclusion The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. Schmittgen et al (WO 2015/002956 A1, published 01/08/2015) teaches claim(s) 1-2, 4, and 10-13 partially in Figure 1. PNG media_image11.png 582 666 media_image11.png Greyscale PNG media_image12.png 364 596 media_image12.png Greyscale No claims allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to LEXUS M TATGE whose telephone number is (571)272-0061. The examiner can normally be reached Monday-Friday: 8:30am to 5:30pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /L.M.T./Examiner, Art Unit 1637 /Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Sep 27, 2023
Application Filed
Jun 26, 2026
Non-Final Rejection mailed — §101, §102, §103 (current)

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
50%
Grant Probability
99%
With Interview (+100.0%)
3y 5m (~4m remaining)
Median Time to Grant
Low
PTA Risk
Based on 2 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month