Prosecution Insights
Last updated: October 04, 2026
Application No. 18/374,236

GENE CIRCUIT, RNA DELIVERY SYSTEM AND USE THEREOF

Non-Final OA §101§102§112§DP
Filed
Sep 28, 2023
Priority
Mar 29, 2021 — CN 202110336983.6 +1 more
Examiner
TATGE, LEXUS MARC
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Nanjing University
OA Round
1 (Non-Final)
50%
Grant Probability
Moderate
1-2
OA Rounds
4m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 50% of resolved cases
50%
Career Allowance Rate
1 granted / 2 resolved
-10.0% vs TC avg
Strong +100% interview lift
Without
With
+100.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 5m
Avg Prosecution
55 currently pending
Career history
37
Total Applications
across all art units

Statute-Specific Performance

§101
8.8%
-31.2% vs TC avg
§103
26.7%
-13.3% vs TC avg
§102
16.6%
-23.4% vs TC avg
§112
25.4%
-14.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 2 resolved cases

Office Action

§101 §102 §112 §DP
DETAILED ACTION The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claim(s) 1-21 are pending. Preliminary Amendments Applicant’s preliminary amendment filed on 01/16/2024 for replacing the drawings, adding a sequence listing incorporation by reference statement, and substitute specification is acknowledged. Applicant’s preliminary amendment filed on 05/28/2026 for adding sequence identifiers throughout the specification is acknowledged. Priority Acknowledgment is made of applicant's claim for foreign priority based on an application filed in CN202110336983.6 on 03/29/2021. It is noted, however, that applicant has not filed a certified copy of the three applications as required by 37 CFR 1.55. All claims are given the priority date of PCT/CN2022/083591 filed on 03/29/2022. Drawings The drawings are objected to because the following: Cannot differentiate the conditions within the graph: Fig 7A; 9B; 11B; 13B; 14C; 15A; 16A; 16C; 22A; 24C; 26B; 37C; 37E; 39A; 39B; 41B; 41H-I; 41L-M; 42E (lipid synthesis graph); 43A; 43C; 59A-D; both graphs in 61; Missing three condition titles in graph in Figure 53E. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Nucleotide and/or Amino Acid Sequence Disclosures Summary of Requirements for Patent Applications Filed On Or After July 1, 2022, That Have Sequence Disclosures 37 CFR 1.831(a) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.831(b) must contain a “Sequence Listing XML”, as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.831-1.835. This “Sequence Listing XML” part of the disclosure may be submitted: 1. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter “Legal Framework”) in XML format, together with an incorporation by reference statement of the material in the XML file in a separate paragraph of the specification (an incorporation by reference paragraph) as required by 37 CFR 1.835(a)(2) or 1.835(b)(2) identifying: a. the name of the XML file b. the date of creation; and c. the size of the XML file in bytes; or 2. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation by reference statement of the material in the XML format according to 37 CFR 1.52(e)(8) and 37 CFR 1.835(a)(2) or 1.835(b)(2) in a separate paragraph of the specification identifying: a. the name of the XML file; b. the date of creation; and c. the size of the XML file in bytes. SPECIFIC DEFICIENCIES AND THE REQUIRED RESPONSE TO THIS NOTICE ARE AS FOLLOWS: Specific deficiency #1 – sequences enumerated in claim(s) 5 and 16 do not have SEQ ID NOs associated with them. Specific deficiency #2 - This application contains sequence disclosures in accordance with the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.821(a)(1) and (a)(2). However, this application fails to comply with the requirements of 37 CFR 1.821 - 1.825. The sequence disclosures are located on page 29 in [0191]: RVG targeting peptide as SEQ ID NO: 1; GE11 peptide as SEQ ID NO: 2; PTP targeting peptide as SEQ ID NO: 3; TCP-1 targeting peptide as SEQ ID NO: 4; MSP targeting peptide as SEQ ID NO: 5; and The respective LAMP2B fusion proteins as SEQ ID NOs: 6-10. Wherein, SEQ ID NOs: 1-10 in the sequence listing correspond to the 5’ flanking, the loop, the 3’ flanking, and siRNA for EGRF and KRAS. Required response – Applicant must provide: A "Sequence Listing" part of the disclosure, as described above in item 1); as well as An amendment specifically directing entry of the "Sequence Listing" part of the disclosure into the application in accordance with 1.825(b)(2); A statement that the "Sequence Listing" includes no new matter in accordance with 1.825(b)(5); and A statement that indicates support for the amendment in the application, as filed, as required by 37 CFR 1.825(b)(4). If the "Sequence Listing" part of the disclosure is submitted according to item 1) a) or b) above, Applicant must also provide: A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter; If the "Sequence Listing" part of the disclosure is submitted according to item 1) b), c), or d) above, Applicant must also provide: A replacement CRF in accordance with 1.825(b)(6); and Statement according to item 2) a) or b) above. Specification The disclosure is objected to because of the following informalities: SEQ ID NOs: 1-10 on page 29 [0191], are listed in the sequence listing as 5’ and 3’ flanking sequences, the loop sequence, and siRNAs, not peptides or fusion proteins. The specification does not enumerate the sequences of, RVG, GE11, PTP, TCP-1, MSP, and the LAMP2B fusion proteins. Thus, the specification should not refer to these peptides or fusion proteins without proper sequence identifiers, or if shorter than 10 nucleotides or 4 amino acids, the enumeration of said sequence(s). [0338] contains reference to colors in drawings, e.g., red part and blue part. Appropriate correction is required. Claim Objections Claim 1 is objected to because of the following informalities: “A gene circuit, comprising at least one RNA fragment . . . and/or at least one targeting tag with targeting function. . .” reads as a gene (DNA) containing RNA. However, the specification, at multiple locations, provides guidance that claim 1 is DNA encoding RNA or a guiding tag (Figure 53A). Thus, it would be remedial to amend the claim to recites, “A gene circuit comprising at least one nucleotide sequence encoding an RNA fragment . . . and/or at least one nucleotide sequence encoding a targeting tag with targeting function. . .”. Claim(s) 5 and 16 are objected to because of the following informalities: the sequences with more than 10 enumerated nucleotides should recite their associated SEQ ID NOs. In claim 5, the first sequence corresponds to SEQ ID NO: 1, the second sequence corresponds to SEQ ID NO: 2, and the third sequence corresponds to SEQ ID NO: 3. In claim 16, the sequence corresponds to SEQ ID NO: 96. Claim(s) 3 and 4 are objected to because of the following informalities: “has types”. Claim 3 should recite “wherein, the gene circuit comprises a promoter-RNA fragment, a promoter-targeting tag, or a promoter-targeting tag-RNA fragment;” for claim consistency. Claim 4 should recite, “wherein the gene circuit comprises a 5’ promoter-5’ flanking sequence-RNA fragment-loop sequence-compensation sequence- 3’flanking sequence, a 5’-promoter-targeting tag, or a 5’ promoter-targeting tag-5’ flanking sequence- RNA fragment-loop sequence-compensation sequence-3’ flanking sequence. Appropriate correction is required. Claim Interpretation Wherein “compensation sequence” is defined in the specification at [0026] to be “[T]he reverse complementary sequence of the RNA fragment sequence.” Thus, the “compensation sequence” is being interpreted as an “antisense sequence”. Claims 19-21 will be interpreted as being dependent upon claim 12, “Application of the RNA delivery system according to claim 12 . .”. Claim 20 limits claim 19 with an active step. Thus, claim 20 will be interpreted as a methods claim, and claim 19 and 21 will be included with rejections involved in said interpretation as a methods claim. Claim 21 is being interpreted as being dependent upon claim 20. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claim(s) 19 and 21 are rejected under 35 U.S.C. 101 because the claimed invention is directed to non-statutory subject matter. The claim(s) does/do not fall within at least one of the four categories of patent eligible subject matter because claim 19 does not purport a process, machine, manufacture, or composition through the recitation of “Application of the RNA delivery system according to claim 1 in the manufacture of a medicament for treating a disease.” Claim 20, which is dependent upon claim 19 further adds a step on administration, thus rendering claim 20 a process (e.g., a method of treating a disease). Claim 21 is rejected for being dependent upon claim 19 because it only limits the disease without further adding an action. Claim Rejections - 35 USC § 112(b) – indefiniteness The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 10, 13 and 19-21 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claim 10, the phrase “preferably, the ribose modification is 2’ fluoropyrimidine modification” renders the claim indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. See MPEP § 2173.05(d). Claim 13 is indefinite because it recites an action or process step (e.g., “seeks for and binds to” and “delivers the RNA…”) in a product claim without clearly reciting the physical structure or structural limitations configured to perform this action. It is unclear whether the claim is directed to a product, or a method of using the product, rendering the metes and bounds of the claimed invention indefinite. It would be remedial to amend this claim to recites “. . . wherein the targeting tag is located on the surface of the complex and the complex is capable of seeking for and binding to a target organ or tissue through the targeting tag, and capable of delivering the RNA fragment into the target organ or tissue.” Claim 19 recites the limitation "the RNA delivery system according to claim 1" in line 1. There is insufficient antecedent basis for this limitation in the claim because claim 1 recites “a gene circuit”. Accordingly, claims 20-21 are rejected for being dependent upon claim 19. It would be remedial to amend claim 19 to be dependent upon claim 12. Claim 19’s recitation of an “Application of the RNA delivery system according to claim 1 in the manufacture of a medicament for treating a disease.”, is indefinite because it merely recites a use without any active, positive steps delimiting how this use is actually practiced. Accordingly, claim 21 is rejected for being dependent upon claim 19. It would be remedial to amend claim 19 to recite any one of scoped claims in the 112(a) enablement rejection below. Claim Rejections - 35 USC § 112(a) – Scope of Enablement The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claim(s) 19-21 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for A method of treating (a) oncogene-driven cancers, (b) obesity, (c) cardiovascular disease caused by obesity, (d) type 2 diabetes, (e) Huntington’s disease, or (f) Parkinson’s disease, the method comprising administering an effective amount of the RNA delivery system of claim 12; does not reasonably provide enablement for the treatment of any/all diseases with at least one RNA fragment capable of inhibiting gene expression and/or at least one targeting tag with targeting function. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims. Enablement is considered in view of the Wands factors (MPEP 2164.01(A)). These include: the breadth of the claims, the nature of the invention, the state of the prior art, the level of one of ordinary skill, the level of predictability in the art, the amount of direction provided by the inventor, the existence of working examples, and the quantity of experimentation needed to make or use the invention. All of the Wands factors have been considered with regard to the instant claims, with the most relevant factors discussed below. Claim interpretation: claim 19 is interpreted as being dependent upon claim 12. Claim 20 is interpreted as a methods claim for containing a “step” of administration. Claims 19 and 21 are included as being a part of claim 20’s process. Claim 21 is being interpreted as being dependent upon claim 20. Nature of the invention: Claim 19 is drawn to an application of the RNA delivery system according to claim 12 in the manufacture of a medicament for treating a disease. The nature of the invention is complex in that the gene circuit in the RNA delivery system must be capable of treating any/all diseases however, there is no action of administration or step in the process. Claim 20 is drawn to the application according to claim 19, wherein the medicament is administered by oral administration, inhalation, subcutaneous injection, intramuscular injection, or intravenous injection. The nature of the invention is complex in that the gene circuit in the RNA delivery system must be capable of treating any/all disease via the administration of the above listed routes. Claim 21 is drawn to the application according to claim 20, wherein the disease is a cancer, pulmonary fibrosis, colitis, obesity, cardiovascular disease caused by obesity, type 2 diabetes, Huntington's disease, Parkinson's disease, myasthenia gravis, Alzheimer's disease, or graft-versus-host disease. The nature of the invention is complex in that the gene circuit in the RNA delivery system must be capable of treating all the diseases listed. Breadth of the claims: The broadest reasonable interpretation of claim 20 is that it encompasses a method of treating any/all diseases comprising administering any/all delivery vectors comprising the any/all combinations of the gene circuit by oral administration, inhalation, subcutaneous injection, intramuscular injection, or intravenous injection that must be capable of inhibiting gene expression. The complex nature of the subject matter of this invention is greatly exacerbated by the breadth of the claims. Guidance of the specification and existence of working examples: Applicant provides examples for construction and use of a promoter-driven plasmid (e.g., CMV or ALB) and AAVs that contain one or more siRNAs (e.g., EGFR, KRAS, TNC, mTOR, VEGFR; TNFa; B7, integrin a; PTP1B; HTT; LRRK2) inserted into a specific microRNA backbone (see Figure 1-8). Applicant demonstrates in tissue culture and in injections (e.g., IV) into mice that this construct (i.e., promoter + siRNA inserted into a microRNA backbone) can utilize the cell’s own exosomal packaging machinery to broadly target tissues/organs or with the combination of a targeting peptide (e.g., Flag, RVG, PTP) with or without a membrane protein (i.e., LAMP2B) can be directed to specific tissues/organs of the body (see Fig 9-10; 53F). Applicant demonstrates (1) treatment of EGFR mutant lung cancer tumors (Figure 11A-F; 12A-D) with an EGFR siRNA inserted into the microRNA backbone promoted by a CMV in a non-viral vector and in an AAV (figure 16); (2) treatment of KRAS mutant lung cancer tumors (Figures 13-14) with a KRAS siRNA inserted into the microRNA backbone promoted by CMV in a non-viral vector or by AAV (Figures 15); (3) treatment of kidney cancer tumors using VEGFR and/or mTOR siRNA (Figure 18-19); (4) treatment of colitis or colon cancer with AAV-CMV-TNFa+B7+integrin siRNA (Figure 20-23); (5) treatment of glioma with CMV-FLAG-siR-EGFR + TNC (figure 36B), CMV-RVG- siR-EGFR + TNC (figure 36C-D; 37-38) and in AAV (Figure 39); (6) Treatment of obesity-related diseases with nonviral CMV-RVG-siRNA-PTP1B (Figure 41-42) and in an AAV (Figure 43-44); (7) Treatment of Huntington’s disease with nonviral CMV-RVG-siRNA-HTT (Figures 45B-H; 46-48) and in an AAV (Figure 49-50); (8) treatment of Parkinson’s disease with nonviral CMV-RVG-siRNA-LRRK2 (Figure 50). Applicant uses various promoters (ALB or CMV), uses bother siRNA and shRNA, and microRNAs separate or in combination with siRNA or shRNA. Applicant tested vectors in Macaca Fascicularis (Figures 51-52). Applicant does not provide working examples of a nucleic acid encoding a targeting protein treating a disease on its own. Predictability and state of the art: Matharu et al (Modulating gene regulation to treat genetic disorders, Nature Reviews Drug Discovery, volume 19, pages 757-775, published 10/05/2020) teaches that not all diseases require the inhibition of gene expression for treatment of said disease. Many diseases require the restoration of protein function, overexpression of missing/downregulated proteins, or post-translational regulation of proteins. More specifically, Matharu et al teaches, “According to the ClinVar database1, it is estimated that 516 genes lead to human disease in a recessive manner due to loss-of-function mutations in both copies, whereas an estimated 660 genes are known to cause disease when haploinsufficient2. In addition, the ClinVar1 and ClinGen3 databases indicate that mutations in 65 genes are known to be pathogenic due to gain of function.”, (page 757, col 1, para 1). “There are an estimated 660 genes that when haploinsufficient lead to human diseases, ranging from epilepsy to cancer, polycystic kidney disease, blindness and many others2. Analyses of large-scale sequencing studies24,25 estimate this number to be much higher, finding 3,230 loss-of-function intolerant genes, 88% of which are predicted to be due to severe haploinsufficiency. A CRT approach to upregulate the expression of the existing normal gene copy could be a potential treatment for these diseases. . . The feasibility of using a CRT approach to upregulate gene expression for an haploinsufficient disease was initially demonstrated by the rescue of haploinsufficiency-caused obesity in mice2. Heterozygous loss-of-function mutations (haploinsufficiency) in the genes single-minded family basic helix–loop–helix (bHLH) transcription factor 1 (SIM1) or melanocortin 4 receptor (MC4R) are a major cause of human obesity26.”, (page 759, col 1, para 1 to para 2; see Figure 2). “Aberrant levels of DNA methylation can lead to abnormal gene dosage and are associated with many neurological diseases69. For example, Fragile X syndrome (FXS; OMIM 300624) is caused by a CGG trinucleotide repeat expansion of over 200 copies in the 5′UTR of the FMRP translational regulator 1 (FMR1) gene promoter, which leads to hypermethylation of the FMR1 promoter, subsequently silencing gene expression70. Demethylation of the FMR1 promoter can reactivate gene function and rescue FXS-associated phenotypes71,72,73. Modulating the levels of DNA methylation could be possible using CRT tools that alter the disease-associated gene expression levels.”, (page 764, col 2, para 2 to page 765, col 1, para 1 and see figure 4). “Chromatin structure and organization can discretely modulate the activity of CREs that regulate gene expression. Several studies have implicated aberrant chromatin structure and histone modifications in organism development, cell differentiation and human disease12,79,80.”, (page 767, col 1 para 4 to page 768, col 2, para 1). Amount of experimentation necessary: The quantity needed to carry out the scope of the invention is large. (1) One would need to test whether inhibiting expression of genes related to loss-of-function mutations would result in the treatment of said diseases; (2) One would need to test whether inhibiting expression of genes related to DNA methylation or histone modifications result in treatment of diseases related to such genes; and lastly, (3) One would need to test whether a genus of targeting proteins is capable of treating a genus of diseases. This type of experimentation is not routine in the art and would require a large amount of inventive effort. Further considering that any positive results (e.g., successful treatment of any/all diseases by gene inhibition any/or administering a nucleic acid encoding a targeting protein) would amount to a significant advancement in the state of the art, additional experimentation required is considered undue. In view of the breadth of the claims and the lack of guidance provided by the specification as well as the unpredictability of the art, the skilled artisan would have required an undue amount of experimentation to make and/or use the claimed invention. Therefore, claim(s) 19-21 is not considered to be enabled by the instant disclosure for the treatment of all diseases but is scoped to the enablement of the embodiments above. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claim(s) 1-9, 11-14, and 17-21 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Fu et al (In vivo self-assembled small RNAs as a new generation of RNAi therapeutics, Cell Research, volume 31, pages 631-648, published 03/29/2021). Regarding claim(s) 1-4 Fu et al teaches, “As an example, two types of composable parts were incorporated to optimize the siRNA effects: one modifying the membrane-anchored proteins of exosomes to enable tissue selectivity; the other enabling the co-expression of a second siRNA for the simultaneous downregulation of two molecular targets (Fig. 1a).”, (page 632, col 1, para 2); see Fig. 1a and Fig. 1b below). Wherein Fig. 1a demonstrates two siRNAs. Wherein “guiding tag” reads on a targeting protein in Fig. 1a. PNG media_image1.png 542 450 media_image1.png Greyscale PNG media_image2.png 147 384 media_image2.png Greyscale Moreover, Fu et al teaches, “The CMV-siRE circuit was generated by inserting an EGFR siRNA sequence (5′-TGTGGCTTCTCTTAACTCCT-3′) into a 166-bp pre-miR-155 backbone. . . The fused tag-Lamp2b and two tandem pre-miR-155 backbones carrying the EGFR siRNA sequence (5′-TGTGGCTTCTCTTAACTCCT-3′) and the TNC siRNA sequence (5′-CACACAAGCCATCTACACATG-3′) were then cloned downstream of the CMV promoter, resulting in the generation of a circuit that simultaneously encodes EGFR and TNC siRNAs and the tag-Lamp2b fusion protein. . .”, (page 648, col 2, para 3). Regarding claim 5-7, Fu et al teaches “The CMV-siRE circuit was generated by inserting an EGFR siRNA sequence (5’-TGTGGCTTCTCTTAACTCCT-3’) into a 166-bp pre-miR-155 backbone (5’-GGATCCTGGAGGCTTGCTGAAGGCTGTATGC TGAATTCTGTGGCTTCTCTTAACTCCTGTTTTGGCCACTGACTGACAGG AGTTAAGAAGCCACAACCGGTCAGGACACAAGGCCTGTTACTAGCAC TCACATGGAACAAATGGCCCAGATCTGGCCGCACTCGAG-3’).”, (see page 642, col 2, para 3). Regarding claim(s) 8-9, Fu et al teaches, “For the design of composable guidance part, a sequence encoding a tissue-targeting tag fused to the N-terminus of Lamp2b (a canonical exosome membrane protein) was inserted downstream of the CMV promoter (Fig. 1a). This tag should be anchored to the exosome surface via Lamp2b, thus guiding the delivery of the exosomal cargo to the desired tissue. Specifically, a central nervous system-targeting RVG peptide was chosen as the tag to direct exosomes to the brain (RVG has been shown to facilitate transcytosis of exosomes across the blood-brain barrier and into neuronal cells).”, (see page 632, col 2, para 2). Regarding claim 11, Fu et al teaches liver and exosomes in figures 1a and 2a-e. Regarding claim 12-13 and 17, Fu et al teaches, “Genetic circuits were present in the form of DNA plasmids and were dissolved in PBS without additional formulations.”, (see page 648, col 2, para 4). Regarding claim 14, Fu et al teaches one or two gene circuits with at least one RNA fragment and a targeting tag in Figure 1a. Regarding claim 18, Fu et al teaches use of the RNA delivery system in mice (see figure 2 a-e). Regarding claim 19-21, Fu et al teaches, two different models of lung cancer, an EGFR-driven and a KRAS-driven lung cancer models (non-small cell lung cancer and lung adenocarcinoma). Fu et al teaches in Figures 3 and 4 the ability to diminish tumor size and promote survival with the gene circuit described in Fig. 1a (see image above). More specifically, Fu et al teaches, “Overall, these results indicate that intravenous injection of the core circuit effectively induced functional siRNA in vivo, and this approach may serve as a potential therapeutic regimen for lung cancer.”, (see page 638, col 1, para 1; also see figures 3 and 4). Further, Fu et al teaches inhibiting tumor growth and promoting survival in glioblastoma mouse models with the combination of EGFR and TNC siRNAs (see figure 5). Lastly, Fu et al teaches treating obesity and diabetes by restoring leptin and insulin sensitivity, decreasing adiposity, and increasing energy expenditure (see figure 6). More specifically, “Overall, these results suggest that the inhibition of central and peripheral PTP1B using genetic circuits may overcome leptin and insulin resistance and provide an attractive strategy to combat obesity.”, (see page 641, col 1, para 1). Accordingly, claim(s) 1-9, 11-14, and 17-21 are anticipated by Fu et al. Applicant cannot rely upon the certified copy of the foreign priority application to overcome this rejection because a translation of said application has not been made of record in accordance with 37 CFR 1.55. When an English language translation of a non-English language foreign application is required, the translation must be that of the certified copy (of the foreign application as filed) submitted together with a statement that the translation of the certified copy is accurate. See MPEP §§ 215 and 216. Claim(s) 1-4, 6-9, 11-14, and 17-21 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Zhang et al (CN 109971756A, published 07/05/2019; as evidenced by the machine translation has been submitted with this action - all paragraph citations refer to the machine translation; all figures placed in action are found in the original document). Regarding claim(s) 1-2, 4, and 6-7 Zhang et al teaches, “This invention provides a novel siRNA that inhibits EGFR gene expression, its precursor, and its application in tumor treatment. In a first aspect, the present invention provides a precursor sequence having a structure shown in Formula I at its 5' to 3' ends”, (see para [0010]-[0011]; and formula I below). PNG media_image5.png 60 128 media_image5.png Greyscale Moreover, Zhang et al teaches, “B1 is the required first ribonucleic acid sequence, wherein the first ribonucleic acid sequence includes the EGFR siRNA positive strand sequence, and the nucleotide sequence of the EGFR siRNA positive strand is shown in SEQ ID NO:1; B2 is a sequence that is either substantially complementary or completely complementary to B1, and B2 is not complementary to C; C represents the stem-loop structure sequence; A1 and A2 are either empty or optional RNA sequences consisting of bases; The precursor sequence can be processed in the host to form EGFR siRNA.”, (see paras [0013] to [0017]). Wherein SEQ ID NO: 1 is uguugcuucucuuaauuccu (see para [0210]). PNG media_image6.png 142 472 media_image6.png Greyscale Regarding claim 3 and 8-9, Zhang et al teaches in figure 2a (see below) promoter-targeting tag-RNA fragment with one and two RNA fragments. Regarding claim 11, Zhang et al teaches that the invention uses the liver as a biogenerator to produce and encapsulate small RNAs and leverages the advantages of host endogenous exosomes entering the circulatory system to deliver the small RNAs (para [0140]). Regarding claim(s) 12-14 and 17-18, Zhang et al teaches, “Conversely, the liver, as a natural biological generator of small RNA, further utilizes the fact that small RNA is encapsulated by hepatocytes to form exosomes, which are then transported to other tissues via the circulatory system. This technology avoids the high costs and technical requirements associated with other delivery methods; 3) More convenient: Large quantities of small RNA can be produced by intravenously injecting RNA expression plasmids without the need for additional compounds (e.g., cationic liposomes and polymers) or complex operations (e.g., electroporation and sonication cell degradation); 4) More efficient: This invention has achieved sustained expression of small RNA in mice injected with plasmids and effective silencing of its target genes.”, (see page 72, para [0140]). Regarding claim(s) 19-21, Zhang et al teaches combining two siRNAs, EGFR and TNC in figure 2A and 3B-I for the treatment of glioblastoma via intravenous injection of a plasmid carrier the two siRNAs (see [0179] and [0185]). Accordingly, claim(s) 1-4, 6-9, 11-14, and 17-21 are anticipated by Zhang et al. Claim(s) 1-4, 6-7, 12-13, and 17-21 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by 173 (US 10,533,173 B2; published 01/14/2020). Regarding claim 1-2, 4, 6-7, 173 discloses a precursor formula at col 6, lines 30 that reads an RNA fragment, e.g., microRNA or siRNA, with a 5’ flanking sequence, RNA targeting sequence, stem loop, compensation sequence, and 3’ flanking sequence. 173 also discloses a polynucleotide encoding the precursor (see col 7, lines 15-16). 173 discloses EGFR siRNA and its corresponding sequences (col 6, lines 34, and 43-49). Regarding claim 3, 173 teaches promoter-RNA fragment in Fig 1. Regarding claim 12-13 and 17-18, 173 teaches in Figure 38 targeting multiple tissue types and/or host organs with an RNA delivery system comprising a gene circuit. Regarding claim(s) 19-21, 173 teaches “2 weeks after the C57BL/6 mice were used for Lewis lung cancer model construction, the EGFR siRNA plasmid was administered by intravenous injection for treatment; during administration, the mice were administered with same once every 3 days; and, the animals were sacrificed on day 3 after the final administration, for taking the blood, lung, liver and various tissues and organs. The EGFR siRNA content in various tissues and organs was detected by qRT-PCR. As can be seen from the determination results (as shown in FIG. 38, each set of histograms from left to right were Normal, PBS, the control plasmid and the EGFR siRNA plasmid successively in FIG. 38), in addition to the brain and skeletal muscle, the EGFR siRNA entered into other tissues and organs, such as the liver and lung.”, (col 39, lines 30-43). Accordingly, claim(s) 1-4, 6-7, 12-13, and 17-21 are anticipated by 173. Claim(s) 1-4, 6, 10, 12-13, and 17-19 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by 481 (US 10,273,481 B2; published 04/30/2019). PNG media_image7.png 260 436 media_image7.png Greyscale Regarding claim(s) 1-4 and 6, 481 discloses figure 1, which contains at least one flanking region, an RNA fragment and its corresponding compensation sequence and a stem loop. Figure 1 discloses three RNAs. 481 more specifically discloses the formula, (formula V) of the RNA used to inhibit Bruton's agammaglobulinemia tyrosine kinase (BTK) (see col 1, line 61-67 to col 2, line 1-11). Lastly, 481 teaches the B from formula V is represented by SEQ ID NOs: 1-3 all of which are 21 nucleotides long (col 2, lines 14-16). Regarding claim 10, 481 teaches that the siRNAs of the invention can include forms with or without a modification, wherein a preferred modification is a 2’ fluoro (col 2, lines 59-60 and col 3, lines 1-5). Regarding claim(s) 12-13 and 17-18, 481 teaches a plasmid with three RNA fragments in it in figures 1, 2, 5-10 in lymphocytes. Regarding claim 19, 481 discloses a method for treating Chronic Lymphocytic Leukemia (CLL) comprising administering the BTK-inhibiting nucleotide (col 5, lines 9-14). Accordingly, claim(s) 1-4, 6, 10, 12-13, and 17-19 are anticipated by 481. Claim(s) 1-2, 4, 6-7, 10, 12, and 17-21 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by 441 (US 10,519,441 B2; published 12/31/2019) as evidenced by Starega-Roslan et al (The role of the precursor structure in the biogenesis of microRNA, Cell. Mol. Life Sci. Vol 68, pages 2859-2871, published May 24th, 2011). Regarding claim 1-2, 4, and 7, 441 teaches, “The inventors has proved with experiments that, through the inhibition of miRNA-214, the Treg cells can be inhibited, and the differentiation of T cells into immune response T cells can be promoted, thereby inhibiting the immune evasion of tumors and achieving the goal of tumor prevention and/or treatment. The present invention is completed on this basis.”, (col 5, lines 30-67). 441 does not explicitly teach 5’ and/or 3’ flanking sequences, a loop, or a compensation sequence on miRNA. Starega-Roslan et al teaches microRNA structure wherein the nucleotide sequence comprises an RNA fragment sequence targeting the gene, and one or more of a flanking sequence (5' flanking sequence), a stem-loop sequence, a compensation sequence of the RNA fragment sequence (reading on the antisense and/or miRNA* strand) and a 3' flanking sequence PNG media_image8.png 337 468 media_image8.png Greyscale (see figure 1 below). Regarding claim 6, 441 teaches, “The present invention provides a type of miRNA relating to the immune evasion of tumors. As used herein, said ‘miRNA’ refers to a type of RNA molecules that can be processed with the transcription product that can turn into the miRNA precursors. Mature miRNAs usually comprise 18-26 nucleotides (nt) (more particularly, 19-22 nt), not excluding other numbers of nucleotides.”, (col 8, lines 55-61). Regarding claim 10, 441 teaches, “The present invention also includes miRNA varieties and derivatives. Besides, miRNA derivatives in the general sense can also include miRNA varieties. n ordinary skilled person in the art can modify miRNA-214 in a conventional way, and the modification methods include (but are not limited to): methylation, . .”, (col 10, 1-9). Regarding claim 12 and 17-18, 441 teaches vectors, e.g., expression vectors containing the miRNA (col 3, lines 25-27) and microvesicles containing the microRNAs for injection into mice in figure 1 and 2A. Regarding claim(s) 19-21, 441 teaches inhibiting the immune evasion of tumors (reading on treating cancer) (col 2, lines 36-41; Figure 5B). Accordingly, claim(s) 1-2, 4, 6-7, 10, 12, and 17-21 are anticipated by 441. Claim(s) 1-2, 4, 6, 12, 17, and 19-20 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by 603 (US 10,227,603 B2; published 03/12/2019) as evidenced by Starega-Roslan et al (The role of the precursor structure in the biogenesis of microRNA, Cell. Mol. Life Sci. Vol 68, pages 2859-2871, published May 24th, 2011). Regarding claim(s) 1-2 and 4, 603 teaches knocking down alanine aminotransferase with microRNA from a transgenic plant in figure 4. 603 also teachings microRNA to interfere with the NDRG1 gene (col 21, lines 17-18). 603 does not explicitly teach miRNA structure. PNG media_image8.png 337 468 media_image8.png Greyscale Starega-Roslan et al teaches microRNA structure wherein the nucleotide sequence comprises an RNA fragment sequence targeting the gene, and one or more of a flanking sequence (5' flanking sequence), a stem-loop sequence, a compensation sequence of the RNA fragment sequence (reading on the antisense and/or miRNA* strand) and a 3' flanking sequence (see figure 1 below). Regarding claim 6, 603 teaches “Micro-ribonucleic acids (microRNA) are defined as a kind of evolutionarily conserved non-coding single-strand small ribonucleic acid molecules of approximately from 19 to 23 nucleotides in length.”, (col 2, lines 7-10). Regarding claim(s) 12 and 17, 603 teaches the construction of vectors (plasmids) stably expression exogenous microRNA (col 21, see example 2.1). Regarding claim(s) 19-20, 603 teaches “In another one preferred example, said method is also used for treating microRNA targeted gene-related diseases.”, (col 6, lines 17-18), wherein mice of the invention ingest via oral administration of a plant containing microRNA (figure 5). Accordingly, claim(s) 1-2, 4, 6, 12, 17, and 19-20 are anticipated by 603. Claim(s) 1-4, 6-7, 11-13, and 17-21 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by 932 (US 10,308,932 B2; published 06/04/2019) as evidenced by Starega-Roslan et al (The role of the precursor structure in the biogenesis of microRNA, Cell. Mol. Life Sci. Vol 68, pages 2859-2871, published May 24th, 2011). Regarding claim(s) 1-2, 4, and 7, 932 teaches, “In a second aspect of the present invention, provided is a use of a functional microRNA and/or siRNA for preparing a composition to be applied to mammals, said composition forms cell microvesicles at a first site in the body of an animal and is delivered to a second site so as to regulate the expression of the target genes of the functional microRNA and/or siRNA at the second site, in which the second site is different from the first site. In another preferred example, said target genes include MYC, K-ras, CCND2, cdk6, E2F3, MEK2, ERK5, PTGS2, and DFF45.”, (col 2, lines 51-61). 932 does not explicitly teach miRNA structure. PNG media_image8.png 337 468 media_image8.png Greyscale Starega-Roslan et al teaches microRNA structure wherein the nucleotide sequence comprises an RNA fragment sequence targeting the gene, and one or more of a flanking sequence (5' flanking sequence), a stem-loop sequence, a compensation sequence of the RNA fragment sequence (reading on the antisense and/or miRNA* strand) and a 3' flanking sequence (see figure 1 below). Regarding claim 3, 932 teaches promoter (CMV) and microRNA (col 17, lines 17-27). Regarding claim 6, 932 teaches that microRNAs are about 19-23 nucleotides (col 1, line 18). Regarding claim 11, 932 teaches, “In this example, the artificially-synthesized siRNA is injected into the body of mice via tail vein injection. The siRNA in the body of mice is reabsorbed by liver cells and is again secreted via cell microvesicles into blood to form “cell microvesicle-siRNA complex”. The lymphocytes in the circulatory system then internalize the “cell microvesicle-siRNA complex”, and the siRNA in the complex enters the lymphocytes and plays a corresponding role.”, (col 14, lines 30-38). Regarding claim(s) 12-13, 932 teaches the preparation of vectors expressing microRNA of the invention (col 12, lines 8-12). Moreover, 932 teaches, “In a first aspect of the present invention, provided is a use of a functional microRNA and/or siRNA for preparing a composition to be applied to mammals; said composition forms cell microvesicles at a first site in the body of an animal and is delivered to a second site so as to improve a physiological state at the second site or treat a disease at the second site, in which the second site is different from the first site.”, (col 2, lines 51-58). Regarding claim 17, 932 teaches constructing a plasmid and an adenovirus overexpression miR-145 (col 17, lines 8-14) Regarding claim 18, 932 teaches, “In a first aspect of the present invention, provided is a use of a functional microRNA and/or siRNA for preparing a composition to be applied to mammals; said composition forms cell microvesicles at a first site in the body of an animal and is delivered to a second site so as to improve a physiological state at the second site or treat a disease at the second site, in which the second site is different from the first site.”, (col 2, lines 43-50). Regarding claim(s) 19-20, 932 teaches a method of treating a disease by applying to the first site a functional microRNA and/or siRNA to a subject in need thereof. Application of said microRNA and/or siRNA includes oral, inhalation, injection, etc., (col 4, lines 40-49). Regarding claim 21, 932 teaches that diseases include liver cancer, or lymph cancer (col 5, lines 11-14). Accordingly, claim(s) 1-4, 6-7, 11-13, and 17-21 are anticipated by 932. Claim(s) 1-4, 6-7, 11-13, and 17-21 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by 970 (US 11,304,970 B2, published 04/19/2022, filing date of 05/05/2016). The applied reference has two common inventors with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2). This rejection under 35 U.S.C. 102(a)(2) might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C. 102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B) if the same invention is not being claimed; or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed in the reference and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. Regarding claim(s) 1-2, 4, 6-7, 970 teaches, “The present invention provides a novel siRNA that inhibits the EGFR gene, and precursors and applications thereof in the treatment of tumours.”, (col 2, lines 9-12). PNG media_image9.png 60 94 media_image9.png Greyscale Moreover, “siRNAs can be obtained by processing the precursor siRNAs, and the said precursor siRNAs can be folded into a stable stem-loop (hairpin) structure having a general length of 50-100 bp. The said precursor siRNAs can be folded into a stable stem-loop structure, and two sides of the stem of the stem-loop structure contain two sequences substantially complementary to each other. In the present invention, the said precursor siRNAs are artificially synthesised precursor siRNAs, and the said precursor siRNAs have the structure as shown in formula I: As a representative example, B1 is EGFR siRNA sense strand sequence; B2 is a sequence with complementarity (including substantial and complete complementarity) to B1; C can be a sequence: 5′-3′, GUUUUGGCCACUGACUGAC (SEQ ID NO: 202); A1 and A2 are null or optionally nucleotide sequences consisting of 4-5 bases respectively; Wherein, the precursor siRNA as shown can be processed in the host to form the EGFR siRNA. In the present invention, the precursor miRNA forming the EGFR siRNA can be spliced to generate an siRNA regulating the EGFR gene, i.e. the EGFR siRNA (for example, SEQ ID NO.: 197).”, (col 6, lines 28-60). Regarding claim 3, 970 teaches a promoter-RNA fragments and the various promoters (col 8, lines 40-54). Regarding claim 11, 970 teaches “. . . the expression vectors are processed to form microvesicles in the mammal, which are transported to a second site on the mammal, where the siRNA is expressed . . . the said second site comprises liver, lung, and kidney sites.”, (col 3, lines 54-56 and 61-62). Regarding claim(s) 12-13, 970 teaches “. . . the expression vectors are processed to form microvesicles in the mammal, which are transported to a second site on the mammal, where the siRNA is expressed . . . the said second site comprises liver, lung, and kidney sites.”, (col 3, lines 54-56 and 61-62). Regarding claim 17, 970 teaches wherein said expression vector is a plasmid (col 3, 31-33). Regarding claim 18, 970 teaches injection of the plasmid expression the siRNA-EGFR into mice (see figure 7-8). Regarding claim(s) 19-21, 970 teaches treating lung cancer via intravenous injection (see figure 8). Accordingly, claim(s) 1-4, 6-7, 11-13, and 17-21 are anticipated by 970. Claim(s) 1-4, 6-7, 11-13, and 17-21 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by 213 (US 10,982,213 B2, published 04/20/2021, filing date of 05/05/2016). The applied reference has two common inventors with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2). This rejection under 35 U.S.C. 102(a)(2) might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C. 102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B) if the same invention is not being claimed; or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed in the reference and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. Regarding claim(s) 1-2, 4, 6-7 213 teaches, “The present invention provides a novel siRNA that inhibits the K-RAS gene, and precursors and applications thereof in the treatment of tumours.”, (col 2, lines 36-38). Moreover, “siRNAs can be obtained by processing the precursor siRNAs, and the said precursor siRNAs can be folded into a stable stem-loop (hairpin) structure having a general length of 50-100 bp. The said precursor siRNAs can be folded into a stable stem-loop structure, and two sides of the stem of the stem-loop structure contain two sequences substantially complementary to each other. In the present invention, the said precursor siRNAs are artificially synthesised precursor siRNAs, and the said precursor siRNAs have the structure as shown in PNG media_image9.png 60 94 media_image9.png Greyscale formula I: As a representative example, B1 is K-RAS siRNA sense strand sequence; B2 is a sequence with complementarity (including substantial and complete complementarity) to B1; C is a sequence as shown (GUUUUGGCCACUGACUGAC); A1 and A2 are null or optionally nucleotide sequences consisting of 4-5 bases respectively; wherein the precursor siRNA as shown can be processed in the host to form the K-RAS siRNA.”, (see col 7, lines 58-67 to col 8, lines 1-17). Regarding claim 3, 213 teaches a promoter-RNA fragments and the various promoters (col 8, lines 66-67 to col 9 lines 1-14). Regarding claim 11, 213 teaches “. . . the expression vectors are processed to form microvesicles in the mammal, which are transported to a second site on the mammal, where the siRNA is expressed . . . the said second site comprises liver, lung, and kidney sites.”, (col 4, lines 54-56 and 61-62). Regarding claim(s) 12-13, 970 teaches “. . . the expression vectors are processed to form microvesicles in the mammal, which are transported to a second site on the mammal, where the siRNA is expressed . . . the said second site comprises liver, lung, and kidney sites.”, (col 3, lines 13-17 and 22-23). Regarding claim 17, 213 teaches wherein said expression vector is a plasmid (col 3, 61-62). Regarding claim 18, 213 teaches injection of the plasmid expression the siRNA-EGFR into mice (col 13, lines 10-11, see figure 8-9). Regarding claim(s) 19-21, 213 teaches treating lung, colorectal, and pancreatic cancer via intravenous injection (see figures 9-12). Accordingly, claim(s) 1-4, 6-7, 11-13, and 17-21 are anticipated by 213. Claim(s) 1-3, 6-9, 11-14, and 17-21 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by 048 (US 12,553,048 B2, published 02/17/2026, filing date of 12/17/2019). The applied reference has two common inventors with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2). This rejection under 35 U.S.C. 102(a)(2) might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C. 102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B) if the same invention is not being claimed; or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed in the reference and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. Regarding claim(s) 1-3 and 6-8, 048 teaches a first siRNA molecule capable of reducing the expression of EGFR or KRAS with SEQ ID NO: 1 or 2 (col 6, lines 29-39). More specifically, 048 teaches the gene circuit template in Figure 1 and the circuit with EGFR siRNA in it in Figure 2. Regarding claim 9, 048 teaches “In a preferred embodiment, the targeting peptide element of the present invention is RVG-LAMP2B, that is, a fusion protein consisting of RVG and LAMP2B.”, (col 7, lines 39-41). Regarding claim 11, 048 teaches, “Through the tail vein injection of plasmids expressing siRNAs, siRNAs can be detected in multiple tissues such as liver, lung, kidney, spleen, stomach and other tissues, but the precursor molecules thereof can only be detected in liver tissue, suggesting that plasmid molecules may be expressed in liver cells and secreted siRNAs into other tissues. By detecting the content of siRNAs in plasma and plasma exosomes, it was found that almost all the siRNA molecules in plasma were concentrated in plasma exosomes.”, (col 8, lines 17-25). Regarding claim(s) 12-14 and 17-18, 048 teaches, “Through the tail vein injection of plasmids expressing siRNAs, siRNAs can be detected in multiple tissues such as liver, lung, kidney, spleen, stomach and other tissues, but the precursor molecules thereof can only be detected in liver tissue, suggesting that plasmid molecules may be expressed in liver cells and secreted siRNAs into other tissues. By detecting the content of siRNAs in plasma and plasma exosomes, it was found that almost all the siRNA molecules in plasma were concentrated in plasma exosomes. After the plasmid with a promoter element, an RVG targeting element, a first siRNA expression element and a second siRNA expression element is introduced into the body through the tail vein injection, the siRNAs can pass through the blood brain barrier to reach the brain tissue, thereby inhibiting the expression of the two different genes.”, (col 8, 17-31). Regarding claim(s) 19-21, 048 teaches, “The present invention further provides a method of treating cancer, that is, administering a safe and effective amount of the siRNA composition or vector or pharmaceutical formulation of the invention to an object in need, thereby treating cancer.”, (col 7, lines 43-47). Further, 048 teaches treating cancer via intravenous injection of a gene circuit contain in a vector comprising EGFR siRNA (figure 4B-C) or KRAS siRNA (figure 5B-C) or EGFR siRNA + TNC siRNA (figure 6D-E). Accordingly, claim(s) 1-3, 6-9, 11-14, and 17-21 are anticipated by 048. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claim(s) 1-2, 4-7, 12, 18-19 and 21 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim 3-4, 6, and 11 of U.S. Patent No. 11,304,970 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because of the following: Claim 3 of the ‘970 patent recites, “A polynucleotide wherein the polynucleotide can be transcribed by a host to form the precursor sequence of claim 1”, wherein claim 1 recites, “A precursor sequence, wherein the sequence has a structure from the 5′ terminus to the 3′ terminus as shown in formula I; wherein B1 is a first ribonucleic acid sequence comprising an EGFR siRNA sense strand sequence; B2 is a sequence substantially or completely complementary to B1, and B2 is not complementary to C, wherein substantially complementary means there are 2-8 non-complementary bases between B2 and B1; C is a stem-loop structure sequence; and A1 is UGCUG and/or A2 is CAGG or CAGGA, wherein, the nucleotide sequence of the EGFR siRNA sense strand is selected from the group consisting of: SEQ ID NO: 197, SEQ ID NO: 17, SEQ ID NO: 20, SEQ ID NO: 35, SEQ ID NO: 42, SEQ ID NO: 47, SEQ ID NO: 52, SEQ ID NO: 59, SEQ ID NO: 63, SEQ ID NO: 68 and SEQ ID NO: 72; and the precursor sequence as shown can be processed in a host to form the EGFR siRNA.” (see formula I below). Claim 3 of ‘970 anticipates instant claim(s) 1-2, 4-7. Claim 4 of the ‘970 patent recites, “An expression vector containing the precursor sequence of claim 1 or a polynucleotide which can be transcribed by a host to form said precursor sequence.” Claim 4 of ‘970 anticipates instant claim 12. Claim 6 of ‘970 recites, “A method for administering a medicament to a mammal in need thereof, comprising: administering the pharmaceutical preparation of claim 5 at a first site of the mammal, whereby the expression vector is processed to form a microvesicle in the mammal which is transported to a second site on the mammal where the siRNA is expressed.” Claim 6 of ‘970 anticipates instant claim 18. Claim 11 of the ‘970 patent recites, “A method for inhibiting EGFR or for treating a malignant tumour highly expressing EGFR, wherein the malignant tumour is selected from the group consisting of liver cancer, lung cancer, stomach cancer, oesophageal cancer, ovarian cancer, colorectal cancer, cervical cancer, pancreatic cancer, prostatic cancer, leukaemia, breast cancer, kidney cancer, bladder cancer, oral epithelial cancer, head and neck cancer, brain tumour and glioblastoma, comprising administering to a subject in need thereof, an effective amount of the precursor sequence of claim 1, or an expression vector comprising said precursor sequence or a polynucleotide which can be transcribed by a host to form said precursor sequence.” Claim 11 of ‘970 anticipates instant claim 19 and 21. Claim(s) 1-2, 12, and 17-21 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1 of U.S. Patent No. 10,308,932 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because of the following: Claim 1 of the ‘932 patent recites, “A method for treating a disease in the colorectum of a mammal subject, comprising: intravenously administering to the mammal subject a composition comprising a recombinant expression vector that expresses functional microRNA in the mammal subject, wherein said functional microRNA is miR-143; said recombinant expression vector is adenovirus vector, and; the disease is colorectal cancer.” Claim 1 of ‘932 patent anticipates claim(s) 1-2, 12, and 17-21. Claim 4 is rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1 of U.S. Patent No. 10,308,932 B2 as evidenced by Starega-Roslan et al (The role of the precursor structure in the biogenesis of microRNA, Cell. Mol. Life Sci. Vol 68, pages 2859-2871, published May 24th, 2011). Claim 1 of the ‘932 patent recites, “A method for treating a disease in the colorectum of a mammal subject, comprising: intravenously administering to the mammal subject a composition comprising a recombinant expression vector that expresses functional microRNA in the mammal subject, wherein said functional microRNA is miR-143; said recombinant expression vector is adenovirus vector, and; the disease is colorectal cancer.” Claim 1 of the ‘932 patent does explicitly teach that the microRNA has an RNA fragment sequence targeting a gene, and one or more of a flanking sequence (5' flanking sequence), a stem-loop sequence, a compensation sequence of the RNA fragment sequence (reading on the antisense and/or miRNA* strand) and a 3' flanking sequence. PNG media_image8.png 337 468 media_image8.png Greyscale Starega-Roslan et al teaches microRNA structure wherein the nucleotide sequence comprises an RNA fragment sequence targeting the gene, and one or more of a flanking sequence (5' flanking sequence), a stem-loop sequence, a compensation sequence of the RNA fragment sequence (reading on the antisense and/or miRNA* strand) and a 3' flanking sequence (see figure 1 below). Accordingly, claim 1 of the ‘932 patent anticipates instant claim 4. Claim(s) 1-2, 6, 12, 18-19, and 21 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim 7 of U.S. Patent No. 10,227,603 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because of the following: Claim 7 of ‘603 recites, “A method for ameliorating or treating a microRNA target gene-related disease, comprising administering a composition including a carrier, wherein said carrier includes at least one product selected from the group consisting of: (a) a plant or an edible part thereof, said plant or edible part thereof expressing and carrying said exogenous functional microRNA, and (b) an extract of said plant or edible part thereof, said extract containing said exogenous functional microRNA, wherein said exogenous functional microRNA consists of SEQ ID NO:14, said plant is leaf lettuce, said exogenous functional microRNA regulates expression of a microRNA targeted gene, and said carrier carrying said exogenous functional microRNA ameliorates or treats a microRNA targeted gene-related disease in an animal, and said gene-related disease is a viral infectious disease or cancer.” Accordingly claim 7 of ’603 anticipates instant claim(s) 1-2, 6, 12, 18-19, and 21. Claim 4 is rejected on the ground of nonstatutory double patenting as being unpatentable over claim 7 of U.S. Patent No. 10,227,603 B2 as evidenced by Starega-Roslan et al (The role of the precursor structure in the biogenesis of microRNA, Cell. Mol. Life Sci. Vol 68, pages 2859-2871, published May 24th, 2011). Claim 7 of ‘603 recites, “A method for ameliorating or treating a microRNA target gene-related disease, comprising administering a composition including a carrier, wherein said carrier includes at least one product selected from the group consisting of: (a) a plant or an edible part thereof, said plant or edible part thereof expressing and carrying said exogenous functional microRNA, and (b) an extract of said plant or edible part thereof, said extract containing said exogenous functional microRNA, wherein said exogenous functional microRNA consists of SEQ ID NO:14, said plant is leaf lettuce, said exogenous functional microRNA regulates expression of a microRNA targeted gene, and said carrier carrying said exogenous functional microRNA ameliorates or treats a microRNA targeted gene-related disease in an animal, and said gene-related disease is a viral infectious disease or cancer.” Claim 7 of the ‘603 patent does explicitly teach that the microRNA has an RNA fragment sequence targeting a gene, and one or more of a flanking sequence (5' flanking sequence), a stem-loop sequence, a compensation sequence of the RNA fragment sequence (reading on the antisense and/or miRNA* strand) and a 3' flanking sequence. Starega-Roslan et al teaches microRNA structure wherein the nucleotide sequence comprises an RNA fragment sequence targeting the gene, and one or more of a flanking sequence (5' flanking sequence), a stem-loop sequence, a compensation sequence of the RNA fragment sequence (reading on the antisense and/or miRNA* strand) and a 3' flanking sequence (see figure 1 above in ‘932 DP rejection). Accordingly, claim 7 of ‘603 anticipates instant claim 4. Claim(s) 1-2, 7, 12, 17, 19, and 21 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1 of U.S. Patent No. 10,519,441 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because of the following: Claim 1 of the ‘441 patent recites, “A method for treating sarcoma or lung cancer by administering a safe and effective dose of microvesicles to a subject in need thereof so as to treat the sarcoma or lung cancer by inhibiting Treg cells, wherein said microvesicles contain a miRNA-214 inhibitor which is an anti-sense nucleotide sequence of miRNA-214 or a precursor thereof.” Claim 1 of ‘441 anticipates instant claim 1-2, 7, 12, 17, 19, and 21. Claim 4 is rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1 of U.S. Patent No. 10,519,441 B2 as evidenced by Starega-Roslan et al (The role of the precursor structure in the biogenesis of microRNA, Cell. Mol. Life Sci. Vol 68, pages 2859-2871, published May 24th, 2011). Claim 1 of the ‘441 patent recites, “A method for treating sarcoma or lung cancer by administering a safe and effective dose of microvesicles to a subject in need thereof so as to treat the sarcoma or lung cancer by inhibiting Treg cells, wherein said microvesicles contain a miRNA-214 inhibitor which is an anti-sense nucleotide sequence of miRNA-214 or a precursor thereof.” Claim 1 of the ‘441 patent does explicitly teach that the microRNA has an RNA fragment sequence targeting a gene, and one or more of a flanking sequence (5' flanking sequence), a stem-loop sequence, a compensation sequence of the RNA fragment sequence (reading on the antisense and/or miRNA* strand) and a 3' flanking sequence. Starega-Roslan et al teaches microRNA structure wherein the nucleotide sequence comprises an RNA fragment sequence targeting the gene, and one or more of a flanking sequence (5' flanking sequence), a stem-loop sequence, a compensation sequence of the RNA fragment sequence (reading on the antisense and/or miRNA* strand) and a 3' flanking sequence (see figure 1 above in ‘932 DP rejection). Claim 1 of ‘441 anticipates instant claim 4. Claim(s) 1-2, 4, 6, and 12 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim(s) 1 and 3 of U.S. Patent No. 10,273,481 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because of the following: Claim 1 of the ‘481 patent recites, “A recombinant nucleic acid molecule for inhibiting Bruton's agammaglobulinemia tyrosine kinase (BTK), wherein the recombinant nucleic acid molecule comprises Formula V: A-(B-L)p-Z, wherein A is an optional sequence of 0-50 nucleotides (nts) at 5′ end, B is either of (1) a BTK-targeted siRNA sequence selected from SEQ ID NO: 1, SEQ ID NO:2, and SEQ ID NO:3, or (2) a precursor RNA molecule of Formula II Seqforward-X-Seqbackward, wherein Seqforward or Seqbackward comprises SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, Seqforward and Seqbackward are capable of hybridizing to each other, and X is a loop sequence not complementary to Seqforward or Seqbackward; L is an optional interval sequence of 0-50 nts; p is a positive integer of 2, 3, 4, or 5; Z is an optional sequence of 0-50 nts at 3′ end.” Claim 1 of ‘481 anticipates instant claim(s) 1-2, 4, and 6. Claim 3 of ‘481 recites, “A pharmaceutical composition comprising a pharmaceutically acceptable carrier and an effective amount of one or more active agents selected from the group consisting of: (a) the recombinant nucleic acid molecule of claim 1, (b) a polynucleotide that encodes the nucleic acid molecule of claim 1, and (c) an expression vector comprising the polynucleotide of (b).” Claim 3 of ‘481 anticipates instant claim 12. Claim(s) 1-2, 4, 6-7, 12, 18-19, and 21 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim(s) 2, 3, and 20 of U.S. Patent No. 10,533,173 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because of the following: PNG media_image9.png 60 94 media_image9.png Greyscale Claim 2 of the ‘173 patent recites, “The pharmaceutical preparation of “A pharmaceutical preparation, wherein the preparation comprises: (a) an expression vector for expressing anti-miRNAs and/or siRNAs; and (b) a pharmaceutically acceptable carrier; wherein the expression vector comprise precursor sequence having a structure from the 5′ terminus to the 3′ terminus as shown in formula I: wherein B1 is a first ribonucleic acid sequence, and comprises an anti-miRNA sequence form or an siRNA sequence form; B2 is a second ribonucleic acid sequence substantially or completely complementary to B1, and B2 is not complementary to C; wherein substantially complementary is that there are 2-8 non-complementary bases between B2 and B1; C is a stem-loop structure sequence; and A1 and A2 are null or are optionally RNA sequences consisting of 4-5 bases respectively; wherein the precursor can express the first ribonucleic acid sequence in a host, but cannot express the second ribonucleic acid sequence complementary to the first ribonucleic acid sequence” wherein the anti-miRNA and/or siRNA is a RNA selected from the group consisting of anti-miRNA-214, K-RAS siRNA, EGFR siRNA, PDL1 siRNA, PDCD1 siRNA, ALK siRNA and IDO1 siRNA; the K-RAS siRNA has a sequence selected from the group consisting of SEQ ID NO: 12,. . .” Claim 2 of ‘173 anticipates instant claim(s) 1-2, 4, and 6-7. Claim 3 of ‘173 recites, “A method for administering a medicament, wherein the method comprises the step of: administering the pharmaceutical preparation of claim 1 at a first site on a mammal, so that the expression vector is processed to form a microvesicle in the mammal which is transported to a second site on the mammal where the anti-miRNAs and/or siRNAs are expressed.” Claim 3 of ‘173 anticipates instant claim(s) 12 and 18. Claim 20 of ‘173 recites, “The method of “A method for inhibiting miRNA-214; and/or treating a malignant tumor highly expressing miRNA-214; comprising administering to a subject in need thereof an effective amount of the pharmaceutical preparation of “The pharmaceutical preparation sequence of claim 1 (see above), wherein the sequence has a structure from the 5′ terminus to the 3′ terminus as shown in formula I: PNG media_image9.png 60 94 media_image9.png Greyscale wherein B1 is anti-miRNA-214-5p; B2 is a sequence substantially or completely complementary to B1, and B2 is not complementary to C; C is a stem-loop structure sequence, and A1 and A2 are null or are optionally RNA sequences consisting of 4-5 bases respectively; wherein the sequence of B1 as shown can be processed in the host to form anti-miRNA-214, and only the anti-miRNA-214-5p, rather than the anti-miRNA-214-3p, in the anti-miRNA-214 is expressed, wherein the precursor cannot express the ribonucleic acid of B2” wherein the malignant tumor is selected from the group consisting of liver cancer, lung cancer, stomach cancer, oesophageal cancer, ovarian cancer, colorectal cancer, cervical cancer, pancreatic cancer, prostatic cancer, leukaemia and breast cancer.” Claim 20 of ‘173 anticipates instant claim(s) 19 and 21. Claim(s) 1-2, 4, 6-7, 12, 19 and 21 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim(s) 4, 5, and 12 of U.S. Patent No. 10,982,213 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because of the following: Claim 4 of ‘213 recites, “A polynucleotide, which can be transcribed by a host to form the precursor sequence of “A precursor sequence having a structure from the 5′ terminus to the 3′ terminus as shown in formula I: PNG media_image9.png 60 94 media_image9.png Greyscale wherein, B1 is a first ribonucleic acid sequence comprising a K-RAS siRNA sense strand sequence; B2 is a sequence substantially or completely complementary to B1, and B2 is not complementary to C; wherein substantially complementary means there are 2-8 non-complementary bases between B2 and B1; C is a stem-loop structure sequence; and A1 is UGCUG; and/or A2 is CAGG or CAGGA; wherein the nucleotide sequence of the K-RAS siRNA sense strand is selected from the following sequences as shown in the sequence listing: SEQ ID NO: 263; and the precursor sequence can be processed in a host to form the K-RAS siRNA (claim 1).”.” Claim 4 of ‘213 anticipates instant claim(s) 1-2, 4, and 6-7. Claim 5 of ‘213 recites, “An expression vector, comprising the precursor sequence of claim 1 (above) or a polynucleotide that can be transcribed by a host to form said precursor sequence.” Claim 5 of ‘213 anticipates instant claim 12. Claim 12 of ‘213 recites, “A method for inhibiting K-RAS or for treating a malignant tumour highly expressing K-RAS; wherein the malignant tumour is selected from the group consisting of kidney cancer, oral epithelial cancer, head and neck cancer, bladder cancer, brain tumour, glioblastoma, liver cancer, lung cancer, stomach cancer, oesophageal cancer, ovarian cancer, colorectal cancer, cervical cancer, pancreatic cancer, prostatic cancer, leukaemia and breast cancer, comprising administering to a subject in need thereof an effective amount of the precursor sequence of claim 1, or an expression vector, comprising said precursor sequence or a polynucleotide that can be transcribed by a host to form said precursor sequence, or an siRNA capable of inhibiting expression of a K-RAS gene, wherein the nucleotide sequence of the sense strand of the siRNA is SEQ ID NO: 263, and to which directly or indirectly a sequence A1 and/or A2 is attached, wherein A1 is UGCUG and A2 is CAGG or CAGGA.” Claim 12 of ‘213 anticipates instant claim(s) 19 and 21. Claim(s) 1-3, 6-9, 12, and 14 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim 2 and 7 of U.S. Patent No. 12,553,048 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because of the following: Claim 2 of ‘048 recites, “The siRNA composition of “A siRNA composition, comprising: a first siRNA molecule that reduces the expression of a first target gene; an optional coding sequence for a targeting peptide element; and a second siRNA molecule that reduces the expression of a second target gene, wherein the first siRNA molecule has a sequence as shown in SEQ ID NO: 1 and/or SEQ ID NO: 2, and the first target gene is selected from the group consisting of EGFR, KRAS, or a combination thereof; and wherein the second siRNA molecule has a sequence as shown in SEQ ID NO: 3, and the second target gene is TNC”, wherein the siRNA composition comprises the coding sequence for the targeting peptide element, and the targeting peptide element is selected from the group consisting of RVG, LAMP2B, or a combination thereof.” Claim 2 of ‘048 anticipates instant claim(s) 1-2 and 6-9. Claim 7 of ‘048 recites, “The vector of “A vector, comprising: a promoter element; a first siRNA molecule that reduces the expression of a first target gene; an optional coding sequence for a targeting peptide element; and a second siRNA molecule that reduces the expression of a second target gene, wherein the first siRNA molecule has a sequence as shown in SEQ ID NO: 1 and/or SEQ ID NO: 2, and the first target gene is selected from the group consisting of EGFR, KRAS, or a combination thereof; and wherein the second siRNA molecule has a sequence as shown in SEQ ID NO: 3, and the second target gene is TNC”, wherein the vector comprises the coding sequence for the targeting peptide element, and the targeting peptide element is selected from the group consisting of RVG, LAMP2B, or a combination thereof.” Claim 7 of ‘048 anticipates instant claim(s) 3, 12, and 14. Claim 4 is rejected on the ground of nonstatutory double patenting as being unpatentable over claim 2 of U.S. Patent No. 12,553,048 B2 in view of ‘213 (US 10,982,213 B2, published April 20, 2021, Effective filing date of May 5th, 2016). Claim 2 of ‘048 recites, “The siRNA composition of “A siRNA composition, comprising: a first siRNA molecule that reduces the expression of a first target gene; an optional coding sequence for a targeting peptide element; and a second siRNA molecule that reduces the expression of a second target gene, wherein the first siRNA molecule has a sequence as shown in SEQ ID NO: 1 and/or SEQ ID NO: 2, and the first target gene is selected from the group consisting of EGFR, KRAS, or a combination thereof; and wherein the second siRNA molecule has a sequence as shown in SEQ ID NO: 3, and the second target gene is TNC”, wherein the siRNA composition comprises the coding sequence for the targeting peptide element, and the targeting peptide element is selected from the group consisting of RVG, LAMP2B, or a combination thereof.” Claim 2 of ‘048 does not explicitly teach a precursor nucleotide with a 5’ or 3’ flanking region, a stem loop, or a compensation sequence. PNG media_image9.png 60 94 media_image9.png Greyscale ‘213 teaches, “siRNAs can be obtained by processing the precursor siRNAs, and the said precursor siRNAs can be folded into a stable stem-loop (hairpin) structure having a general length of 50-100 bp. The said precursor siRNAs can be folded into a stable stem-loop structure, and two sides of the stem of the stem-loop structure contain two sequences substantially complementary to each other. In the present invention, the said precursor siRNAs are artificially synthesised precursor siRNAs, and the said precursor siRNAs have the structure as shown in formula I: As a representative example, B1 is K-RAS siRNA sense strand sequence; B2 is a sequence with complementarity (including substantial and complete complementarity) to B1; C is a sequence as shown (GUUUUGGCCACUGACUGAC); A1 and A2 are null or optionally nucleotide sequences consisting of 4-5 bases respectively; wherein the precursor siRNA as shown can be processed in the host to form the K-RAS siRNA.”, (see col 7, lines 58-67 to col 8, lines 1-17). Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify claim 2 of ‘048 to be a precursor siRNA as taught by ‘213 to yield the predictable results of obtaining stable hairpin structures that contain the siRNA of interest with 5’ and 3’ flanking regions, a stem loop, and a compensation sequence. Instant claim 4 is unpatentable over claim 2 of ‘048 in view of ‘213. Claim(s) 1-9 and 11-18 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 2, 4, 8, 10-11, 13, and 15-16 of copending Application No. 18/374,253 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because of the following: Claim 8 of ‘253 recites, “The viral vector-based RNA delivery system according to “The viral vector-based RNA delivery system according to “The viral vector-based RNA delivery system according to “The viral vector-based RNA delivery system according to “A viral vector-based RNA delivery system, comprising a viral vector carrying an RNA fragment to be delivered, wherein the viral vector is capable of enriching and endogenously spontaneously forming a complex comprising the RNA fragment in a host organ or tissue, and the complex is capable of entering and binding to a target tissue, and delivering the RNA fragment into the target tissue (claim 1)”, wherein the viral vector comprises a promoter and a targeting tag, wherein the targeting tag is capable of forming a targeting structure of the complex in the host organ or tissue, the targeting tag is located on the surface of the complex, and the complex seeks for and binds to the target tissue through the targeting structure, and delivers the RNA fragment into the target tissue”, wherein the viral vector comprises a circuit selected from the group consisting of promoter-RNA fragment, promoter-targeting tag, and promoter-RNA fragment-targeting tag, or a combination thereof; and the viral vector comprises at least an RNA fragment and a targeting tag, wherein the RNA fragment and the targeting tag are located in the same circuit or in different circuits”, wherein the viral vector further comprises a flanking sequence, a compensation sequence and a loop sequence that facilitate the correct folding and expression of the circuit, and the flanking sequence comprises 5' flanking sequence and 3' flanking sequence; and the viral vector comprises a circuit selected from the group consisting of 5' promoter-5' flanking sequence-RNA fragment-loop sequence-compensation sequence-3' flanking sequence, 5'-promoter-targeting tag, and 5' promoter-targeting tag-5' flanking sequence-RNA fragment-loop sequence-compensation sequence-3' flanking sequence, or a combination thereof.”, wherein the 5' flanking sequence has a sequence that is identical to or more than 80% homologous with ggatcctggaggcttgctgaaggctgtatgctgaattc (SEQ ID NO: 1); the loop sequence has a sequence that is identical to or more than 80% homologous with gttttggccactgactgac (SEQ ID NO: 2); the 3' flanking sequence has a sequence that is identical to or more than 80% homologous with accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag (SEQ ID NO: 3); and the compensation sequence has a reverse complementary sequence to the RNA fragment in which any 1 to 5 bases have been deleted.” Claim 8 of ‘253 anticipates instant clam(s) 1, 3-5, 8, and 12-14. Claim 2 of ‘253 recites, “The viral vector-based RNA delivery system according to claim 1, wherein the viral vector is an adenovirus-associated virus” (claim 1 above). Claim 2 of ‘253 anticipates instant claim 17. Claim 4 of ‘253 recites, “The viral vector-based RNA delivery system according to claim 1, wherein the RNA fragment comprises one, two or more RNA sequences with medical significance, and the RNA sequence is siRNA, shRNA or miRNA with medical significance.” Claim 4 of ‘253 anticipates instant claim 2. Claim 10 of ‘253 recites, “The viral vector-based RNA delivery system according to “The viral vector-based RNA delivery system according to claim 6, wherein in the case where the viral vector comprises two or more of the circuits, adjacent circuits are linked via a sequence composed of sequences 1-3; wherein, sequence 1 is CAGATC, sequence 2 is a sequence of 5-80 bases, and sequence 3 is TGGATC”, wherein in the case where the viral vector comprises two or more of the gene circuits, adjacent gene circuits are linked via sequence 4 or a sequence with more than 80% homology to sequence 4; wherein, sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC (seq id no: 6).” Claim 10 of ‘253 anticipates instant claim(s) 15-16. Claim 11 of ‘253 recites, “The viral vector-based RNA delivery system according to claim 1, wherein the organ or tissue is liver, and the complex is an exosome.” Claim 11 of ‘253 anticipates instant claim 11. Claim 13 of ‘253 recites, “The viral vector-based RNA delivery system according to “The viral vector-based RNA delivery system according to “The viral vector-based RNA delivery system according to claim 1, wherein the viral vector comprises a promoter and a targeting tag, wherein the targeting tag is capable of forming a targeting structure of the complex in the host organ or tissue, the targeting tag is located on the surface of the complex, and the complex seeks for and binds to the target tissue through the targeting structure, and delivers the RNA fragment into the target tissue”, wherein the targeting tag is a targeting peptide or targeting protein with targeting function.”, wherein the targeting peptide is RVG targeting peptide and the targeting protein is selected from the group consisting of RVG-LAMP2B fusion protein.” Claim 13 of ‘253 anticipates instant claim(s) 8-9. Claim 15 of ‘253 recites, “The viral vector-based RNA delivery system according to “he viral vector-based RNA delivery system according to claim 5,wherein the RNA sequence is 15-25 nucleotides in length”, wherein the RNA sequence has a sequence that is identical to, more than 80% homologous with, or of a nucleic acid molecule encoding a sequence selected from the group consisting of siRNA of EGFR gene, siRNA of KRAS gene, siRNA of VEGFR gene, siRNA of mTOR gene, siRNA of TNF-a gene, siRNA of integrin-a gene, siRNA of B7 gene, siRNA of TGF-p1 gene, siRNA of H2-K gene, siRNA of H2-D gene, siRNA of H2-L gene, siRNA of HLA gene, siRNA of GDF 15 gene, an antisense strand of miRNA-21, an antisense strand of miRNA-214, siRNA of TNC gene, siRNA of PTP 1 B gene, siRNA of mHTT gene, siRNA of Lrrk2 gene, siRNA of a-synuclein gene, and a combination thereof.” Claim 15 of ‘253 anticipates instant claim(s) 6-7. Claim 16 of ‘253 recites, “The viral vector-based RNA delivery system according to claim 1, wherein the delivery system is a delivery system for use in a mammal including human.” Claim 16 of ‘253 anticipates instant claim 18. Claim(s) 1-9 and 11-21 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 6, 8-9, 11, 13-14, and 16-17 of copending Application No. 18/374,242 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because of the following: Claim 6 of 242 recites, “The RNA plasmid delivery system as claimed in “The RNA plasmid delivery system as claimed in “The RNA plasmid delivery system as claimed in “The RNA plasmid delivery system as claimed in “An RNA plasmid delivery system, wherein the system comprises a plasmid carrying a RNA fragment required to be delivered, the plasmid can be enriched in an organ tissue of a host, and spontaneously forms a complex structure containing the RNA fragment in the organ tissue of the host, the complex structure can enter and be combined with a target tissue to deliver the RNA fragment into the target tissue (claim 1)”, wherein the plasmid further comprises a promoter and a targeting tag, the targeting tag can form a targeting structure of the complex structure in the organ tissue of the host, the targeting structure is located on the surface of the complex structure, and the complex structure can search for and be combined with the target tissue through the targeting structure to deliver the RNA fragment into the target tissue.”, wherein the plasmid comprises any one or a combination of the following circuits: promoter-RNA fragment, promoter-targeting tag, promoter-RNA fragment-targeting tag; wherein each of the plasmid comprises at least one RNA fragment and one targeting tag, the RNA fragment and targeting tag are located in the same circuit or in different circuits”, wherein the plasmid further comprises a flanking sequence, a compensation sequence, and a loop sequence that facilitate the correct folding and expression of the circuit, wherein the flanking sequence comprises a 5' flanking sequence and a 3' flanking sequence; and the plasmid comprises any one or a combination of the following circuits: 5' promoter-5' flanking sequence-RNA fragment-loop sequence-compensation sequence-3' flanking sequence, 5'- promoter-targeting tag, and 5' promoter-targeting tag-5' flanking sequence-RNA fragment-loop sequence-compensation sequence-3' flanking sequence.” wherein the 5' flanking sequence has a sequence that is identical to or more than 80% homologous with ggatcctggaggcttgctgaaggctgtatgctgaattc; the loop sequence has a sequence that is identical to or more than 80% homologous with gttttggccactgactgac;the 3' flanking sequence has a sequence that is identical to or more than 80% homologous with accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag; and the compensation sequence has a reverse complementary sequence to the RNA fragment in which any 1 to 5 bases have been deleted.” Claim 6 of 242 anticipates instant claim(s) 1, 3-5, 8, 12-14, and 17. Claim 8 of 242 recites “The RNA plasmid delivery system as claimed in “The RNA plasmid delivery system as claimed in claim 4, wherein in the presence of at least two circuits in the plasmid, adjacent circuits are connected through a sequence consisted of sequences 1-3; wherein, sequence 1 is CAGATC, sequence 2 is a sequence of 5-80 bases, and sequence 3 is TGGATC.”, wherein in the presence of at least two circuits in the plasmid, adjacent circuits are connected through sequence 4 or a sequence with homology greater than 80% with sequence 4; wherein, sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.” Claim 8 of 242 anticipates instant claim(s) 15-16. Claim 9 of 242 recites, “The RNA plasmid delivery system as claimed in claim 1, wherein the organ tissue is liver, and the complex structure is an exosome.” Claim 9 of 242 anticipates instant claim 11. Claim 13 of 242 recites, “The RNA plasmid delivery system according to “The RNA plasmid delivery system as claimed in “The RNA plasmid delivery system as claimed in claim 1, wherein the RNA fragment comprises one, two or more specific RNA sequences of medical significance, which are siRNA, shRNA, or miRNA sequences of medical significance”, wherein the RNA sequence is 15-25 nucleotides in length”, wherein the RNA sequence has a sequence that is identical to, or more than 80% homologous with, or of a nucleic acid molecule encoding a sequence selected from the group consisting of siRNA of EGFR gene, siRNA of KRAS gene, siRNA of VEGFR gene, siRNA of mTOR gene, siRNA of TNF-a gene, siRNA of integrin-a gene, siRNA of B7 gene, siRNA of TGF-31 gene, siRNA of H2-K gene, siRNA of H2-D gene, siRNA of H2-L gene, siRNA of HLA gene, siRNA of GDF15 gene, an antisense strand of miRNA- 21, an antisense strand of miRNA-214, siRNA of TNC gene, siRNA of PTP1B gene, siRNA of mHTT gene, siRNA of Lrrk2 gene, siRNA of a-synuclein gene, and a combination thereof.” Claim 13 of 242 anticipates instant claim(s) 2 and 6-7. Claim 14 of 242 recites, “The RNA plasmid delivery system as claimed in claim 1, wherein the delivery system is a delivery system for application in a mammal including human.” Claim 14 of 242 anticipates instant claim 18. Claim 11 of 242 recites, “The RNA plasmid delivery system as claimed in “The RNA plasmid delivery system as claimed in claim 3, wherein the targeting tag is selected from the group consisting of a targeting peptide or protein with a targeting function”, wherein the targeted peptide is selected from the group consisting of RVG targeting peptide, GEl1 targeting peptide, PTP targeting peptide, TCP-1 targeting peptide, and MSP targeting peptide; and the targeting protein is selected from the group consisting of RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP- 1 -LAMP2B fusion protein, and MSP-LAMP2B fusion protein.” Claim 11 of 242 anticipates instant claim 9. Claim 16 of 242 recites, “The application according to “Application of the RNA plasmid delivery system according to claim 1 in the manufacture of a medicament for treating a disease”, wherein the medicament is administered by oral administration, inhalation, subcutaneous injection, intramuscular injection, or intravenous injection.” Claim 16 of 242 anticipates instant claim(s) 19-20. Claim 17 of 242 recites, “The application according to claim 15, wherein the disease is a cancer, pulmonary fibrosis, colitis, obesity, cardiovascular disease caused by obesity, type 2 diabetes, Huntington's disease, Parkinson's disease, myasthenia gravis, Alzheimer's disease, or graft-versus-host disease.” Claim 17 of 242 anticipates instant claim 21. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claim(s) 1-9 and 11-21 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 8, 10-11, 13, 15, 17, and 19 of copending Application No. 18/477,107 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because of the following: Claim 8 of 107 recites, “The RNA delivery system for the treatment of Huntington's disease according to “The RNA delivery system for the treatment of Huntington's disease according to “The RNA delivery system for the treatment of Huntington's disease according to “The RNA delivery system for the treatment of Huntington's disease according to “An RNA delivery system for the treatment of Huntington's disease, wherein the system comprises a viral vector, the viral vector carries RNA fragments capable of treating Huntington's disease, the viral vector is capable of enrichment in organ tissues of a host and endogenously and spontaneously forming a complex containing the RNA fragments capable of treating Huntington's disease in the organ tissues of the host, and the complex is capable of delivering the RNA fragments into a target tissue to treat Huntington's disease.”, wherein the viral vector comprises a promoter and a targeting tag, the targeting tag is capable of forming a targeting structure for the complex in the organ tissues of the host, the targeting structure is located on the surface of the complex, the complex is capable of finding and binding to target tissues through the targeting structure, to deliver the RNA fragments into the target tissues”, wherein the viral vector comprises any one of the following circuits or the combination of several circuits: promoter-RNA fragment, promoter-targeting tag, promoter-RNA fragment-targeting tag; each viral vector comprises at least one RNA fragment and one targeting tag, and the RNA fragment and targeting tag are located in the same circuit or different circuits.”, wherein the viral vector further comprises a flanking sequence, a compensation sequence and a loop sequence that facilitate the folding into a correct structure and the expression of the circuit, the flanking sequences comprises 5' flanking sequences and 3' flanking sequences; the viral vector comprises any one of the following circuits or the combination of several circuits: 5'-promoter-5' flanking sequence-RNA fragment-loop sequence-compensation sequence-3' flanking sequence, 5'-promoter-targeting tag, 5'-promoter-targeting tag-5' flanking sequence-RNA fragment-loop sequence-compensation sequence-3' flanking sequence.”, wherein the 5' flanking sequence has a sequence that is identical to or more than 80% homologous with ggatcctggaggcttgctgaaggctgtatgctgaattc; the loop sequence has a sequence that is identical to or more than 80% homologous with gttttggccactgactgac; the 3' flanking sequence has a sequence that is identical to or more than 80% homologous with accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag; the compensation sequence has a reverse complementary sequence to the RNA fragment in which any 1 to 5 bases have been deleted.” Claim 8 of 107 anticipates instant claim(s) 1, 3-5, 8, 12-14, and 17. Claim 10 of 107 recites, “The RNA delivery system for the treatment of Huntington's disease according to “The RNA delivery system for the treatment of Huntington's disease according to claim 6, wherein in the case where there are at least two circuits in the virus vector, adjacent circuits are connected by a sequence consisting of sequences 1-3; wherein sequence 1 is CAGATC, sequence 2 is a sequence consisting of 5-80 bases, and sequence 3 is TGGATC.”, wherein in the case where there are at least two circuits in the virus vector, adjacent circuits are connected by a sequence that is identical to or more than 80% homologous with sequence 4; wherein sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.” Claim 10 of 107 anticipates instant claim(s) 15-16. Claim 11 of 107 recites, “The RNA delivery system for the treatment of Huntington's disease according to claim 1, wherein the organ tissue is liver, and the complex is exosome.” Claim 11 of 107 anticipates instant claim 11. Claim 13 of 107 recites, “The RNA delivery system for the treatment of Huntington's disease according to “The RNA delivery system for the treatment of Huntington's disease according to claim 5, wherein the targeting tag is selected from targeting peptides or targeting proteins with targeting functions”, wherein the targeting peptides include RVG targeting peptide, GE11 targeting peptide, PTP targeting peptide, TCP-1 targeting peptide, MSP targeting peptide; the targeting proteins include RVG-LAMP2B fusion protein, GE 11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP- 1 -LAMP2B fusion protein, MSP-LAMP2B fusion protein.” Claim 13 of 107 anticipates instant claim(s) 8-9. Claim 15 of 107 recites, “The RNA delivery system for the treatment of Huntington's disease according to “The RNA delivery system for the treatment of Huntington's disease according to “The RNA delivery system for the treatment of Huntington's disease according to claim 1, wherein the RNA fragments comprise one, two, or more specific RNA sequences with medical significance, and the RNA sequence is selected from siRNA, shRNA, or miRNA with medical significance”, wherein the length of the RNA sequence is 15-25 nucleotides.”, wherein the RNA capable of treating Huntington's disease is selected from siRNA of mHTT gene, or a sequence that is identical to or more than 80% homologous with the above sequence, or a nucleic acid molecule encoding the above RNA.” Claim 15 of 107 anticipates claim(s) 2 and 6-7. Claim 17 of 107 recites, “The RNA delivery system for the treatment of Huntington's disease according to claim 1, wherein the delivery system is a delivery system for use in a mammal including human.” Claim 17 of 107 anticipates instant claim 19. Claim 19 of 107 recites, “The application according to “Application of the RNA delivery system for the treatment of Huntington's disease according to claim 1 in the manufacture of a medicament for treating a disease, wherein the medicament is a medicament for the treatment of Huntington's disease and related diseases, and the medicament is administered by oral administration, inhalation, subcutaneous injection, intramuscular injection, or intravenous injection.” Claim 19 of 107 anticipates instant claim(s) 19-21. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claim(s) 1-2, 4, and 6 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 2 of copending Application No. 18/373,605 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because of the following: Claim 5 of 605 recites “The isolated nucleic acid according to “An isolated nucleic acid comprising a nucleotide sequence encoding an RNA capable of inhibiting expression of a gene, comprising: a first nucleotide sequence encoding: one or more RNAs that inhibit gene expression, and the RNA is selected from the group consisting of miRNA, shRNA, siRNA, mRNA, ncRNA, sgRNA, and a combination thereof; wherein, the nucleotide sequence comprises an RNA fragment sequence targeting the gene, and one or more of a flanking sequence, a stem-loop sequence, and a compensation sequence of the RNA fragment sequence; or wherein, the nucleotide sequence encodes one or more RNAs that inhibit gene expression comprises successively: 5' flanking sequence, RNA fragment sequence, stem-loop sequence, compensation sequence and 3' flanking sequence; or a second nucleotide encoding a targeting protein” wherein the first nucleotide sequence that encodes one or more RNAs that inhibit gene expression is 15-29 nucleotides in length, or 21-23 nucleotides in length.” Claim 2 of 605 anticipates instant claim(s) 1-2, 4 and 6. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Conclusion The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. PNG media_image10.png 364 596 media_image10.png Greyscale PNG media_image11.png 582 666 media_image11.png Greyscale Schmittgen et al (WO 2015/002956 A1, published 01/08/2015) teaches claim(s) 1-2, 4, and 10-13. Any inquiry concerning this communication or earlier communications from the examiner should be directed to LEXUS M TATGE whose telephone number is (571)272-0061. The examiner can normally be reached Monday-Friday: 8:30am to 5:30pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /L.M.T./ Examiner, Art Unit 1637 /Jennifer Dunston/ Supervisory Patent Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Sep 28, 2023
Application Filed
Jun 30, 2026
Non-Final Rejection mailed — §101, §102, §112 (current)

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
50%
Grant Probability
99%
With Interview (+100.0%)
3y 5m (~4m remaining)
Median Time to Grant
Low
PTA Risk
Based on 2 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month