DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Nucleotide and/or Amino Acid Sequence Disclosures
Summary of Requirements for Patent Applications Filed On Or After July 1, 2022, That Have Sequence Disclosures
37 CFR 1.831(a) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.831(b) must contain a “Sequence Listing XML”, as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.831-1.835. This “Sequence Listing XML” part of the disclosure may be submitted:
1. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter “Legal Framework”) in XML format, together with an incorporation by reference statement of the material in the XML file in a separate paragraph of the specification (an incorporation by reference paragraph) as required by 37 CFR 1.835(a)(2) or 1.835(b)(2) identifying:
a. the name of the XML file
b. the date of creation; and
c. the size of the XML file in bytes; or
2. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation by reference statement of the material in the XML format according to 37 CFR 1.52(e)(8) and 37 CFR 1.835(a)(2) or 1.835(b)(2) in a separate paragraph of the specification identifying:
a. the name of the XML file;
b. the date of creation; and
c. the size of the XML file in bytes.
SPECIFIC DEFICIENCIES AND THE REQUIRED RESPONSE TO THIS NOTICE ARE AS FOLLOWS:
Specific deficiency - Sequences appearing in the specification are not identified by sequence identifiers (i.e., “SEQ ID NO:X” or the like) in accordance with 37 CFR 1.831(c).
Required response – Applicant must provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required sequence identifiers, consisting of:
• A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
• A copy of the amended specification without markings (clean version); and
• A statement that the substitute specification contains no new matter.
Application Status
This action is written in response to applicant’s correspondence received 02/10/2026. Claims 1-4, 6, 26, 27, 29, 48, 55-57, 62, 65-67, 71 and 75-77 are currently pending. Accordingly, claims 1-4, 6, 26, 27, 29, 48, 55-57, 62, 65-67, 71 and 75-77 are examined herein. The election of species requirement mailed on 11/10/2025 is still deemed proper. Applicant's elected compound Rps6kbl_459 ("duplex no. 2") as the species of siRNA duplex for Species I and TegChol as the species of a linker and functional moiety for Species II without traverse in the reply filed on 02/10/2026.
Election/Restrictions
Applicant's election without traverse of compound Rps6kbl_459 ("duplex no. 2") as the species of siRNA duplex for Species I and TegChol as the species of a linker and functional moiety for Species II in the reply filed on 02/10/2026 is acknowledged. The election of species requirement mailed on 11/10/2025 is still deemed proper.
Priority
Applicant’s claim for the benefit of a provisional application PRO 63/412,092 filed on 09/30/2022 under 35 U.S.C. 119(e) is acknowledged.
Drawings
Color photographs and color drawings are not accepted in utility applications unless a petition filed under 37 CFR 1.84(a)(2) is granted. Any such petition must be accompanied by the appropriate fee set forth in 37 CFR 1.17(h), one set of color drawings or color photographs, as appropriate, if submitted via the USPTO patent electronic filing system or three sets of color drawings or color photographs, as appropriate, if not submitted via the via USPTO patent electronic filing system, and, unless already present, an amendment to include the following language as the first paragraph of the brief description of the drawings section of the specification:
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
Color photographs will be accepted if the conditions for accepting color drawings and black and white photographs have been satisfied. See 37 CFR 1.84(b)(2).
Specification
The disclosure is objected to because of the following informalities:
Numerous references to colors such as “red”, “green”, and “blue” are included in ¶s [0052]-[0080] and [0345]-[0371]. However, color drawings have not been accepted as discussed above. In the absence of acceptable color drawings, the description of the figures that refers to colors is unclear. Appropriate correction is required.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-4 are rejected under 35 U.S.C. 103 as being unpatentable over Frigerio (US 2007/0053910 Al, published on 03/08/2007, filed on 10/17/2003), as evidenced by NCBI (S6K1 mRNA sequences, see NCBI_2022_S6K1_transcripts.pdf attached and listed on the PTO-892 form), in view of Reynolds (Rational siRNA design for RNA interference. Nat Biotechnol. 2004 Mar;22(3):326-30), further in view of Hsieh (A library of siRNA duplexes targeting the phosphoinositide 3‐kinase pathway: determinants of gene silencing for use in cell‐based screens. Nucleic Acids Research, 32, 3, 2004, Pages 893–901), further in view of Zhao (Toward a systematic understanding of mRNA 3' untranslated regions. Proc Am Thorac Soc. 2011; 8:163-6).
Frigerio (2007) teaches “siRNA duplexes containing between 20 and 25 bps, …, of the S6K sequence” (Page 7, ¶[0069]), an embodiment of which is “an at least partially double stranded RNA comprising a nucleic acid sequence of AGUGUUUGACAUAGACCUG (SEQ ID NO:1) or AAGGGGGCUA
UGGAAAGGUUU (SEQ ID NO:2)” (Page 2, ¶[0017]), both sequences map to the human S6K1 (RPS6KB1 gene) transcript mRNA sequence (NM_003161.4 ) based on alignment using NCBI alignment tool below:
Alignment statistics for match SEQ ID NO: 1
Query 1 AGTGTTTGACATAGACCTG 19
|||||||||||||||||||
Sbjct 142 AGTGTTTGACATAGACCTG 160
Alignment statistics for match SEQ ID NO: 2
Query 1 AAGGGGGCTATGGAAAGGTTT 21
|||||||||||||||||||||
Sbjct 360 AAGGGGGCTATGGAAAGGTTT 380
The recitation of “duplexes”, “double stranded”, the limitation of 20-25 bps, and the provided sequences above that are perfectly mapped to the S6K1 mRNA sequence confirm that the siRNA compound above comprises a sense strand and an antisense strand, each comprising a 5’ end and a 3’ end, wherein the antisense strand comprises a sequence substantially complementary to a S6K1 nucleic acid sequence.
Frigerio does not teach that the antisense strand comprises a sequence substantially complementary to a S6K1 nucleic acid sequence of any one of SEQ ID NOs: 1-6, as evidenced by the alignment of SEQ ID NOs: 1-6 to the human or mouse RPS6KB1/Rps6kb1 mRNA (239-283, 407-451, 1312-1356, 1966-2010, 2024-2068, 2119-2163nt of NM_003161.4 or 276-320, 444-488, 2034-2078, 2089-2133, 2185-2229, 1349-1392nt of NM_001114334.2):
Homo sapiens ribosomal protein S6 kinase B1 (RPS6KB1), mRNA
Sequence ID: NM_003161.4
Mus musculus ribosomal protein S6 kinase, polypeptide 1 Rps6kb1),
transcript variant 1, mRNA, Sequence ID: NM_001114334.2
SEQ ID NO: 1 vs NM_003161.4, Range 1: 407 to 451
Query 1 AATACTGGGAAGATATTTGCCATGAAGGTGCTTAAAAAGGCAATG 45
|||||||||||:|||||||||||||||||||||||||||||||||
Sbjct 407 AATACTGGGAAAATATTTGCCATGAAGGTGCTTAAAAAGGCAATG 451
SEQ ID NO: 1 vs NM_001114334.2, Range 1: 444 to 488
Query 1 AATACTGGGAAGATATTTGCCATGAAGGTGCTTAAAAAGGCAATG 45
|||||||||||||||||||||||||||||||||||||||||||||
Sbjct 444 AATACTGGGAAGATATTTGCCATGAAGGTGCTTAAAAAGGCAATG 488
SEQ ID NO: 2 vs NM_003161.4, Range 2: 239 to 283
Query 2 GTTGGACCATATGAACTTGGCATGGAACATTGTGAGAAATTTGAA 45
|||||||||||||||||||||||||||||||||||||||||||||
Sbjct 239 GTTGGACCATATGAACTTGGCATGGAACATTGTGAGAAATTTGAA 283
SEQ ID NO: 2 vs NM_001114334.2, Range 2: 276 to 320
Query 2 GTTGGACCATATGAACTTGGCATGGAACATTGTGAGAAATTTGAA 45
|||||||||||||||||||||||||||||||||||||||||||||
Sbjct 276 GTTGGACCATATGAACTTGGCATGGAACATTGTGAGAAATTTGAA 320
SEQ ID NO: 3 vs NM_003161.4, Range 3: 2024 to 2068
Query 3 TTGCCTGTAATACTTGCAACTAAGGACAAATTAGCATGCAAGCTT 45
||||||:||||||||||||||||||||||||||||||||||||||
Sbjct 2024 TTGCCTATAATACTTGCAACTAAGGACAAATTAGCATGCAAGCTT 2068
SEQ ID NO: 3 vs NM_001114334.2, Range 3: 2089 to 2133
Query 3 TTGCCTGTAATACTTGCAACTAAGGACAAATTAGCATGCAAGCTT 45
|||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2089 TTGCCTGTAATACTTGCAACTAAGGACAAATTAGCATGCAAGCTT 2133
SEQ ID NO: 4 vs NM_003161.4, Range 4: 2119 to 2163
Query 4 ATTGATGTTTTACGTGCAAACAACCTGAATCttttttttATATAA 45
|||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2119 ATTGATGTTTTACGTGCAAACAACCTGAATCTTTTTTTTATATAA 2163
SEQ ID NO: 4 vs NM_001114334.2, Range 4: 2185 to 2229
Query 4 ATTGATGTTTTACGTGCAAACAACCTGAATCttttttttATATAA 45
|||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2185 ATTGATGTTTTACGTGCAAACAACCTGAATCTTTTTTTTATATAA 2229
SEQ ID NO: 5 vs NM_003161.4, Range 5: 1312 to 1356
Query 5 ATCTGTACTTGAAAGTGTGAAAGAAAAGTTTTCATTTGAACCAAA 45
|||||||||||||||||||||||||||||||||:|||||||||||
Sbjct 1312 ATCTGTACTTGAAAGTGTGAAAGAAAAGTTTTCCTTTGAACCAAA 1356
SEQ ID NO: 5 vs NM_001114334.2, Range 5: 1349 to 1392
Query 5 ATCTGTACTTGAAAGTGTGAAAGAAAAGTTTTCATTTGAACCAA 44
||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1349 ATCTGTACTTGAAAGTGTGAAAGAAAAGTTTTCATTTGAACCAA 1392
SEQ ID NO: 6 vs NM_003161.4, Range 6: 1966 to 2010
Query 6 CCGTTGAAATCTGATGATGTCAAATAAGGGTTATCCTAATAGGCA
|:|||||::||||||::|||::||:||||||||||||:::|::::
SBJCT 1966 CTGTTGAGTTCTGATTGTGTTGAAGAAGGGTTATCCTTTCATTAG 2010
SEQ ID NO: 6 vs NM_001114334.2, Range 6: 2034 to 2078
Query 6 CCGTTGAAATCTGATGATGTCAAATAAGGGTTATCCTAATAGGCA 45
|||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2034 CCGTTGAAATCTGATGATGTCAAATAAGGGTTATCCTAATAGGCA 2078
However, Reynolds (2004) teaches a rational systematic siRNA design strategy by targeting every other position along the target mRNA sequence (Page 326, Abstract, lines 11-12; First ¶, lines 2-3). Applying such a systematic approach requires no specialized knowledge about how to design siRNA duplexes, aside from knowing the target mRNA sequence. For a mRNA target sequence encoding RPS6KB1 or Rps6kb1, e.g. NM_003161.4 or NM_001114334.2, this design approach would have yielded 4666 siRNA antisense sequence designs with 100% complementarity to the target mRNA CDS region by targeting every other nucleotide position, or 9339 siRNA antisense sequence designs with 100% complementarity by targeting every nucleotide position along the 1578nt CDS mRNA regions (e.g. NM_003161.4, 65-1642nt, i.e. 1578nt; or NM_001114334.2, 102-1679nt, i.e. 1578nt) for either human or mouse RPS6KB1/Rps6kb1 mRNA to ensure complete coverage, as evidenced by NCBI (2022; See attached NCBI_2022_S6K1_transcripts.pdf attached and listed in the PTO-892 form). These siRNA duplex antisense sequence designs are based on the 20-25nt length taught by Frigerio (2007; Page 7, ¶[0069]). Since these siRNA designs cover the entire length of the CDS region of the RPS6KB1/Rps6kb1 mRNA, at least some embodiments would have comprised S6K1 sequences of SEQ ID NOs: 1, 2, 5 mappable to the human or mouse RPS6KB1/Rps6kb1 mRNA (239-283, 407-451, 1312-1356nt of NM_003161.4 or 276-320, 444-488, 1349-1392nt of NM_001114334.2), as detailed above in the alignments section because SEQ ID NOs: 1-6 are each 45nt long, and each supports 141 (21+22+23+24+25) 20-25nt siRNA antisense strand designs covering each region.
Additional siRNA antisense designs that bind to the 3’UTR regions of the target mRNAs are also feasible options for persons having ordinary skill in the art (PHOSITAs), in view of Hsieh (2004) and Zhao (2011). Hsieh (2004) teaches that “silencing by duplexes targeting the 3’ UTR was comparable with duplexes targeting the coding sequence” (Page 893, Abstract, lines 13-15). Zhao (2011) teaches that “The 3’ UTR begins at the stop codon” (i.e. TAA, TGA, TAG) and ends with “Polyadenylation signals (typically AAUAAA or a similar sequence)” (Page 163, left column, last ¶, lines 1-2). Zhao also teaches that “Most human genes have more than one polyadenylation signal, and usage of alternative polyadenylation sites is one source of variability in 3’ UTR length” (Page 163, left column, last 3 lines). These teachings indicate that the 3’ UTR for NM_003161.4 could be from 1643-1750nt (see attached NCBI_2022_S6K1_transcripts.pdf) before the polyadenylation site ATTACA at 1751-1756nt, but also could encompass 1643-3112nt followed by “AATAAA” polyadenylation signal. PHOSITAs would have chosen to include these 3’ UTR regions to design siRNAs, which would have included siRNA antisense strand designs with at least some embodiments showing substantial complementarity to the SEQ ID NOs: 3, 4, 6 regions of the mouse RPS6KB1/Rps6kb1 mRNA (1966-2010, 2024-2068, 2119-2163nt of NM_003161.4 or 2034-2078, 2089-2133, 2185-2229nt of NM_001114334.2). Although the wider selection of the target regions are, the greater the number of siRNA antisense strand sequences would need to be evaluated. Reynolds further teaches that intermittent tiling (e.g. every other nucleotide) of the siRNA sequence designs significantly reduces the number of sequence design candidates for evaluation yet maintain reasonable expectation of success in siRNA silencing of the target mRNA with more than 60% of knockdown efficiency (Page 328, Fig. 2j). Also, Hsieh (2004; full citation above) further teaches a high-throughput, cell-based siRNA screening strategy that uses 96 well plates to efficiently identify potent siRNA duplex designs using limited resources and time (Page 900, Figure 6). The combination of Reynolds, Hsieh, and Zhao would have dramatically reduced the number of siRNA antisense sequence candidates needed to validate for a screen-based approach. For example, the original estimate of 9339 siRNA antisense sequence designs with 100% complementarity by targeting every nucleotide position along the 1578nt CDS mRNA regions can be reduced to 467 sequence designs with 100% complementarity by targeting every 20th nucleotide position along the 1578nt CDS mRNA regions, and it would only take a single experiment of siRNA knockdown using 15x 96 well plates with triplicate wells for each siRNA duplex design, and there would have still been at least 2 designs at minimum with 100% complementarity to a section of each of the 45nt SEQ ID NOs: 1, 2, 5 regions. This can be doubled additionally to cover a 1470nt 3’ UTR (1643-3112nt of the NM_003161.4 mRNA for example), and there would have been at least 2 siRNA antisense strand designs (20-25nt) with 100% complementarity to a section of each of the 45nt SEQ ID NOs: 1-6 with reasonable expectation of success.
It would have been obvious for PHOSITAs, motivated by the prospect of reversing pathogenesis due to over-active S6K1 expression in the target biological system using the most effective siRNA duplexes, also to avoid infringing on the claims of Frigerio, to have modified the siRNA duplexes of Frigerio by incorporating the teachings and strategies of Reynolds, in view of Hsieh, further in view of Zhao and would have systematically and strategically designed and tested a limited number of siRNA duplexes targeting the S6K1 mRNA CDS and/or the 3’ UTR regions, i.e. known, finite number of potential solutions to resolve an known problem, and would have covered the regions defined by SEQ ID NOs: 1-6, and would have arrived at the claimed siRNA sequences with a “obvious to try” rationale.
Regarding claim 1, the combination of Frigerio (2007), NCBI (2022), Reynolds (2004), Hsieh (2004), and Zhao (2011) teaches siRNA duplexes comprising a sense and an antisense strand, each with a 5” end and a 3’ end, with the antisense strand comprising substantial complementarity to a S6K1 nucleic acid of SEQ ID NOs: 1-6, with at least some antisense strand embodiments comprising 100% perfect complementarily to enable target-specific silencing of an S6K1 mRNA. The recitation “wherein the substantially complementary sequence comprises sufficient complementarity to the S6K1 nucleic acid sequence …” encompasses 100% complementarity to the desired regions of the target mRNA sequence.
Regarding claim 2, since SEQ ID NOs: 7-12 are fragments of SEQ ID NOs: 1-6, see alignments below, the teachings of Frigerio (2007), NCBI (2022), Reynolds (2004), Hsieh (2004), and Zhao (2011) discussed above also apply and PHOSITAs would have arrived at siRNA duplexes with 100% complementarity to SEQ ID NOs: 7-12 with at least some embodiments of the designs based on an obvious-to-try rationale, although a more rigorous tiling strategy designing siRNA starting from every nucleotide of the reference mRNA sequence of both the CDS and 3’ UTR regions is necessary. However, the high throughput screening strategies of Hsieh (2004) still provides reasonable expectation of success in identifying siRNA antisense sequences with 100% complementarity to SEQ ID NOs: 7-12.
Query 1 TTTGCCATGAAGGTGCTTAA 20 SEQ ID NO: 7
||||||||||||||||||||
Sbjct 16 TTTGCCATGAAGGTGCTTAA 35 SEQ ID NO: 1
Query 1 CTTGGCATGGAACATTGTGA 20 SEQ ID NO: 8
||||||||||||||||||||
Sbjct 16 CTTGGCATGGAACATTGTGA 35 SEQ ID NO: 2
Query 1 GCAACTAAGGACAAATTAGC 20 SEQ ID NO: 9
||||||||||||||||||||
Sbjct 16 GCAACTAAGGACAAATTAGC 35 SEQ ID NO: 3
Query 1 GCAAACAACCTGAATCTTTT 20 SEQ ID NO: 10
||||||||||||||||||||
Sbjct 16 GCAAACAACCTGAATCTTTT 35 SEQ ID NO: 4
Query 1 TGTGAAAGAAAAGTTTTCAT 20 SEQ ID NO: 11
||||||||||||||||||||
Sbjct 16 TGTGAAAGAAAAGTTTTCAT 35 SEQ ID NO: 5
Query 1 GATGTCAAATAAGGGTTATC 20 SEQ ID NO: 12
||||||||||||||||||||
Sbjct 16 GATGTCAAATAAGGGTTATC 35 SEQ ID NO: 6
Regarding claim 3, siRNA sequence designs with antisense strand of 20-25nt with 100% complementarity to SEQ ID NOs: 1-6, as taught by the obvious-to-try rationale of combined teachings of Frigerio (2007), NCBI (2022), Reynolds (2004), Hsieh (2004), and Zhao (2011) would have made it obvious that these siRNA sequence designs would have been comprising complementarity to at least 10, 11, 12, or 13 contiguous nucleotides of the S6K1 nucleic acid sequence of any one of SEQ ID NOs: 1-6.
Regarding claim 4, the siRNA sequence designs based on the combined teachings of Frigerio, NCBI, Reynolds, Hsieh, and Zhao would have been comprising no more than 3 mismatches with the S6K1 nucleic acid sequence of any one of SEQ ID NOs: 1-6. At least some embodiments would have been designed to comprise 100% complementarity to the target sequences of SEQ ID NOs: 1-6.
Claims 1-4 are rejected under 35 U.S.C. 103 as being unpatentable as being unpatentable over Frigerio (2007), as evidenced by NCBI (NCBI_2022_S6K1_transcripts.pdf, see PTO-892 form), in view of Reynolds (2004), Hsieh (2004), Zhao (2011), and further in view of Carthew (Origins and Mechanisms of miRNAs and siRNAs. Cell. 2009 Feb 20;136(4):642-55) and Bentwich (US 7.687,616 B1; PD 2010-03-30; FD 2004-05-17). Full citations of Frigerio (2007), NCBI (2022), Reynolds (2004), Hsieh (2004), and Zhao (2011) see above in ¶[12] of this office action.
The teachings of Frigerio, NCBI, Reynolds, Hsieh, and Zhao have been discussed above. To further support the obviousness of the ability of PHOSITAs to arrive at the claimed inventions based on the above prior art teachings before the effective filing date of the instant application, Bentwich (PD 2010) teaches a collection of curated bioinformatically predicted “Genome Address Messenger (GAM) oligonucleotides”, which are encoded by human genome and are analyzed based on the biogenesis of microRNAs known in the art and are identified as microRNA-like molecules with high potential for targeted mRNA degradation based on the predicted mRNA binding sites (Column 1, last 2 ¶; Figures 8, 28). Given that microRNA and siRNA, although involving distinct pathways, do share the common technical requirement of must being able to bind to an accessible portion of the target mRNA as an antisense molecule, a predicted microRNA binding site would be a strong candidate for an siRNA for binding the target mRNA in view of the relatedness and similarities of how both types of small oligonucleotides suppress gene expression in view of Carthew (2009). Carthew teaches that “Dicers, Agos, and 21–23 nt duplex-derived RNAs—became recognized as the signature components of RNA silencing” (Page 643, left column, 3rd ¶). Especially, when Bentwich’s model for prediction can encompass siRNA processing from long, perfectly complementary double stranded RNAs (FIG. 8, 28). The instant SEQ ID NO: 10, a 20nt target sequence comprised within the 45nt target sequence of SEQ ID NO: 4 of the instant application, is one of those exactly predicted binding sites in the 3’UTR of human S6K1 mRNA (NM_003161.4) in Bentwich’s disclosure (Table 6) where it is listed as SEQ ID NO: 716324 (US-10-709-577B-716324) or SEQ ID NO: 6228292 (US-10-709-577B-6228292). See alignments below:
Query Instant SEQ ID NO: 10. 1 GCAAACAACCTGAATCTTTT 20
||||||||||||||||||||
Sbjct Bentwich SEQ ID NO: 716324. 1 GCAAACAACCTGAATCTTTT 20
||||||||||||||||||||
Sbjct Bentwich SEQ ID NO: 6228292. 1 GCAAACAACCTGAATCTTTT 20
It would have been obvious for PHOSITAs before the effective filing date to have integrated the teachings from Bentwich in the prediction strategy discussed above with strong motivation to prioritize those predicted binding site sequences within the length range of 20-25nt, taught by Frigerio to strengthen the reasonable expectation for success using the screening-based strategies taught by Reynolds (2004), Hsieh (2004), and Zhao (2011), thereby reducing the screening burden and increasing the siRNA antisense strand design efficiency using known methods with finite number of known solutions to address the challenge of a known problem with improved “obvious to try” rationale with reasonable expectation for success.
Regarding claim 1, the combined teachings of Frigerio, NCBI, Reynolds, Hsieh, Zhao, Carthew, and Bentwich would have led to the claimed invention with a finite number of candidates with reasonable expectation of success in identifying the claimed siRNA antisense strand designs.
Regarding claim 2, Bentwich’s teachings of predicted inhibitory oligonucleotide binding sites targeting the S6K1 transcript ensures that at least some embodiments show 100% complementarity to the target sequences of SEQ ID NO: 7-12.
Regarding claim 3, siRNA sequence designs with antisense strand of 20-25nt with 100% complementarity to SEQ ID NOs: 1-6, as taught by the obvious-to-try rationale of combined teachings of Frigerio (2007), NCBI (2022), Reynolds (2004), Hsieh (2004), Zhao (2011), Bentwich (2010) and Carthew (2009) would have made it obvious that these siRNA sequence designs would have been comprising complementarity to at least 10, 11, 12, or 13 contiguous nucleotides of the S6K1 nucleic acid sequence of any one of SEQ ID NOs: 1-6.
Regarding claim 4, the siRNA sequence designs based on the combined teachings of Frigerio, NCBI, Reynolds, Hsieh, and Zhao would have been comprising no more than 3 mismatches with the S6K1 nucleic acid sequence of any one of SEQ ID NOs: 1-6. At least some embodiments would have been designed to comprise 100% complementarity to the target sequences of SEQ ID NOs: 1-6.
Claims 6, 26, 27, 29, 48, 55-57, 62, 65 are rejected under 35 U.S.C. 103 as being unpatentable over Frigerio (2007), as evidenced by NCBI (S6K1 mRNA sequences, see PTO-892 form), in view of Reynolds (2004), Hsieh (2004), Zhao (2011), and further in view of Khvorova’22 (US 20220042015 A1, PD 2022-02-10, FD 2021-07-16), Khvorova’09 (US 20090209626 A1, PD 2009-08-20, FD 2009-02-10), and Foster (Advanced siRNA Designs Further Improve In Vivo Performance of GalNAc-siRNA Conjugates. Mol Ther. 2018 Mar 7;26(3):708-717).
The teachings of Frigerio (2007), NCBI (2022), Reynolds (2004), Hsieh (2004), and Zhao (2011) have been discussed above. None of Frigerio, NCBI, Reynolds, Hsieh, or Zhao teaches detailed design elements such as a blunt end and an overhang, i.e. asymmetric designs, double stranded region, length parameters, mismatch between the sense and the antisense strands, chemical modifications to the nucleotides or internucleotide linkages, or functional moieties.
However, Khvorova’22 teaches siRNA duplex designs with one blunt end and one 3’ overhang, various chemical modifications, the antisense strand and/or the sense strand comprise about 15 nucleotides to about 25 nucleotides in length; the siRNA comprises a double-stranded region of 15 base pairs to 20 base pairs; the siRNA comprises at least one blunt-end; the siRNA comprises least one single stranded nucleotide overhang (Figures 1-11); and the conjugation of functional moieties (Figure 6A, 7A). Khvorova’09 teaches siRNA duplex designs with one or more mismatches to overcome negative impacts of chemical modifications of the sense strand (Page 10, ¶[0095]; Figure 1A). Neither Khvorova’22, nor any of Frigerio, NCBI, Reynolds, Hsieh, Zhao, or Khvorova’09 specifically teaches the chemical modification schemes for each nucleotide along the sense and antisense strands of the siRNAs.
However, Foster (2018) teaches detailed analysis and design considerations for Enhanced Stabilization Chemistry (Page 708, Abstract) detailed below.
It would have been obvious for PHOSITAs to combine the teachings, strategies, and motivations of Frigerio, NCBI, Reynolds, Hsieh, and Zhao with those of Khvorova’22, Khvorova’09, and Foster (2018) to have modified the siRNA duplex designs with the optimal chemical modification schemes, functional moiety conjugations, and structural improvements to achieve stable, highly effective, and minimal off-targeting using the identified S6K1 siRNA candidates to achieve the desired biomedical impact in patients in need and therefore arrive at the claimed inventions.
Regarding claim 6, Khvorova’22 further teaches that the antisense strand and/or the sense strand comprises about 15 nucleotides to about 25 nucleotides in length (embodiments in Figures 1-11); the siRNA comprises a double-stranded region of 15 base pairs to 20 base pairs (Figures 1-11); the siRNA comprises one blunt-end and one single stranded nucleotide overhang (embodiments in Figures 1-11); Frigerio further teaches that the claimed S6K1 siRNA antisense sequences (SEQ ID NOs: 1 & 2) comprise naturally occurring A, C, G, T nucleotides (ST.26 standards requires T to represent U in RNA sequences).
Regarding claim 26, Khvorova’22 further teaches that the siRNA comprises at least one modified nucleotide (Figure 1); the siRNA comprises at least one modified internucleotide linkage (Figure 1, Backbone modifications); and Khvorova’09 further teaches that the sense strand comprises one or more nucleotide mismatches between the antisense strand and the sense strand (Figure 1); and/or a functional moiety is linked to the 5' end and/or the 3' end of the antisense strand and/or the sense strand (Page 2, ¶[0021]).
Regarding claim 27, Khvorova’22 further teaches 2'-O-methyl modified nucleotide, a 2'-deoxy-, or a 2'-fluoro modified nucleotide (Figure 1).
Regarding claim 29, Khvorova’22 further teaches at least one modified internucleotide linkage, such as a phosphorothioate or phosphodiester linkage (Figure 1).
Regarding claim 48, Khvorova’22 further teaches that the functional moiety is linked to the 5' end and/or the 3' end of the antisense strand and/or the sense strand, and wherein the functional moiety comprises a hydrophobic moiety, such as a steroid, i.e. cholesterol derivative (Page 1, ¶[0005]).
Regarding claim 55, Khvorova’22 further teaches that the functional moiety is linked to the 5' end and/or the 3' end of the antisense strand and/or the sense strand via a linker (Page 1, ¶[0005]).
Regarding claim 56, Khvorova’22 further teaches that the functional moiety is linked to the 5' end and/or the 3' end of the antisense strand and/or the sense strand via a divalent or trivalent linker (Page 2, ¶[0023]).
PNG
media_image1.png
731
480
media_image1.png
Greyscale
Regarding claim 57, Khvorova’22 further teaches that the divalent or trivalent linker is selected from the group consisting of (linkers on the right, on page 2, ¶[0024], the instant claim 57 is below), these structures are identical:
PNG
media_image2.png
483
986
media_image2.png
Greyscale
Regarding claim 62, Frigerio further teaches a pharmaceutical composition for inhibiting S6K1 expression in an organism, comprising pharmaceutically acceptable carrier (Page 8, ¶[0081] and [0087]).
Regarding claim 65, Frigerio further teaches a method of reducing adipocyte size using an S6 kinase modulator that encompasses siRNAs targeting S6K1 (Claims 12, 13, 17). Since time is required to observe or record any change along the temporal or spatial dimensions and maintaining cells is necessary in order to observe the impact of treatment during the required time, step (b) is inherent in any treatment intended for change. PHOSITAs would immediately recognize that the method inherently comprises step (b), which is maintaining the cell produced in step (a) for a time sufficient to obtain degradation of a mRNA transcript of the S6K1 gene. The recitation of “thereby” is intended outcome and has no patentability weight.
Regarding the elected species I, compound Rps6kbl_459 ("duplex no. 2"), which comprises a sense strand having a sequence of 5'-(mC)#(mA)#(mU)(mG)(fA)(fA)(fG)(mG)(fU)(mG)(mC)(mU)(mU)# (mA)#(mA)- TegChol-3' (SEQ ID NO: 44) as listed in Table 3 and an antisense strand having a sequence of 5'-P(mU)#(fU)#(mA)(mA)(mG)(fC)(mA)(mC)(mC)(mU)(mU)(mC)(mA)#(fU)#(mG)#(fG)#(mC)#(mA)#(mA) #(fA)-3' (SEQ ID NO: 65) as listed in Table 4, the collective teachings, strategies, and motivations of Frigerio, NCBI, Reynolds, Hsieh, Zhao, Khvorova’22, or Khvorova’09 would have led PHOSITAs to arrive at the claimed base sequences of the antisense strand design of a 20nt oligonucleotide, comprising the claimed chemical modification schemes involving each nucleotide, each internucleotide linkage, and the conjugation of the elected species II, TEG-cholesterol, based on the general structure schemes of Khvorova’22 Figure 1 (showing a lipid conjugate). Even though the exact positions of chemical modifications may slightly differ from the elected species, the base sequences of both the 20nt anti-sense strand and the 15nt sense strand can be discovered based on Reynolds’s tiling screen and Hsieh’s high-throughput screens using an “obvious to try” rationale using finite known solutions to solve known problems with reasonable expectation of success. The TEG-cholesterol lipid conjugate is specifically taught by Khvorova’22 (Page 2, ¶[0024]). However, none of Frigerio, NCBI, Reynolds, Hsieh, Zhao, Khvorova’22, or Khvorova’09 teaches the specific scheme of Enhanced Stabilization Chemistry for each specific nucleotide along the sense and antisense strands.
However, Foster (2018), drawn to siRNA modifications to improve in vivo performance of siRNA, teaches (§Abstract) iterative design approach to optimize the positioning of 2’-F and 2’-OMe ribosugar modifications across both strands of a double-stranded siRNA duplex. Foster teaches (§Abstract) such optimization enhances stability without compromising intrinsic RNAi activity. Foster teaches (§Results ¶3) their analysis shows certain positions in each strand are positively impacted by 2’-F relative to 2’-OMe. Foster used iterative modification changes to improve potency and duration of siRNA. Foster teaches (§Introduction ¶3) siRNA modifications must balance bulk (caused by bulky 2'-OMe mods) with activity.
Foster further teaches (§Introduction ¶4) that 2'-F and 2'-OMe modifications should be balanced within a siRNA to produce the compound(s) with best performance. Foster also teaches (§Introduction ¶4-5) siRNA comprising 2'-F are well-tolerated while 2'-OMe has better stabilizing effects but is bulkier and can reduce RNAi activity. Foster suggests (same §) refining, analyzing, and further refining siRNA to improve siRNA potency and duration. Their studies show that relatively small changes in design can have a large impact on metabolic stability, thereby affecting the in vivo performance of the siRNA conjugates, (¶2) the modification patterns on the strands have to be considered in context of each other, and (¶4) in vivo performance can be enhanced without sacrificing activity by optimizing the 2'-F/2'-OMe modification pattern, specifically by including a greater than 50% reduction in 2' F content.
The sum teachings of Foster indicate that it is routine and conventional in the art of siRNA design to change the proportion of 2'-F and 2'-OMe modifications in the strands of a siRNA to find the proportion that works best for a chosen purpose. Altogether, Foster teaches that altering the proportion of 2'-F and 2'-OMe within a siRNA was known in the art for the benefit of optimizing stability and silencing activity. Foster explicitly teaches siRNAs wherein the AS strand comprises ≥50% and ≤85% 2’-OMe mods and where in the sense strand comprises ≥80% 2’-OMe mods.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the siRNAs taught by Frigerio, NCBI, Reynolds, Hsieh, Zhao, Khvorova’22, and Khvorova’09 with Foster’s teachings about optimizing the proportion of 2’-OMe and 2’-F modification within a siRNA duplex for the benefits of optimizing efficacy and stability of the siRNA and minimizing immune response and off-target effects. One would have been motivated to do so with a reasonable expectation of success because Foster teaches altering the proportions of 2’-F and 2’-OMe nucleotides to enhance stability without comprising intrinsic RNAi activity and prior teachings.
Although Foster doesn’t explicitly show the specific permutations of Enhanced Chemical Modifications for each nucleotide, Foster’s teachings would have made it obvious to place a 2’-F or 2’-OMe modification at any position in the sense or AS strands. Furthermore, nothing in Foster teaches that placing a 2’-F at AS strand has any negative impact on silencing. Foster’s teachings indicate optimizing 2’-F and 2’-OMe composition within a siRNA duplex was routine and customary.
“Obviousness does not require absolute predictability of success.” Id. at 903, 7 USPQ2d at 1681. Hence, both elected species I and II are rejected herein.
It would have been obvious for PHOSITAs before the effective filing date to have modified the S6K1 siRNA duplexes of Frigerio, based on the collective teachings, strategies, and motivations of Frigerio, NCBI, Reynolds, Hsieh, Zhao, Khvorova’22, Khvorova’09, and Foster to have identified an improved siRNA duplex compound comprising 20nt antisense strand with 100% complementarity to the SEQ ID NO: 1 region of the target mRNA sequence, coupled with a 15nt sense strand with 100% and 15nt complementarity, with a conjugated TEG-Cholesterol moiety with a blunt end, a 3’ overhang of 5nt, and optimized nucleotide and internucleotide chemical modifications, and would have arrived at the claimed invention.
Claims 66, 67, 71, 75, 77 are rejected under 35 U.S.C. 103 as being unpatentable over Frigerio (2007), as evidenced by NCBI (S6K1 mRNA sequences, see PTO-892 form), in view of Reynolds (2004), Hsieh (2004), Zhao (2011), Khvorova’22, Khvorova’09, Foster (2018), and further in view of Naik (Small interfering RNAs based gene silencing strategies for the treatment of glaucoma: Recent advancements and future perspectives. Life Sci. 2021 Jan 1;264:118712) and Losiewicz (mTORC1 and mTORC2 expression in inner retinal neurons and glial cells. Exp Eye Res. 2020 Aug;197:108131).
The teachings of Frigerio (2007), NCBI (2022), Reynolds (2004), Hsieh (2004), Zhao (2011), Khvorova’22, Khvorova’09, and Foster (2018) have been discussed above. None of the above teaches using the S6K1 siRNA duplexes designed based on the collective teachings, strategies, and motivations to treat eye disorders.
However, Naik (2021) teaches extensive preclinical and clinical efforts to explore the potential of using siRNAs to treat a variety of eye disorders (Page 3, Table 1). Naik does not teach using S6K1 siRNAs to treat eye disorders.
However, Losiewicz (2020) teaches that the upstream regulator of S6K1, mTORC1, is highly active in diseased retinal cells, including ganglion cells, where highly active or overexpressed S6K1 can be found (Page 1, Abstract, lines 15-17), offering S6K1 as a potential therapeutic target for a series of optic neuropathies (Page 1, Abstract, last 3 lines).
It would have been obvious to PHOSITAs seeking novel therapeutics for a broad series of optic neuropathies involving mTORC1 signaling dysregulations and S6K1 hyperactivities to pursue administering the well refined siRNA duplexes based on the collective teachings, strategies, and motivations of Frigerio, NCBI, Reynolds, Hsieh, Zhao, Khvorova’22, Khvorova’09, Foster, Naik, and Losiewicz to develop RNAi therapeutics for the eye disorders as claimed, and would have arrived at the invention.
Regarding claim 66, Naik’s overview of the success and failures of existing siRNA-based eye disorder therapeutics development further offers robust guidance for executing improve development plan for S6K1 siRNA therapy for optic neuropathies.
Regarding claim 67, Naik further teaches intravitreal injection as a therapeutic delivery route (Page 5, §3.4; Page 3, Table 1, items 2, 8). The recitation of “and/or” is interpreted under the broadest reasonable interpretation that the ensuing recitation “the siRNA inhibits expression of a S6K1 gene by at least 20% or at least 50%” is not a required limitation, thereby carrying no patentability weight.
Regarding claim 71, Frigerio further teaches a vector comprising a regulatory sequence operably linked to a nucleotide sequence that encodes an siRNA comprising a sequence substantially complementary to a S6K1 nucleic acid sequence (Page 3, ¶[0031], [0032]; Page 4, ¶[0034]; Page 6, ¶[0064]; Page 7, ¶[0070], [0071]), and the modification based on the teachings of Frigerio, NCBI, Reynolds, Hsieh, Zhao, Khvorova’22, or Khvorova’09 as discussed above would have arrived at the siRNA duplexes with 100% antisense strand complementarity to SEQ ID NOs: 1-6.
Regarding claim 75, Frigerio further teaches an adipocyte as a treatment subject (Page 8, ¶[0080], last line), so at least some embodiments of Frigerio’s inventions would have taught a cell comprising the vector encoding the siRNAs of claim 1.
Regarding claim 76, Naik further teaches an AAV2 vector (Page 3, Table 1, item 9). The fact that the serotype of an AAV vector is dictated by its capsid, the AAV2 vector taught by Naik indicates that the vector comprises an AAV capsid. The combined teaching above from Frigerio, NCBI, Reynolds, Hsieh, Zhao, Khvorova’22, Khvorova’09, or Foster would have taught the S6K1 siRNA designs as claimed.
Claim 77 is rejected under 35 U.S.C. 103 as being unpatentable over Frigerio (2007), as evidenced by NCBI (S6K1 mRNA sequences, see PTO-892 form), in view of Reynolds (2004), Hsieh (2004), Zhao (2011), Khvorova’22 (US 20220042015 A1), Khvorova’09 (US 20090209626 A1), and further in view of Khvorova’21 (US 20210115442 A1, PD 2021-04-22, FD 2020-08-21).
The teachings of Frigerio (2007), NCBI (2022), Reynolds (2004), Hsieh (2004), Zhao (2011), Khvorova’22, and Khvorova’09 have been discussed above. None of Frigerio, NCBI, Reynolds, Hsieh, Zhao, Khvorova’22, or Khvorova’09 teaches branched RNA compounds.
Regarding claim 77, Khvorova’21 further teaches that a branched RNA compound comprising two or more of the siRNA of claim 1 covalently bound to one another in Figures 16-18 (Page 5, ¶[0093]).
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
U.S. Patents:
(US 9012623, US 10087441, US 11136578, US 8304530, US 8309705, US 8329892, US 9121018, US10604754, US 7595387, US 7507811, US 7511132, US 7514550, US 7576197, US 7576196, US 7579457, US 7592444, US 7595389, US 7608707, US 7642349, US 7645869, US 7655788, US 7674896, US 7691997, US 7696344, US 7745611, US 7795420, US 7803933, US 7807819, US 7820809, US 7893247, US 7985854, US 8008474, US 8030474, US 8093370, US 7498316, US 8008271, US 12252691, US 12435336, US 9879266; Hereinafter, USPATs), (US 8309704; Hereinafter, ‘704), (US 7750144; Hereinafter, ‘144).
Claims 1-4, 6, 26-27, 29, 48, 55-57, 62, 65-67 are rejected on the ground of nonstatutory double patenting as being unpatentable over all claims of USPATs, claims 20-29 of ‘704, and claims 11-13, 24-25, 28-36 of ‘144, in view of NCBI (2022), Reynolds (2004), Hsieh (2004), further in view of Zhao (2011). Although the claims at issue are not identical, they are not patentably distinct from each other. See §103 rejection above for full citations of all prior arts.
USPATs, ‘704, and ‘144 teach a general double stranded siRNA with modifications and methods of delivery and treating a disease in a subject. None of USPATs, ‘704, or ‘144 teaches the specific sequences in S6K1 targeted by the claimed siRNA duplexes.
The teachings of NCBI, Reynolds, Hsieh, and Zhao have been discussed above.
It would have been obvious for PHOSITAs, motivated by the prospect of reversing pathogenesis due to over-active S6K1 expression in the target biological system using the most effective siRNA duplexes, to have modified the siRNA duplexes of USPATs, ‘704, or ‘144 by incorporating the teachings and strategies NCBI (2022), in view of Reynolds (2004) and Hsieh (2004), and further in view of Zhao (2011; all full citations see above in §103 rejection section), and would have systematically and strategically designed and tested a limited number of siRNA duplexes targeting the S6K1 mRNA CDS and/or the 3’ UTR regions, i.e. known, finite number of potential solutions to resolve an known problem, and would have covered the regions defined by SEQ ID NOs: 1-6, with at least some antisense strand embodiments comprising 100% perfect complementarily to enable target-specific silencing of an S6K1 mRNA, and would have arrived at the claimed siRNA sequences with a “obvious to try” rationale.
US Application 17/996,711
Claims 1-4, 66, 67 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 4, 6, 15, 16, 18, 20, 22 of U.S. Application 17/996,711 (Hereinafter, App’711), in view of NCBI (2022), Reynolds (2004), Hsieh (2004), further in view of Zhao (2011). Although the claims at issue are not identical, they are not patentably distinct from each other. See §103 rejection above for full citations of all prior arts.
App’711 teaches a general method of treating drusen formation in the ocular tissue, method of inhibiting drusen formation in an ocular tissue in a subject who is in drusen stage, the method comprising administering to cells of the ocular tissue one or more inhibitors of Ribosomal protein S6K1, wherein the one or more inhibitors of S6K1 comprises an inhibitory nucleic acid that binds to a nucleic acid encoding a S6K1 protein and reduces/prevents its expression. However, App’711 does not teach a specific siRNA sequence targeting S6K1 mRNA.
The teachings of NCBI, Reynolds, Hsieh, and Zhao have been discussed above.
It would have been obvious for PHOSITAs, motivated by the prospect of reversing pathogenesis due to over-active S6K1 expression in the target biological system using the most effective siRNA duplexes, to have modified the siRNA duplexes of App‘711 by incorporating the teachings and strategies NCBI (2022), in view of Reynolds (2004) and Hsieh (2004), and further in view of Zhao (2011; all full citations see above in §103 rejection section), and would have systematically and strategically designed and tested a limited number of siRNA duplexes targeting the S6K1 mRNA CDS and/or the 3’ UTR regions, i.e. known, finite number of potential solutions to resolve an known problem, and would have covered the regions defined by SEQ ID NOs: 1-6, with at least some antisense strand embodiments comprising 100% perfect complementarily to enable target-specific silencing of an S6K1 mRNA, and would have arrived at the claimed siRNA sequences with a “obvious to try” rationale. The recitation “wherein the substantially complementary sequence comprises sufficient complementarity to the S6K1 nucleic acid sequence …” encompasses 100% complementarity to the desired regions of the target mRNA sequence.
Claims 1, 6, 20, 22 of App’711 correspond to the instant claims 1-4, 6, 26-27, 29, 48, 55-57, 62, 65.
Claims 15 & 16 of App’711 correspond to the instant claim 66.
Claims 4 & 18 of App’711 correspond to the instant claim 67.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
US Application 18/375,206
Claims 65-67 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 2, 5, 34, 43, 54, 55, 77 of U.S. Application 18/375,206 (Hereinafter, App’206), in view of Naik (2021). Although the claims at issue are not identical, they are not patentably distinct from each other.
App’206 teaches a general method for delivering an oligonucleotide conjugate to an eye of a subject, the method comprising administering the oligonucleotide conjugate to the subject. Claims 1, 5, 34, 43, 54, 55, and 77 of App’206 teach siRNAs with double strands, each with a 5’ end and a 3’ end, comprising functional moieties, chemical modifications, such as 2’-Ome, and the functional moieties can be conjugated on the 5’, 3’ ends. Some embodiments of the inhibitory oligonucleotides are siRNAs. The method focuses on delivery to the eye of a subject comprising an eye disease. App’206 does not teache the specific sequences in S6K1 targeted by the claimed siRNA duplexes.
The teachings of NCBI, Reynolds, Hsieh, and Zhao have been discussed above.
It would have been obvious for PHOSITAs, motivated by the prospect of reversing pathogenesis due to over-active S6K1 expression in the target biological system using the most effective siRNA duplexe, to have modified the siRNA duplexes of App‘206 by incorporating the teachings and strategies NCBI (2022), in view of Reynolds (2004) and Hsieh (2004), and further in view of Zhao (2011; all full citations see above in §103 rejection section), and would have systematically and strategically designed and tested a limited number of siRNA duplexes targeting the S6K1 mRNA CDS and/or the 3’ UTR regions, i.e. known, finite number of potential solutions to resolve an known problem, and would have covered the regions defined by SEQ ID NOs: 1-6, with at least some antisense strand embodiments comprising 100% perfect complementarily to enable target-specific silencing of an S6K1 mRNA, and would have arrived at the claimed siRNA sequences with a “obvious to try” rationale.
Claims 1, 2, 5, 34, 43, 54, 55, 77 of App’206 correspond to the instant claims 65-67.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Conclusion
No claims are allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Delphinus D. Yu whose telephone number (571) 272-1576. The examiner can normally be reached Mon-Thr 7:30am to 4:30pm Fri 10am to 2pm ET.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil P Hammell can be reached on (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/DELPHINUS DOU YI YU/Examiner, Art Unit 1636
/NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636