Prosecution Insights
Last updated: October 02, 2026
Application No. 18/375,392

METHODS FOR PRODUCING SINGLE INSECT CELL CLONES

Final Rejection §103§112
Filed
Sep 29, 2023
Priority
Apr 02, 2021 — EU 21166830.6 +1 more
Examiner
POPA, ILEANA
Art Unit
1633
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
UNIQURE BIOPHARMA B.V.
OA Round
2 (Final)
21%
Grant Probability
At Risk
3-4
OA Rounds
1y 8m
Est. Remaining
36%
With Interview

Examiner Intelligence

Grants only 21% of cases
21%
Career Allowance Rate
181 granted / 845 resolved
-38.6% vs TC avg
Strong +15% interview lift
Without
With
+15.1%
Interview Lift
resolved cases with interview
Typical timeline
4y 8m
Avg Prosecution
54 currently pending
Career history
902
Total Applications
across all art units

Statute-Specific Performance

§101
2.3%
-37.7% vs TC avg
§103
48.6%
+8.6% vs TC avg
§102
7.6%
-32.4% vs TC avg
§112
20.7%
-19.3% vs TC avg
Black line = Tech Center average estimate • Based on career data from 845 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . 1. Claims 1, 3-7, 9-11, 14, 16, 18, 20, and 21 have been amended. Claims 1-22 are pending and under examination. 2. The objections to claims 1, 3, 4, 6, 10, 18, and 22 are withdrawn in response to the amendments filed on 07/09/2026. The rejection of claims 4 and 16 under 35 U.S.C. 112(b) is withdrawn in response to the amendment removing the embodiment within parenthesis. The rejection of claims 5, 6, and 20 under 35 U.S.C. 112(b) for reciting preferred embodiments is withdrawn in response to the amendment removing the preferred embodiments from the claims. The rejection of claim 6 under 35 U.S.C. 112(b) for reciting hr4b as both a control and the hr enhancer element providing enhanced reporter gene expression is withdrawn in response limiting hr4b to the control enhancer. The rejection of claim 6 under 35 U.S.C. 112(b) for reciting “the expression cassette” is withdrawn in response amendment to clarify that the expression cassette is a reporter expression cassette. The rejection of claims 9, 11-13, and 20 under 35 U.S.C. 112(b) is withdrawn in response to the amendment correcting for the antecedent basis. The rejection of claims 5 and 9 under 35 U.S.C. 112(d) is withdrawn in response to the amendments to delete the recitations “at least one Rep 78 and 68” and “at least one Rep 52 and 40” from claim 5; and for limiting claim 9 to Rep 52 and 78. Claim Objections 3. Claim 4 is objected to because of the recitation “a baculovirus immediate early protein IE1” (lines 5-6). Correction to “the baculovirus immediate early protein IE1” is required. 4. Claim 6 should recite “the reporter expression cassette” in (a) and (b). 5. Claim 9 should recite “parvoviral Rep 52” (line 2). 6. Claim 16 should recite “the at least one single cell clone” in line 2. 7. Claim 21 is objected to because of the recitation “(a) producing a single cell clone in a method according to claim 1” (line 4). Correction to “(a) producing the single insect cell clone by the method according to claim 1” is required. Claim Rejections - 35 USC § 112(b) 8. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. 9. Claims 5, 7, 14, and 15 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claims 5, 7, and 14 directly or indirectly depend upon claim 4. Claim 4 recites “at least one baculovirus promoter”, and thus, the recitation “the first and second promoters” in the dependent claims 5, 7, and 14 makes it uncertain which of the promoters are intended, rendering the claims unclear. Claim 15 is rejected for being dependent upon the rejected claim 14 and for failing to further clarify the basis of the rejection. Claim Rejections - 35 USC § 112(d) 10. The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. 11. Claim 6 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 6 recites that “the hr enhancer element” is operably linked to a reporter expression cassette. This recitation fails to further limit the subject matter of the parent claim 4, which recite that the hr enhancer element is operably linked to a cassette coding for Rep 78 and Rep 52. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 103 12. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. 13. Claims 1-6, 9-13, and 16-22 are rejected under 35 U.S.C. 103 as being unpatentable over Bakker et al. (AU 2014201171), in view of all Mirzaei et al. (Thirteen International Conference on Miniaturized Systems for Chemistry and Life Sciences, 2009, p. 1169-1170), Yssel et al. (J. Immunol. Methods, 1984, 72: 219-227), and Olson et al. (J. Virol., 2003, 77: 5668-5677), as evidenced by Rodems et al (J. Virol., 1995, 69: 5368-5375). Bakker et al. teach genetically engineered insect cells comprising in their genome first and second expression cassettes comprising a promoter operably linked to nucleic acid sequences encoding first and second parvoviral Rep proteins. Bakker et al. teach that the first and second Rep proteins are Rep52 (or Rep40) and Rep78 (or Rep68), respectively. Bakker et al. teach that Rep52/Rep40 and Rep78/Rep68 proteins comprise a common amino acid sequence with at least 90% identity; the nucleic acid sequence encoding the common amino acid sequence of Rep52/Rep40 is codon-optimized for expression in the insect cells, and thus, has less than 90% identity with that encoding the common amino acid sequence of Rep78/Rep68, which is not codon-optimized. Bakker et al. teach that the promoter for Rep52/Rep40 is the polH promoter (i.e., very late), while that for Rep78/Rep68 is the [Symbol font/0x44]IE1 promoter. Bakker et al. teach enhancing the expression of the Rep proteins by operably linking a homologous region enhancer element (hr) to the promoters, where the hr is hr5 (claims 1, 4, 5, 9, 10) (see p. 7, lines 18-30; p. 12, line 22 through p. 13, line 31; p. 14, lines 5-11; p. 23, lines 10-25; paragraph bridging p. 26 and 27; p. 26, lines 18-30). With respect to claims 11-13, Bakker et al. teach that the mRNA encoding Rep78/Rep68 comprises a suboptimal translation initiation codon, such as CTG (see p. 17, lines 11-17; p. 24, lines 4-11; p. 32, lines 13-15). With respect to claim 20, Bakker et al. teach that the insect cells are Sf9, Sf21, BTI-TN-5Bl-4, Tn368, or High Five (see p. 14, lines 21-30). Although Bakker et al. teach enhancing Rep expression by operably linking hr5 to the promoters, Bakker et al. do not specifically teach using IE1 (claim 4). Olson et al. teach that enhanced expression requires IE1 binding to hr (see Abstract; p. 5668, column 1, first paragraph; p. 5672, column 2, last paragraph; p. 5678, Fig. 7). Based on this teaching, one of skill in the art would have found obvious to use a vector encoding IE1 to induce the expression of the Rep proteins, to achieve the predictable result of selecting the higher expressing clones. Bakker et al. and Olson et al. do not teach producing a single insect clone (claims 1-3, 21, and 22). However, doing so is suggested by the prior art. For example, Bakker et al. teach that the genetically engineered insect cells are useful for the production of parvoviral vectors used in gene therapy and that improved expression of the Rep proteins leads to increased productivity of parvoviral vectors (see Abstract). Mirzaei et al. teach that the isolation of single productive cells is widely used in biotechnology to identify and expand the highly productive cells; cloning takes place by seeding the cells in multiple wells at a range between zero and three cells/well, with an average of one cell/well (see Abstract; paragraph bridging p. 1169 and 1170). While Mirzaei et al. teach insect cells genetically engineered to produce IL-7 and not parvoviral vectors for gene therapy, one of skill in the art would have reasonably concluded that the teachings in Mirzaei et al. could be extrapolated to other genetically engineered cells. One of skill in the art would have found obvious to modify Bakker et al. by isolating single cell clones, to achieve the predictable result of obtaining single cells to be tested for parvoviral vector production. While Mirzaei et al. do not teach seeding at a density of less than one cell/well, Yssel et al. teach cloning by limiting dilution via seeding at a density of 0.5 cells/well (see p. 221, first paragraph). One of skill in the art would have found obvious to use serial dilution to identify the limiting dilution resulting in seeding 0.5 cells/well cloning and use the identified limiting dilution to seed 0.5 cells/well, with the reasonable expectation that doing so would maximize the probability that the wells contain colonies originated from a single cell. One of skill in the art would have also found obvious to inspect the wells under a microscope to identify the well containing a single cell, obtain a clonal colony, take a cell sample, and further use IE1 to induce the expression of the Rep proteins in the cell sample, to achieve the predictable result of identifying the highly productive clonal cells (claims 1-3, 21, and 22). Thus, Rep expression is induced after obtaining the clones, i.e., after step (c) recited in claim 1. With respect to claim 16, Olson et al. teach introducing IE1 into cells by using a plasmid (see p. 5674, Fig. 7). Thus, using a plasmid encoding IE1 would have been obvious to one of skill in the art to achieve the predictable result of inducing the expression of the Rep proteins. With respect to claim 17, Bakker et al. teach using baculovirus to obtain genetically engineered insect cells (see p. 13, lines 23-27; p. 14, lines 9-11). Thus, replacing the plasmid with a baculovirus would have been obvious to one of skill in the art to achieve the predictable result of inducing the expression of the Rep proteins. With respect to claims 18 and 19, Bakker et al. teach introducing into the cells a construct encoding a parvoviral capsid and a construct comprising a transgene such as a reporter transgene flanked by parvoviral ITRs (see p. 7, lines 7-12; p. 14, line 31 through p. 15, line 30; p. 16; p. 17, lines 20-28; paragraph bridging p. 17 and 18; p. 18, lines 11-16; p. 19, lines 5-14). Using baculoviruses to introduce simultaneously these constructs together the baculovirus encoding IE1 would have been obvious to one of skill in the art to achieve the predictable result of obtaining parvoviruses. With respect to claim 6, further obtaining an expression cassette by operably linking the reporter transgene to hr5-polH promoter to achieve the predictable result of enhancing its expression. This expression cassette would necessarily meet clauses (a) and (b) in claim 6 because all that is to operably link hr5 to the promoter. The specification does not teach more than this. With respect to SEQ ID NO: 1 recited in claim 6, as evidenced by Rodems et al., hr5 comprises CTTTACGAGTAGAATTCTACGCGTAAAA (see p. 5369, Fig. 1) With respect to claim 21, one of skill in the art would have found obvious to expand the colony and distribute the expanded cells into vials for storing, to achieve the predictable result of creating a bank of highly producing clonal cells. Thus, the claimed invention was prima facie obvious at the time of its effective filing date. 14. Claims 1-13, and 16-22 are rejected under 35 U.S.C. 103 as being unpatentable over Bakker et al. taken with all Mirzaei et al., Yssel et al., and Olson et al., as evidenced by Rodems et al., in further view of Dong et al. (Antiviral Res., 2016, 130: 50-57). The teachings of Bakker et al., Mirzaei et al., Yssel et al., and Olson et al. are applied as above for claims 1-6, 9-13, and 16-22. Bakker et al., Mirzaei et al., Yssel et al., and Olson et al. do not teach the 39K promoter (claims 7 and 8). However, it is noted that there is no evidence of record indicting that using the 39K promoter to express Rep78/Rep68 leads to unexpected results over the [Symbol font/0x44]IE1 promoter. Furthermore, Dong et al. teach that the IE1 promoter can be replaced with the 39K promoter for inducible expression regulated by the IE1 protein (see p. 51, column 1, last paragraph; p. 55). Thus, replacing the [Symbol font/0x44]IE1 promoter with the 39K promoter would have been obvious to one of skill in the art to achieve the predictable result of obtaining genetically engineered insect cells suitable for producing parvoviral vectors for gene therapy. Thus, the claimed invention was prima facie obvious at the time of its effective filing date. 15. Claims 1-6 and 9-22 are rejected under 35 U.S.C. 103 as being unpatentable over Bakker et al. taken with all Mirzaei et al., Yssel et al., and Olson et al., as evidenced by Rodems et al., in further view of Guarino et al. (J. Virol., 1986, 60: 215-223). The teachings of Bakker et al., Mirzaei et al., Yssel et al., and Olson et al. are applied as above for claims 1-6, 9-13, and 16-22. With respect to claims 14 and 15, Bakker et al. teach that the baculovirus vector used for genome insertion comprises the polH and [Symbol font/0x44]IE1 promoters in opposite direction, i.e., the two cassettes are inserted into the genome of the insect cell in opposite direction (see Fig. 2). Since Bakker et al. teach that h5 is operably linked to both promoters (see above), one of skill in the art would have reasonably concluded that hr5 is inserted in between the polH and [Symbol font/0x44]IE1 promoters. Conversely, Guarino et al. teach the hr5 is orientation independent (see Abstract). One of skill in the art would have found obvious to operably link hr5 to both polH and [Symbol font/0x44]IE1 promoters by inserting it in between the two promoters to achieve the predictable result of enhancing the expression of the Rep proteins. Since Bakker et al. teach at least one enhancer element (see paragraph bridging p. 26 and 27), one of skill in the art would have found obvious to add an additional baculovirus enhancer between the polH and [Symbol font/0x44]IE1 promoters to achieve the predictable result of enhancing the expression of the Rep proteins. Thus, the claimed invention was prima facie obvious at the time of its effective filing date. Response to Arguments 16. 35 U.S.C. 112(b) The arguments have been considered but not found persuasive. Making claims 7 and 14 dependent upon claim 5 is not enough to obviate the rejection because all depend upon claim 4. Since claim 4 recites “at least one baculovirus promoter”, it is uncertain which of the promoters are intended in claim 5, 7, and 14. 35 U.S.C. 112(d) The arguments have been considered but not found persuasive. Claim 4 recites “a baculovirus homologous region (hr) enhancer element” linked to a cassette coding for Rep 78 and Rep 52. The recitation of “the hr enhancer element” in the dependent claim 6 refers to the hr enhancer element in claim 4. Claim 6 is not further limiting because it recites that the hr enhancer element of claim 4 is linked to a reporter expression cassette, and not to the cassette coding for Rep 78 and Rep 52, as required by claim 4. 35 U.S.C. 103 The applicant argues that the rejection does not identify the requirement of step (c) that growth is conducted under conditions which do not induce the expression of the Rep proteins. This is not found persuasive. The specification defines the non-inducing conditions as lack of IE1, while the inducing conditions are conditions where IE1 is present (see p. 21, lines 20-23). The passage from the rejection referred to by the applicant clearly states that the expression of the Rep proteins is induced with IE1 after obtaining the clones. This means after step (c) of claim 1. For these reasons, the argument that the rejection may be understood to treat the non-inducing conditions as inherently present is not found persuasive. The rejection does not state inherency and provides no basis for this conclusion. Conclusion 17. THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ILEANA POPA whose telephone number is (571)272-5546. The examiner can normally be reached 8:00 am to 4:30 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher Babic can be reached at 571-272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ILEANA POPA/Primary Examiner, Art Unit 1633
Read full office action

Prosecution Timeline

Sep 29, 2023
Application Filed
Apr 09, 2026
Non-Final Rejection mailed — §103, §112
Jul 09, 2026
Response Filed
Sep 14, 2026
Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12702716
MONOCYTE-SPECIFIC APTAMERS AND USES THEREOF FOR DELIVERING THERAPEUTIC AGENTS TO HEART
3y 8m to grant Granted Aug 11, 2026
Patent 12685785
POLYNUCLEOTIDES ENCODING PROPIONYL-COA CARBOXYLASE ALPHA AND BETA SUBUNITS FOR THE TREATMENT OF PROPIONIC ACIDEMIA
3y 1m to grant Granted Jul 21, 2026
Patent 12678515
LIPIDS AND LIPID NANOPARTICLE FORMULATIONS FOR DELIVERY OF NUCLEIC ACIDS
8y 0m to grant Granted Jul 14, 2026
Patent 12668616
WT1 VACCINE
3y 5m to grant Granted Jun 30, 2026
Patent 12622981
IMMOLATIVE CELL-PENETRATING COMPLEXES FOR NUCLEIC ACID DELIVERY
2y 2m to grant Granted May 12, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
21%
Grant Probability
36%
With Interview (+15.1%)
4y 8m (~1y 8m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 845 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month