DETAILED ACTION
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim(s) 1-26 are pending.
Preliminary Amendments
Applicant’s preliminary amendment filed on 02/20/2024 is acknowledged but has not been entered for the reasons stated below in the specification section.
Priority
This application repeats a substantial portion of prior Application No. 17/489,357, filed 09/29/2021, and adds disclosure not presented in the prior application. Because this application names the inventor or at least one joint inventor named in the prior application, it may constitute a continuation-in-part of the prior application. Should applicant desire to claim the benefit of the filing date of the prior application, attention is directed to 35 U.S.C. 120, 37 CFR 1.78, and MPEP § 211 et seq. The presentation of a benefit claim may result in an additional fee under 37 CFR 1.17(w)(1) or (2) being required, if the earliest filing date for which benefit is claimed under 35 U.S.C. 120, 121, 365(c), or 386(c) and 1.78(d) in the application is more than six years before the actual filing date of the application.
This application makes reference to or appears to claim subject matter disclosed in Application No. 63/531,004, filed 08/06/2023. If applicant desires to claim the benefit of a prior-filed application under 35 U.S.C. 119(e), 120, 121, 365(c) or 386(c), the instant application must contain, or be amended to contain, a specific reference to the prior-filed application in compliance with 37 CFR 1.78. If the application was filed before September 16, 2012, the specific reference must be included in the first sentence(s) of the specification following the title or in an application data sheet (ADS) in compliance with pre-AIA 37 CFR 1.76; if the application was filed on or after September 16, 2012, the specific reference must be included in an ADS in compliance with 37 CFR 1.76. For benefit claims under 35 U.S.C. 120, 121, 365(c), or 386(c), the reference must include the relationship (i.e., continuation, divisional, or continuation-in-part) of the applications.
If the instant application is a utility or plant application filed under 35 U.S.C. 111(a), the specific reference must be submitted during the pendency of the application and within the later of four months from the actual filing date of the application or sixteen months from the filing date of the prior application. If the application is a national stage application under 35 U.S.C. 371, the specific reference must be submitted during the pendency of the application and within the later of four months from the date on which the national stage commenced under 35 U.S.C. 371(b) or (f), four months from the date of the initial submission under 35 U.S.C. 371 to enter the national stage, or sixteen months from the filing date of the prior application. See 37 CFR 1.78(a)(4) for benefit claims under 35 U.S.C. 119(e) and 37 CFR 1.78(d)(3) for benefit claims under 35 U.S.C. 120, 121, 365(c), or 386(c). This time period is not extendable and a failure to submit the reference required by 35 U.S.C. 119(e) and/or 120, where applicable, within this time period is considered a waiver of any benefit of such prior application(s) under 35 U.S.C. 119(e), 120, 121, 365(c), and 386(c). A benefit claim filed after the required time period may be accepted if it is accompanied by a grantable petition to accept an unintentionally delayed benefit claim under 35 U.S.C. 119(e) (see 37 CFR 1.78(c)) or under 35 U.S.C. 120, 121, 365(c), or 386(c) (see 37 CFR 1.78(e)). The petition must be accompanied by (1) the reference required by 35 U.S.C. 120 or 119(e) and by 37 CFR 1.78 to the prior application (unless previously submitted), (2) the applicable petition fee under 37 CFR 1.17(m)(1) or (2), and (3) a statement that the entire delay between the date the benefit claim was due under 37 CFR 1.78 and the date the claim was filed was unintentional. The presentation of a benefit claim may result in an additional fee under 37 CFR 1.17(w)(1) or (2) being required, if the earliest filing date for which benefit is claimed under 35 U.S.C. 120, 121, 365(c), or 386(c) and 1.78(d) in the application is more than six years before the actual filing date of the application. The Director may require additional information where there is a question whether the delay was unintentional. The petition should be addressed to: Mail Stop Petition, Commissioner for Patents, P.O. Box 1450, Alexandria, Virginia 22313-1450.
If the reference to the prior application was previously submitted within the time period set forth in 37 CFR 1.78 but was not included in the location in the application required by the rule (e.g., if the reference was submitted in an oath or declaration or the application transmittal letter), and the information concerning the benefit claim was recognized by the Office as shown by its inclusion on the first filing receipt, the petition under 37 CFR 1.78 and the petition fee under 37 CFR 1.17(m)(1) or (2) are not required. Applicant is still required to submit the reference in compliance with 37 CFR 1.78 by filing an ADS in compliance with 37 CFR 1.76 with the reference (or, if the application was filed before September 16, 2012, by filing either an amendment to the first sentence(s) of the specification or an ADS in compliance with pre-AIA 37 CFR 1.76). See MPEP § 211.02.
All claims are given the priority date of the filing date, 10/09/2023.
Drawings
Figure 1 should be designated by a legend such as --Prior Art-- because only that which is old is illustrated. See MPEP § 608.02(g). Corrected drawings in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. The replacement sheet(s) should be labeled “Replacement Sheet” in the page header (as per 37 CFR 1.84(c)) so as not to obstruct any portion of the drawing figures. If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Applicant states in the Brief Description of the Drawings for Figure 1, “FIG. 1 depicts the step-by-step procedure of the prior Lin's PCR-IVT methodology. For RNA production, a part or whole procedure of this PCR-IVT protocol may be adopted for either single or multiple cycle amplification of a desired RNA/mRNA sequence.”, (para [0017]).
The same drawing was published as FIG 1 of US 12,590,329 B2 and US 12,570,977 B2.
Nucleotide and/or Amino Acid Sequence Disclosures
Summary of Requirements for Patent Applications Filed On Or After July 1, 2022, That Have Sequence Disclosures
37 CFR 1.831(a) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.831(b) must contain a “Sequence Listing XML”, as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.831-1.835. This “Sequence Listing XML” part of the disclosure may be submitted:
1. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter “Legal Framework”) in XML format, together with an incorporation by reference statement of the material in the XML file in a separate paragraph of the specification (an incorporation by reference paragraph) as required by 37 CFR 1.835(a)(2) or 1.835(b)(2) identifying:
a. the name of the XML file
b. the date of creation; and
c. the size of the XML file in bytes; or
2. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation by reference statement of the material in the XML format according to 37 CFR 1.52(e)(8) and 37 CFR 1.835(a)(2) or 1.835(b)(2) in a separate paragraph of the specification identifying:
a. the name of the XML file;
b. the date of creation; and
c. the size of the XML file in bytes.
SPECIFIC DEFICIENCIES AND THE REQUIRED RESPONSE TO THIS NOTICE ARE AS FOLLOWS:
Specific deficiency - The incorporation by reference paragraph required by 37 CFR 1.834(c)(1), 1.835(a)(2), or 1.835(b)(2) is missing, defective or incomplete.
Paragraph [0001.1] does not contain the correct file name, date, and byte size for the sequence listing. While the amendment filed on 02/20/2024 contains mostly correct sequence information (i.e., file name and date are correct; byte information is incorrect and should be amended to recite “. . . 168,132 bytes in size”), this amendment has not been entered for the reason stated below in the “specification” section.
Required response - Applicant must:
• Provide a substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required incorporation by reference paragraph, consisting of:
• A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
• A copy of the amended specification without markings (clean version); and
• A statement that the substitute specification contains no new matter.
Specification
Regarding the amendment filed 02/20/2024
The amendment to the specification filed 02/20/2024 has not been entered because it does not conform to 37 CFR 1.121(b) 1(i) because: (1) the directions of “. . . inserting the following new paragraph on page 1 immediately before the BACKGROUND section” is ambiguous because the “BACKGROUND SECTION” i.e., “BACKGROUND OF THE INVENTION” does not start until page 3 and there is “FIELD OF INVENTION” section prior said background section.
Minor Informalities
The disclosure is objected to because of the following informalities:
This application has a filing date on or after 07/01/2022, thus, needs to be compliant with ST.26 rules. ST.26 prohibits skipped sequences. The SEQ listing filed on 02/20/2024 contains two skipped sequences with the following SEQ ID NOs: 1 and 2. Applicant should amend the specification to replace all relevant SEQ ID NOs with the actual sequences, if those sequences are originally disclosed.
Page 28 discloses “SEQ ID NO: 1” in line 3 and “SEQ ID NO: 2” in line 15.
In paragraph [0006] line 3, there is a period missing after the citation parenthesis before a new sentence starts, e.g., “. . . Prev. 7:137-141, 2014) In prior practice, . . .”.
In paragraph [0006] line 3, “encoing” should recite “encoding”.
In paragraph [0014] line 2, there are two parentheses, e.g., “. . . mixture include (1) ) in-cell. . .”.
Appropriate correction is required.
Trademark/Tradename
The use of the following term(s), which is/are a trade name or a mark used in commerce, has been noted in this application.
JETPEI [0019], [0020];
THERMO FISHER SCIENTIFIC [0021];
SUPERSCRIPT [0021];
CELLYTIC [0023];
SOFTMAX [0023];
ODYSSEY [0023];
ALEXA FLUOR [0023];
LI-COR [0023];
TRITON [0024];
INVITROGEN [0024];
SIGMA-ALDRICH [0024];
METAMORPH [0024] (of note, the application refers to this being a Nikon product, but MetaMorph is a Molecular Devices trademark);
EXCEL [0025];
The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Objections
Claim 4 objected to because of the following informalities: the forward slash, i.e., /, between “protein-/peptide-” should be amended to a comma. An amended claim 4 could recite:
“The composition as defined in Claim 1, wherein said RNA encoded in the PLRcD template is protein-, peptide- or antibody-coding mRNA.”
Claim(s) 8-9, 11-14, 16-17, and 20 are objected to because of the following informalities: Claim 1, from which all of the above claims depend upon, introduces the phrases (a) promoter-linked RNA-coding DNA (PLRcD) template, (b) DNA-dependent RNA polymerase (DdRP) mRNA, and (c) internal ribosome entry site (IRES). The preamble for all of the dependent claim(s) recites “The composition as defined in Claim X”, thus, the above claims should be amended to recite only the acronym, instead of the full phrase, that was set forth and defined in claim 1.
Claim 18 objected to because of the following informalities: the phrases “as well as”
should be amended to recite “or”. An amended claim 18 could recite:
“The composition as defined in Claim 1, wherein said mixture composition of at least a PLRcD template and at least a DdRP mRNA is further formulated with at least a delivery agent for facilitating intracellular transfection in vitro, ex vivo or in vivo.”
Appropriate correction is required.
Claim Rejections - 35 USC § 112(b) – indefiniteness
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim(s) 1-26 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 1, the term “novel” is a relative term which renders the claim indefinite. The term “novel” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. Cambridge (Novel - Cambridge Dictionary, pages 1-2, accessed 07/16/2026) defines novel as used in medical terms as “new and original, not like anything seen before” or “used to refer to a new strain (=type) of a virus that has not been seen before” (p. 2). However, as time goes on, the novel-ness of a composition/item wears off, thus, after a given time an item can no longer be “novel”.
Claim 1 could be amended to recite:
“A composition comprising a promoter-linked RNA-coding DNA (PLRcD) template and a DNA-dependent RNA polymerase (DdRP) mRNA, wherein said PLRcD template comprises an internal ribosome entry site (IRES)-linked kozak motif (IRES-kozak) located between the promoter and the encoded RNA sequences.”
If Applicant chooses to amend claim 1 to the above recited language, it would be remedial to amend claim 18 and 21 to remove “at least” from the claim language for consistency.
Regarding claim 2, the word "may" renders the claim indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. See MPEP § 2173.05(d).
Claim(s) 7, 24, and 26 are vague and indefinite in that the metes and bounds of the phrase “wherein said RNA encoded in the PLRcD template is pharmaceutical compound or composition.”, (of claim 7); “wherein said PLRcD template is a pharmaceutical compound or composition.”, (of claim 24); and “wherein said DdRP mRNA is a pharmaceutical compound or composition.”, (of claim 26). The preamble sets forth that the invention is a “composition”, therefore by limiting a subcomponent of the composition, e.g., the RNA encoded, the whole PLRcD template, or the DdRP mRNA, to a pharmaceutical compound or composition renders the indefinite because it is unknown whether the other subcomponents are “pharmaceutical” as well.
Claim 7 could be amended to recite:
“. . .wherein said RNA encoded in the PLRcD template is capable of being used as a therapy.”
Claim 24 or 26 could be amended to recite:
“. . . wherein the composition contains a pharmaceutically acceptable excipient.”
Regarding claim 9, the word "particularly" renders the claim indefinite because it is unclear whether the limitation(s) following the word are part of the claimed invention. See MPEP § 2173.05(d).
Regarding claim 20, the sequence identifiers in line 2 and 3 refer to sequences with fewer than 10 specifically defined nucleotides or fewer than four specifically defined amino acids, also known as skipped sequences. Per ST.26 sequence compliance, skipped sequences do not contain any sequence data, thus the metes and bounds of the sequences are unclear. It would be remedial to amend the claim to remove the “SEQ ID NO: X” and add the enumerated sequence.
Accordingly, claim(s) 3-6, 8, 10-19, 21-23, and 25 are rejected for being dependent upon a rejected claim.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 1, 3-4, 6-7, 10-11, 16-21, 23-24, and 26 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Wang et al (Facilitated in vivo synthesis of ribonucleic acid and protein via T7 RNA polymerase, Analytical Biochemistry, vol 374, pages 97-104, published December 26th, 2007).
“Composition” of claim 1 is being broadly interpreted as a cell. Thus, at any given point mRNA and protein can and are occurring simultaneously.
In light of the 35 U.S.C. 112b rejections for claims 7, 24, and 26, claim 7 will be interpreted as “wherein said RNA encoded in the PLRcD template is capable of being used as a therapy.”, and claim(s) 24 and 26 will be interpreted as “wherein said composition contains a pharmaceutically acceptable excipient.”
Claims 16, 17, and 23 are product-by-process claims therefore, if a different process results in the same product, it too anticipates the product of said claim.
Wang et al teaches, “In the current study, the DNA encoding T7 RNA polymerase was stably introduced into mammalian cells, and following a transient transfection we showed that T7 promoter-containing DNA or oligonucleotide (ODN) template is transcribed in the cytoplasm.”, (p.97, col 1, para 1).
Regarding claim(s) 1, 3, 6-7, 10-11, 16-19, 23-24 and 26, Wang et al teaches, “In the current study, we showed that cell lines (e.g., HEK, HeLa, H1299) that were preestablished to carry T7 RNA polymerase could generate cytoplasmic shRNA and ribozyme when transfected with ODN templates containing a T7 promoter.”, (p. 98, col 1, para 2). Wang et al further teaches, “The DNA template can be obtained by PCR or reverse transcription (RT)–PCR using primers containing T7 promoter sequence and some essential elements such as internal ribosomal entry site (IRES), Kozak sequence, and polyA tail for the translation.”, (p.98, col 1, para 2). Wang et al teaches T7 RNA polymerase mRNA produced through the transfection of pIRES-T7POL (a template) using Superfect as a carrier into HEK, HeLa, and H1299 cells (p.98, col 1, para 4 to col 2 para 1). Moreover, Wang et al teaches incubating the oligonucleotide (ODN) template with lipofectamine 2000 solution and adding the ODN/Lipofectamine mixture to 2mL of medium and cells in 70% confluency (i.e., the cells that contain the T7 polymerase mRNA and/or protein) (p.98, col 2, para 3). Thus, the resulting mixture is one of (a) a DNA template with an IRES, Kozak, and polyA, (b) mRNA and protein of T7 RNA polymerase, (c) lipofectamine reading on delivery agent, and (d) shRNA reading on a RNA encoded capable of being used as a therapy.
Regarding claim 4, Wang et al teaches an RNA encoded protein, e.g., resistin from mouse adipocytes used in the DNA template (p. 103, col 1, para 2; and Fig 6).
Regarding claim 20, Wang et al discloses the Kozak sequence of GCCGCC (p.98, col 1, para 3).
Regarding claim 21, Wang et al teaches, “All amplicons contained T7 promoter and part of 5’ UTR-containing Kozak sequence of luciferase gene.”, (p.102, col 2, para 1). Wang et al further teaches the orientation of the IRES and Kozak, “Amplicons with two IRESs were amplified using 5’ primer of GAATTAATACGACTCACTATAGGTTGCCCGGCGG TATATGCCCGGCGGCATTCCGGTACTGTTG, where T7 promoter sequence is underlined, 9-nt IRESs are in bold letters, and -28 to -12 nt of luciferase gene is in italics.”, (p.99, col 1, para 2). Thus, the IRES is 5’ of the luciferase gene which contains the Kozak sequence.
Accordingly, claim(s) 1, 3-4, 6-7, 10-11, 16-21, 23-24, and 26 are anticipated by Wang et al.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claim 2 is rejected under 35 U.S.C. 103 as being unpatentable over Wang et al (supra) as applied to claim(s) 1, 3-4, 6-7, 10-11, 16-21, 23-24, and 26 above, and further in view of Luo et al (Engineering a Reliable and Convenient SARS-CoV-2 Replicon System for Analysis of Viral RNA Synthesis and Screening of Antiviral Inhibitors, American Society for Microbiology, vol 12, issue 1, pages 1-14, published January 19th, 2021).
“Composition” of claim 1 is being broadly interpreted as a cell. Thus, at any given point mRNA and protein are occurring simultaneously.
Wang et al does not teach mRNA of NSP7, NSP12, NSP13, NSP9/14, and/or NSP10/16 proteins, or a combination thereof.
Luo et al teaches creating a reliable and convenient SARS-CoV-2 replicon system without the needs for a biosafety level III laboratory to study viral RNA synthesis and drug development (p. 9 paragraph 1 of the discussion to p.10).
Regarding claim 3, Luo et al teaches that to simulate RNA replication and transcription of SARS-Cov-2, a SARS-Cov-2 replicon backbone carrying reporter genes was first constructed, however because nsp1 to nsp16 genes are quite large, they were separated into three constructs “ps2AN expressing Nsp1 to Nsp4, the ps2AC expressing Nsp5 to Nsp11, and the ps2B expressing Nsp12 to Nsp16. All of them are downstream of an IRES sequence (Fig. 1A). As a result, Nsp1 to Nsp16 were expressed from these three plasmids and formed the mature replicase/transcriptase complex to facilitate replicon RNA replication and transcription (Fig. 1B).”, (p. 3 para 2 to p. 4 para 1). Luo et al teaches incorporating the CMV promoter into the replicon system (p.4, para 2). Further, Luo et al teaches using siRNA such as STAT1 to see how it effected the replicon system activity (p. 6, para 3).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Wang et al, i.e., an shRNA DNA template and DNA-dependent RNA polymerases with the teachings of Luo et al, i.e., transfecting cells with a SARS-Cov-2 replicon system containing nsp1 to nsp16 genes, to yield the predictable results of a composition containing an shRNA DNA template, a DNA-dependent RNA polymerase and SARS-Cov-2 mRNA/proteins of nsp1 to nsp16. One would be motivated to combine these. Luo et al teaches that silencing RNA can be added to the solution to see how it effects replicon system activity, and Wang et al teaches that shRNA or Ribozyme DNA templates are mixed with T7 polymerase. One could look to the teachings of Luo et al and Wang et al for combining nonstructural proteins with the composition that contains a T7 polymerase and shRNA/ribozymes and have a high likelihood of success with such composition for studying of viral RNA synthesis and drug development without the need for a biosafety level II laboratory.
Accordingly claim 2 is rejected as being unpatentable over Wang et al in view of Luo et al.
Claim(s) 5 and 25 are rejected under 35 U.S.C. 103 as being unpatentable over Wang et al (supra) as applied to claim(s) 1, 3-4, 6-7, 10-11, 16-21, 23-24, and 26 above, and further in view of Lundstrom et al (Self-Amplifying RNA Viruses as RNA Vaccines, Int J Mol Sci, vol 21, issue 5130, pages 1-29, published July 20th, 2020).
Wang et al does not disclose self-amplifying RNA/mRNA.
Lundstrom et al teaches that “Particularly, alphaviruses and flaviviruses can be administered as recombinant particles, layered DNA/RNA plasmid vectors carrying the RNA replicon and even RNA replicon molecules. Self-amplifying RNA viral vectors have been used for high level expression of viral and tumor antigens, which in immunization studies have elicited strong cellular and humoral immune responses in animal models. Vaccination has provided protection against challenges with lethal doses of viral pathogens and tumor cells. Moreover, clinical trials have demonstrated safe application of RNA viral vectors and even promising results in rhabdovirus-based phase III trials on an Ebola virus vaccine. Preclinical and clinical applications of self-amplifying RNA viral vectors have proven efficient for vaccine development and due to the presence of RNA replicons, amplification of RNA in host cells will generate superior immune responses with significantly reduced amounts of RNA delivered.”, (abstract).
Regarding claim(s) 5 and 25, Lundstrom et al teaches, “In any case, the RNA genome of self-amplifying RNA viruses can act directly in the cytoplasm without any need of nucleic acid delivery to the nucleus . . . All self-amplifying RNA viruses initially express their nonstructural genes resulting in the formation of the RNA replication complex (RNA replicon), responsible for extreme RNA replication in infected host cells [7]. It has been estimated that 200,000 copies of RNA are made from a single RNA molecule, providing together with strong subgenomic promoters the basis for extremely high expression levels of viral proteins. This feature has been taken advantage of in expression vectors engineered from self-amplifying RNA viruses, which have been applied for mammalian and non-mammalian cell lines, primary cells and in vivo [9].”, (p. 2, para 2).
“In this context, engineering of an expression vector carrying the SFV nonstructural protein genes (nsP1-4), where the gene of interest can be inserted downstream of the strong 26S subgenomic promoter allows in vitro transcribed RNA to be directly translated in cell lines and in vivo (Figure 1). Alternatively, replacement of the SP6 or T7 RNA polymerase promoter upstream of the nsP1-4 region with a cytomegalovirus (CMV) promoter permits direct use of plasmid DNA in vitro or in vivo [13]. . . In any case, the options and flexibility are excellent as alphavirus vectors can be used for vaccine development in the form of naked RNA replicons, DNA plasmid vectors and recombinant viral particles as described in more detail in the next sections.” (p.2, para 4).
Therefore, it would have been obvious to someone of ordinary skill in the art before the effective filing date of the claimed invention to modify the DNA templates/plasmids of Wang et al, i.e., both the shRNA/ribozymes and the T7 polymerase with the teachings of Lundstrom et al, incorporating a gene of interest downstream a CMV promoter in an engineered expression vector carrying SFV nonstructural genes to yield the predictable results of a self-amplifying RNA and/or DNA replicon. One of skill in the art would be motivated to do so because Lundstrom et al teaches that self-amplifying RNA/DNA can (1) produce roughly 200,000 copies of RNA made from a single RNA molecule, (2) generate a superior immune response if and when delivered in vivo, and (3) significantly reduce the amount of RNA needed to be delivered.
Accordingly, claim(s) 5 and 25 are rejected as being unpatentable over Wang et al in view of Lundstrom et al.
Claim 8 is rejected under 35 U.S.C. 103 as being unpatentable over Wang et al (supra) as applied to claim(s) 1, 3-4, 6-7, 10-11, 16-21, 23-24, and 26 above, and further in view of Ulrich et al (Rat Insulin Genes: Construction of Plasmids Containing the Coding Sequences, Science, Vol 196, Issue 4296, Published June 17th, 1977).
Wang et al does not teach that the 5’ end of said DNA template is dephosphorylated.
Regarding claim 8, Ulrich et al teaches that in order to prevent recombining of cut plasmid, the DNA that was cut with HindIII was treated with an alkaline phosphatase to remove the 5’ terminal phosphate. This ensures the prevention of self-ligation since circle formation is dependent on the insertion of a DNA fragment containing 5’ phosphorylated termini (p. 1316, col 1, para 3).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Wang et al, i.e., a linear DNA template, with those of Ulrich et al, applying an alkaline phosphatase to said linear DNA template, to yield the predictable results of a dephosphorylated 5’ DNA template. One of skill in the art would be motivated to do so because Ulrich et al teaches that to prevent self-ligation, one must add in a phosphatase since circular formation of DNA is dependent on the insertion of a DNA fragment containing a 5’ phosphorylated termini.
Accordingly claim 8 is reject as being unpatentable over Wang et al in view of Ulrich et al.
Claim(s) 12-15 are rejected under 35 U.S.C. 103 as being unpatentable over Wang et al (supra) as applied to claim(s) 1, 3-4, 6-7, 10-11, 16-21, 23-24, and 26 above, and further in view of Pardi et al (Chapter 2: In Vitro Transcription of Long RNA Containing Modified Nucleosides, Synthetic Messenger RNA and Cell Metabolism Modulation: Methods and Protocols, Methods in Molecular Biology, vol. 969, pages 29-42, published January 1st, 2012).
Wang et al does not disclose a 5’ cap molecule, 3’ cap-like molecule, and/or nucleotide modifications into the RNA.
Pardi et al teaches, “The in vitro synthesis of long RNA can be accomplished using phage RNA polymerase and template DNA. However, the in vitro synthesized RNA, unlike those transcribed in vivo in cells, lacks nucleoside modifications. Introducing modified nucleosides into in vitro transcripts is important because they reduce the potential of RNA to activate RNA sensors [1–6] and translation of such nucleoside-modified RNA is increased in cell lines, primary cells, and after in vivo delivery [1, 3, 7–10]. Here, we describe the in vitro synthesis of nucleoside- modified RNA with enhanced translational capacity and reduced ability to activate immune sensors.”, (abstract).
Further, “Interestingly, the first in vivo application of an in vitro transcript encoding a physiologically relevant protein was reported in 1992, but RNAs further development beyond use as antigen-encoding vaccine vector was delayed until 2011. The potential reasons for the limited interest in applying mRNA as a therapeutic or using it in laboratory techniques for cellular delivery are RNA’s immunogenicity, lability, low level and transient translatability, and difficulty to work with. The recent discovery that incorporating naturally occurring modified nucleosides into RNA reduces its immunogenicity and greatly increases its translatability has revolutionized RNA as a therapeutic. Now, in vitro transcripts containing modified nucleosides have been tested in vitro, to express protein at a high efficiency; ex vivo, to deliver transcription factors for the generation of induced pluripotent stem (iPS) cells; and recently, in vivo to express therapeutic proteins in mice and macaques.”, (p.29, para 1 to p.30 para 1).
Regarding claim(s) 12 and 13, Pardi et al teaches “After in vitro transcription, the newly synthesized mRNA can be further optimized. 7-methylguanylate cap and a poly(A) tail give significant stability and translatability to mRNA. Both can be incorporated into RNA during transcription with the inclusion of an anti-reverse cap analog (ARCA). . .”, (p. 30, para 3).
Regarding claim(s) 14 and 15, Pardi et al teaches, “Different nucleoside modifications can be incorporated into mRNA. We found that T7 RNA polymerase or the double mutant (Y639F/H784A) with superior ability to incorporate noncanonical NTPs were able to incorporate 2-thiouridine (s2U), 5-methyluridine (m5U), 5-methylcytidine (m5C), N6-methyladenosine (m6A), and pseudouridine ( Ψ ), but were unable to incorporate 2’ -O-methylated NTPs into long RNA. . . We have found that for translation, complete replacement of uridine with pseudouridine results in RNA with the highest level of translation and low levels of immunogenicity. Incorporation of m5C and Ψ into the RNA results in a further decrease in immunogenicity and variable but usually lower levels of translation.”, (p. 31, para 1).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the T7 polymerase as taught by Wang et al with the teachings of Pardi et al, i.e., producing the RNA by template DNA and in vitro transcription prior to transfection and incorporating a 5’ cap molecule, 3’ cap-like molecule, and/or nucleotide modifications into the RNA to yield the predictable results of a modified T7 RNA polymerase for transfection into cells. One of skill in the art would be motivated to do so because Pardi et al teaches that mRNA modification with capping molecules and nucleotides (1) enhances translational capacity, (2) reduces the ability to activate immune sensors, and (3) greatly increases the translatability of RNA as a therapeutic.
Accordingly, claim(s) 12-15 are rejected as being unpatentable over Wang et al in view of Pardi et al.
Claim 22 is rejected under 35 U.S.C. 103 as being unpatentable over Wang et al (supra) as applied to claim(s) 1, 3-4, 6-7, 10-11, 16-21, 23-24, and 26 above, and in view of Kerr et al (Molecular analysis of the factorless internal ribosome entry site in Cricket Paralysis virus infection, Scientific Reports, vol 6. Issue 37319, pages 1-11, published November 17th, 2016)
Wang et al does not teach IRESes selected from SEQ ID NOs: 3-13.
PNG
media_image1.png
946
1486
media_image1.png
Greyscale
Kerr et al teaches with 98.9% similarity to instant SEQ ID NO: 12, which is the cricket paralysis virus (CrPV) intergenic region IRES (see figure 1 below – Dotted boxes are the mismatched nucleotides).
Kerr et al teaches that mutations to the region surrounding the mismatches above are predicted to strengthen specific helical regions on the IGR IRES within PKI and enhances IRES activity 2.0-fold (p.3 para 1 and Figure 2).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to substitute the IRES of Wang et al with the IRES taught by Kerr et al. The substituted components, i.e., the CrPV IRES (of Kerr et al) and the canonical IRES (of Wang et al) and their functions were known in the art. One of skill in the art could look to the teachings of Wang et al, e.g., “IRESs are RNA sequences able to mediate internal entry of 40 S ribosome on some mRNAs upstream of the translation initiation codon. These sequences are very diverse, and mRNAs with different IRESs have been identified continuously.”, (p. 102, col 2, para 2 to p.103, col 1, para 1) and substitute the basic IRES of Wang et al for the IRES of Kerr et al and the result of the substitution would have been predictable. Further, it would have been obvious to try to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the IRES, as taught by the substitution of Wang et al’s IRES for Kerr et al’s IRES, with nucleotides substitutions in the PKI region, as taught by Kerr et al to yield the predictable results of an IRES represented by instant SEQ ID NO: 12. One of skill in the art would be motivated to do so because Kerr et al teaches that the substitutions within the PKI region strengthen specific helical regions of the IGR IRES and that these substitutions enhance IRES activity by 2.0-fold. One could look the PKI region and identify a finite number of base pairs and substitute each base pair to identify whether said substitutions enhance IRES activity with a high likelihood of success.
Accordingly, claim 22 is rejected over Wang et al in view of Kerr et al.
Allowable Subject Matter
Claim 9 is objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims, while also being amended to overcome the rejection under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph. Claim 9’s limitation of wherein the 3’ end of the DNA template is tailed by an 8-OHG is free of the art and any “obviousness” rationale as to incorporating that nucleotide analog into the 3’ end of a DNA template.
Conclusion
No claims allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to LEXUS M TATGE whose telephone number is (571)272-0061. The examiner can normally be reached Monday-Friday: 8:30am to 5:30pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/L.M.T./Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637