DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant’s correspondence received on 06/23/2026. Claims 1-8, 10, 12-16, 18-20, 26, 32, and 48 are currently pending.
Information Disclosure Statement
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. This application is a CON of PCT/US2022/024703 filed on 04/13/2022, claims priority to PRO 63/174,468 filed on 04/13/2021.
Specification
The use of the terms STEMCELL Technologies, Synthego, Aldevron, Lonza, HT Nucleofector, Sarstedt, TexMACS, Attune NxT, Biolegend, HemaCare Corporation, Miltenyi Biotech, Gemini Bio, Thermo Fisher, Nexcelom, BD Bioscience, which are trade names or marks used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Objections
Claim 3 is objected to because of the following informalities: The recitation “both the first and second CDL target sequence” should be “both the first and second CDL target sequences”. Appropriate correction is required.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1–8, 10, 12-17, 20, 26, 32, 48 are rejected under 35 U.S.C. 103 as being unpatentable over Marson (WO2020123871A1, published on 06/18/2020; Cited on the IDS filed on 02/27/2026), in view of Zhang (Genome Biol. 2017;18(1):35).
Marson (2020) teaches a composition for modifying a target nucleic acid in claim 1, comprising:
(a) a targetable nuclease; (b) a DNA-binding protein;
(c) a donor template comprising a homology directed repair (HDR) template and one or more DNA-binding protein target sequences, i.e. a “(ii) a first co-delivery linearization (CDL) target sequence, wherein the first CDL target sequence is operably linked 5' of the HDR template; and (iii) a second CDL target sequence, wherein the second CDL target sequence is operably linked 3' of the HDR template” (FIG. 2A, Truncated Cas9 Target Sequence, or tCTS; Page 17, ¶[0076]).
Marson further teaches “wherein the donor template is a plasmid” in claim 113, “the composition comprises an anionic polymer” in claims 2, 33-36, 41, 43-51, “a ribonucleoprotein (RNP) complex” in claims 75-82 involving complexing with polymer, and “Non-viral strategies, such as electroporation” (Page 26, ¶[0116]; Claim 38 for electroporation), i.e. “the composition is formulated for non-viral delivery into a cell”.
Marson does not teach: “wherein each of the first and the second CDL target sequences are capable of cleavage by the targetable nuclease protein or a complex comprising the targetable nuclease protein”. In another word, Marson does not teach using the DNA-binding protein to cleave the HDR template, which would simultaneously linearize a template plasmid.
PNG
media_image1.png
330
711
media_image1.png
Greyscale
However, Zhang (2017) teaches the missing limitation in Marson. Zhang teaches “that a double cut HDR donor, which is flanked by single guide RNA (sgRNA)-PAM sequences and is released after CRISPR/Cas9 cleavage, increases HDR efficiency by twofold to fivefold relative to circular plasmid donors” (Figure 1b above; Page 1, Abstract, lines 5-7). Zhang further teaches the linearization design details in Figure 3a, mapping representative CDL target sequences and respective PAM motifs.
Regarding claim 1, it would have been obvious to persons having ordinary skills in the art (PHOSITAs) before the effective filing date of the claimed invention to have modified the composition for modifying a target nucleic acid taught by Marson (2020) by incorporating the double cut feature in the “CDL sequences”, so that the same sgRNA used for cleaving the target nucleic acid can guide the “targetable nuclease protein”, Cas9 in Zhang’s case, to cleave both ends of the HDR template and release it from the circular plasmid donor while linearizing it, for more efficient HDR-based transgene integration, taught by Zhang (2017). However, multi-purposing the same sgRNA may require optimization of sgRNA and Cas9 dosing as a procedural tradeoff, because more amount of sgRNA and Cas9 is required to target the genomic target site and multiple sites in the donor plasmid. It would have merely amounted to a simple substitution of prior art elements according to known methods to yield predictable results because these are known structural elements in the art and they function the same way as alternative HDR template donor systems despite with different optional features and tradeoffs. One would have been motivated to do so because Zhang (2017) teaches that double cuts in template plasmid significantly improves the HDR knock-in efficiency. One would have reasonable expectation of success because Zhang specifically teaches that “a double cut HDR donor, which is flanked by single guide RNA (sgRNA)-PAM sequences and is released after CRISPR/Cas9 cleavage, increases HDR efficiency by twofold to fivefold relative to circular plasmid donors” (Page 1, Abstract, Results, lines 1-3) with a simple and reproducible strategy that can be easily verified by PHOSITAs by comparing the substitutable strategies.
Regarding claims 2 and 4, Marson further teaches an “RNA-guided nuclease comprises CRISPR-CAS”, Cas9, guided by single guide RNA (sgRNA) or gRNA complexed in an RNP (FIG. 1A; Claim 2).
Regarding claim 3, Marson further teaches that “In some embodiments, the DNA-binding protein target sequence has at least 14 nucleotides, …”, which “… is complementary to an equal length portion of the sequence of the donor gRNA” (Page 45, ¶[0164]). As discussed above, the “Truncated Cas9 Target Sequence, or tCTS” is equivalent to the claimed CDL target sequence, and that the range “at least 14 nucleotides” encompasses embodiments with “at least 17 nucleotides”. Hence, Marson further teaches a composition further comprising a donor RNA comprising at least 17 nucleotides that are complementary to the first, second, or both first and second CDL target sequences.
Regarding claims 5, 10, and 16, Marson further teaches RNP complexes of donor gRNAs and a truncated variant of Cas9, a CRISPR/Cas, and at least some embodiments meet the following limitations:
(1) the donor gRNA comprises at least 17 nucleotides (see discussion above regarding claim 3) that are complementary to each of the first and the second tCTS target sequences, i.e. CDL target sequences, see Marson FIG. 2A, and
(2) each of the first and the second tCTS target sequences, i.e. CDL target sequences, are operably linked to a 3-base pair protospacer adjacent motif (PAM) located 3' of the tCTS target sequences, which is the “out” orientation for tCTS target sequences taught by Marson (FIG. 2A; Page 17, ¶[0076], lines 4-6), wherein the PAM motifs face away from the HDR template insert region, i.e. 3’ to either of the tCTS target sequences, i.e. CDL target sequences.
Since Marson teaches that “the target gRNA and the donor gRNA have the same sequence” (Claim 103) or “the target gRNA and the donor gRNA have the different sequences” (Claim 104), Marson teaches the limitations of claims 5, 10, and 16.
Regarding claim 6, Marson further teaches that each donor gRNA is configured to form a distinct RNP complex comprising a variant of Cas9, dCas9 (Page 17, ¶[0075], lines 2-8).
PNG
media_image2.png
533
551
media_image2.png
Greyscale
Regarding claim 7, Zhang further teaches using the same 21nt gRNA sequence, CCAGGTGGACAGCAATCAGC, called sgCTNNB1, to target both CDL sequences flanking the HDR template insert, as well as the CTNNB1 genomic locus (Page 6; Figure 3a, right). Hence, Zhang further teaches the same composition taught by Marson “wherein one or more of the donor gRNAs comprises at least 17 nucleotides that are complementary to a genomic target sequence of the cell”.
Regarding claim 8, Zhang further teaches that the composition discussed above “wherein the HDR template comprises homology arms that are complementary to nucleic acid sequences flanking the genomic target sequence of the cell”, as seen in Figure 3a above, wherein the yellow and blue highlighted homology arms are complementary to the antisense strand of the nucleic acid sequences flanking the genomic target sequences of the cell.
Regarding claim 12, Marson teaches “(a) a targetable nuclease” and “(b) a DNA-binding protein” as separate components of the claimed composition. Under the broadest reasonable interpretation (BRI) these two components can be the identical nuclease/DNA-binding protein or different nucleases/DNA-binding proteins because there are embodiments that meet both functional limitations, or only one of the two.
Regarding claims 13, 15, & 26, Marson teaches that both “(a) a targetable nuclease” and “(b) a DNA-binding protein” are variants of RNA-guided nuclease, i.e. dCas9 vs. Cas9 (FIG. 1A & 2A), and the second targetable nuclease protein, Cas9, can cleave a genomic target sequence of the cell (FIG. 2).
Regarding claim 14, Marson teaches that “in other embodiments, the target gRNA and the donor gRNA have the different sequences” (Claim 104), and that “the target gRNA is complementary to a target nucleic acid” (Claim 101), hence, the composition further comprises a second gRNA complementary to the genomic target sequence. Marson further teaches “a 20-nucleotide length gRNA was used in all experiments” (Page 18, ¶[0077], lines 19-20), and 20 is within the range of “at least 17”.
Regarding claim 20, Marson further teaches the “in” and “out” orientations for tCTS target sequences taught by Marson (FIG. 2A; Page 17, ¶[0076], lines 4-6). An "in" facing orientation of the tCTS means PAMs facing in towards the center of the inserted sequence vs "out" away from the insert on the edges of both the 5' and 3' homology arms. This design flexibility leads to the options of one, both, or neither of the PAM sequences encoded between the CDL target sequences and the HDR template.
Regarding claim 32, Marson further teaches a “a ribonucleoprotein (RNP) complex” (Claims 75-82) for modifying a target nucleic acid, comprising: (a) a CRISPR-CAS RNA-guided nuclease; (b) a donor guide RNA (gRNA). wherein the donor gRNA comprises “a 20-nucleotide length gRNA”(Page 18, ¶[0077], lines 19-20, 20 is within the range of “at least 17”) that are complementary to a tCTS sequence, i.e. a “co-delivery linearization (CDL) target sequence”, and wherein the composition is formulated for non-viral delivery into a cell via RNP electroporation (Claim 38).
Regarding claim 48, Marson further teaches the method steps of:
-providing the cell (Claim 37),
-introducing into the cell a composition formulated for non-viral delivery, RNP, via electroporation (Claims 38, 75-82), the composition has been discussed above regarding claim 1, wherein Zhang teaches that each of the first and the second tCTS sequences, i.e. CDL target sequences, are capable of cleavage by the targetable nuclease protein or a complex comprising the targetable nuclease protein.
Claims 18 and 19 are rejected under 35 U.S.C. 103 as being unpatentable over Marson (2020), in view of Zhang (2017), further in view of Zheng (US11332744B1, issued on 05/17/2022, claims priority to PRO 63/105,834, filed on 10/26/2020). The teachings of Zheng discussed below have been verified to be fully supported by disclosure in PRO 63/105,834, filed on 10/26/2020.
The teachings of Marson (2020) and Zhang (2017) have been discussed above as applied to claims 1-8, 10, 12-17, 20, 26, 32, 48. Neither Marson nor Zhang teaches a genomic “safe-harbor nucleic acid sequence comprising the nucleic acid sequence GAGCCATGCTTGGCTTACGA (SEQ ID NO: 2)”.
Zheng (2020) teaches a sgRNA protospacer sequence comprising the nucleic acid sequence GAGCCATGCTTGGCTTACGA in Table 4 (Column 45, SEQ ID NO: 94; Target locus: chr11:128340000-128350000) that is identical to the claimed SEQ ID NO: 2, see alignment below:
Query: Zheng SEQ ID NO: 94 GAGCCATGCTTGGCTTACGA
||||||||||||||||||||
Sbjct: Instant SEQ ID NO: 2 GAGCCATGCTTGGCTTACGA
Zheng further teaches that “wherein the safe harbor locus is at chr11:128340000-128350000 target loci” (Claim 1) and that “the safe harbor locus is at any one or more of the sgRNA target loci provided in Table 4”. Hence, Zheng teaches a “safe-harbor nucleic acid sequence comprising the nucleic acid sequence GAGCCATGCTTGGCTTACGA (SEQ ID NO: 2)”.
Regarding claim 18 and 19, it would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have modified the composition for modifying a target nucleic acid taught by Marson (2020) and Zhang (2017) by incorporating known gRNAs complementary to or targeting a known genomic safe harbor site with the target sequence comprising “the nucleic acid sequence GAGCCATGCTTGGCTTACGA (SEQ ID NO: 2)”. It would have merely amounted to a simple substitution of prior art elements according to known methods to yield predictable results. One would have been motivated to do so because Zheng (2020) teaches that “The identification of safe harbor sites (SHS) has improved outcomes of genome-engineering therapies” (Column 1, lines 41-43) and “there is still a need for … additional SHS to address challenges such as poor knock-in (KI) efficiency, insertional oncogenesis, unstable and/or anomalous expression of transgenes and/or adjacent genes…” (Column 1, lines 49-53). One would have reasonable expectation of success because it does not involve additional step apart from those in the methods of Marson and Zhang by simply swapping a target sequence. And SHS loci have been widely used in the art, a routine and well understood aspect of gene editing.
Conclusion
No claims are allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Delphinus D. Yu whose telephone number (571) 272-1576. The examiner can normally be reached Mon-Thr 7:30am to 4:30pm Fri 10am to 2pm ET.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil P Hammell can be reached on (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/DELPHINUS DOU YI YU/Examiner, Art Unit 1636
/NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636