DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of claims 94-107 and 112 in the reply filed on July 20, 2026 is acknowledged.
Status of Claims
Claims 94-112 are pending in the instant application. Claims 108-111 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Accordingly, claims 94-107 and 112 are under examination on the merits in the instant application.
Claim Objections
Claims 101 and 104 are objected to because the second line contains only the word “donor”. Appropriate correction is required.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 94-107 and 112 are rejected under 35 U.S.C. 103 as being unpatentable over
Conway et al. (US 2015/0056705 A1, applicant’s citation) in view of Tremblay et al. (WO 2017/049407 A1), McGarrity et al. (US 2006/0172381 A1, applicant’s citation), and Friedland et al. (US 9,963,719 B1, applicant’s citation).
Conway teaches making a composition that can insert a transgene “into an albumin gene with a CRISPR/Cas system where the single guide RNA comprises the sequences to target the albumin gene”, wherein the transgene encodes the clotting factor “Factor VIII”, which provides “therapeutic benefit” for treating “clotting disorders”, wherein the insertion of the transgene into the albumin locus results in “liver-specific expression of the transgene encoded protein at high concentrations.” See paragraph 0060.
Conway teaches that the transgene encoding Factor VIII can be an “engineered gene” through “codon optimization” and that hemophila A patients have FVIII mutations thus “liver-directed gene therapy protocols” are useful for treating hemophilia A. See paragraph 0063.
Conway teaches that the donor sequence can be “present in a separate vector” such as an “AAV” vector from the “CRISPR/Cas vector” and the nuclease-encoding sequence can be delivered to cells via “liposomes”. See paragraphs 0028, 0206, and 0209.
Conway teaches that making a “kit” comprising the composition and instructions for using the composition. See paragraph 0039.
Conway does not teach that the single guide RNA targeting the albumin locus has the RNA counterpart of the first 20-mer (5’-ATTTATGAGATCAACAGCAC) of SEQ ID NO:22 claimed in the instant case.
Tremblay teaches that 20-mer guide RNAs are designed by “the identification of PAMs (i.e., NGG sequence)” for S. pyogenes Cas9 (SpCas9) in the desired target genomic sequence, which includes “the antisense strand”. See paragraphs 0059 and 0078; Table 3.
Tremblay demonstrates the identification of the NGG PAM sequence (complementary to the “CCN” in the sense strand sequence) in the antisense strand of a target genomic sequence in Figure 1, wherein the following portion is reproduced from Figure 1.
PNG
media_image1.png
310
814
media_image1.png
Greyscale
Tremblay demonstrates that the 20-mer guide RNAs designed using the antisense strand sequence provide intended activity when tested. See Figure 3b.
McGarrity teaches that Factor VIII-encoding sequence can be inserted into intron 1 of albumin and demonstrates that a composition comprising an albumin intron 1-targeting sequence and a Factor VIII-encoding sequence results in increased plasma levels of Factor VIII in Factor VIII mice, wherein the target sequence of albumin intron 1 is SEQ ID NO:40, wherein albumin pre-mRNA is abundant in plasma such that “the levels of albumin pre-mRNA are 270x more abundant than Factor VIII transcript”. See paragraphs 0212-0213; Figures 4, 25, and 46-48.
MacGarrity discloses SEQ ID NO:40 (albumin intron 1) in Figure 25 as copied below, wherein a box has been added for the 5’-CCN PAM motif in the sense strand direction (thus corresponding to the 5’-NGG sequence in the antisense strand), wherein there are thirteen (13) sequences having the 5’-CCN(N20) motif, which would correspond to 5’-(N20)NGG motif in the antisense direction.
PNG
media_image2.png
232
758
media_image2.png
Greyscale
Friedland teaches that a donor template sequence (or “replacement sequence”) that is to be inserted/replaced as a new sequence into the target sequence includes flanking or adjoining target sequences to be cleaved such that “the donor template can be adjacent to, or flanked by, target sites recognized by one or more gRNAs” for inserting the new sequence. See columns 44-45. Friedland teaches that Cas9 nuclease can be DNA or RNA and that gRNA and Cas9 can be mixed to form RNPs. See Table 6; column 51.
It would have been obvious to one of ordinary skill in the art before the effective filing date to use the art-recognized gRNA design rule and obtain the above-identified thirteen 20-mer gRNA sequences within the antisense strand of human albumin intron 1 when making Conway’s CRISPR/Cas9 system that utilizes a factor VIII donor sequence and an albumin-targeting gRNA sequence. One of ordinary skill in the art would have been motivated to do so with a reasonable expectation of success in order to make a CRISPR/SpCas9 system that increases factor VIII plasma levels by inserting a factor VIII-encoding sequence into intron 1 of albumin pre-mRNA that is “270x more abundant than Factor VIII transcript” as it was an art-recognized technology/goal to insert a factor VIII-encoding sequence into intron 1 of albumin as evidenced by the teachings of Conway and McGarrity, and because a target sequence-specific gRNA design rule suitable for the CRISPR/SpCas9 system including utilizing the antisense strand sequence was available and known in the art as disclosed by Fenway, who taught that one of ordinary skill can obtain a desired 20-mer gRNA sequence by identifying an NGG PAM sequence both in the sense strand and the antisense strand within a known target sequence for use with SpCas9, wherein the gRNA sequences designed within the antisense strand sequence of a desired target sequence are effective as demonstrated by Fenway. That is, one of ordinary skill in the art would have had a reasonable expectation of success in obtaining the RNA counterpart of the first 20-mer (5’-ATTTATGAGATCAACAGCAC) of SEQ ID NO:22 as one of thirteen 20-mer gRNA sequences within the antisense strand of human albumin intron 1 when using CRISPR/SpCas9 because it was within the technical grasp of one of ordinary skill in the art before the effective filing date to identify thirteen 5’-(N20)NGG sequences including 5’-(ATTTATGAGATCAACAGCAC)AGG in the antisense strand sequence of human albumin intron 1, wherein the 5’-(N20)NGG corresponds to 5’-CCT(GTGCTGTTGATCTCATAAAT) shown in the sense strand sequence found in MacGarrity’s SEQ ID NO:40. One of ordinary skill in the art would have been motivated to flank the factor VIII-encoding donor template sequence with target sites recognized by any of the 13 above-identified gRNA sequences designed within the antisense strand sequence of human albumin intron 1 including 5’-AUUUAUGAGAUCAACAGCAC in order to effectively insert the factor VIII-encoding sequence into intron 1 of the abundant albumin pre-mRNA, because Friedland taught that flanking or adjoining donor template sequences with target sequences that are recognized by gRNAs can provide insertion of the donor template replacement sequence within the target sequence.
Accordingly, claims 94-107 and 112 taken as a whole would have been prima facie obvious before the effective filing date.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 94-107 and 112 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-20 of U.S. Patent No. 11,529,427 B2.
Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are anticipated and encompassed by the ‘427 patent claims, which require and recite the instantly claimed composition with all recited limitation including “a gRNA comprising a spacer sequence complementary to a host cell locus or a nucleic acid encoding the gRNA”, wherein the scope of “gRNA” as broadly and generically claimed in the ‘427 patent claims is defined to read on and encompass the “20 nucleotide version” of “T5” (SEQ ID NO:358; 5’-ATTTATGAGATCAACAGCACAGG), which is a gRNA “targeting human albumin intron 1” as evidenced by the ‘427 patent specification. See columns 3, 101-102, and 201-202. It is noted that the first 20-mer sequence of SEQ ID NO:358 is 100% identical to the first 20-mer of SEQ ID NO:22 claimed in the instant case. Note that it is proper to look to the specification to determine the proper scope of the claims in the reference patent. See Pfizer Inc. v. Teva Pharmaceuticals USA Inc., 518 F3d 1353, 86 USPQ2d 1001 (Fed. Cir. 2008).
Claims 94-107 and 112 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-13 of U.S. Patent No. 12,016,932 B2 in view of Conway et al. (US 2015/0056705 A1, applicant’s citation), Tremblay et al. (WO 2017/049407 A1), McGarrity et al. (US 2006/0172381 A1, applicant’s citation), and Friedland et al. (US 9,963,719 B1, applicant’s citation).
Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are an obvious variation of the ‘932 patent claims drawn to a nucleic acid comprising a donor template of a codon-optimized sequence encoding FVIII protein flanked by “a gRNA target site”, wherein the donor template is operably linked to an endogenous albumin promoter sequence. It would have been obvious to one of ordinary skill in the art to utilize a target site recognized by the first 20-mer sequence of SEQ ID NO:22 claimed in the instant case in view of the combined teachings of Conway, Tremblay, McGarrity, and Friendland and the level of skills/techniques disclosed therein for the reasons stated in the §103 rejection above, which is fully incorporated by reference herein thus will not be repeated.
Claims 94-107 and 112 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 28, 35-36, 41-45, 47-49, and 51-56 of copending Application No. 17/286,276.
Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are anticipated and encompassed by the ‘276 claims, which require and recite the instantly claimed composition with all recited limitation including “a gRNA comprising a spacer sequence” from SEQ ID NO:22, which is 100% identical to SEQ ID NO:22 claimed in the instant case, and wherein the “spacer sequence” is defined to read on “20 nucleotides.” See paragraph 0199 of the ‘276 specification. Note that it is proper to look to the specification to determine the proper scope of the claims in the reference patent. See Pfizer Inc. v. Teva Pharmaceuticals USA Inc., 518 F3d 1353, 86 USPQ2d 1001 (Fed. Cir. 2008).
Claims 94-107 and 112 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3, 7-10, 12, 16-18, 20-22, 26-29, 69, and 124 of copending Application No. 18/671,569.
Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are anticipated and encompassed by the ‘569 claims, which require and recite the instantly claimed composition with all recited limitation including “a guide RNA (gRNA) comprising a spacer sequence complementary to a host cell locus or a nucleic acid encoding the gRNA”, wherein the scope of “gRNA” as broadly and generically claimed in the ‘569 claims is defined to read on and encompass the “20 nucleotide version” of “T5” (SEQ ID NO:358; 5’-ATTTATGAGATCAACAGCACAGG), which is a gRNA “targeting human albumin intron 1” as evidenced by the ‘569 specification. See paragraphs 0023 and 0567-0569. It is noted that the first 20-mer sequence of SEQ ID NO:358 is 100% identical to the first 20-mer of SEQ ID NO:22 claimed in the instant case. Note that it is proper to look to the specification to determine the proper scope of the claims in the reference patent. See Pfizer Inc. v. Teva Pharmaceuticals USA Inc., 518 F3d 1353, 86 USPQ2d 1001 (Fed. Cir. 2008).
Conclusion
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to DANA H SHIN whose telephone number is (571)272-8008. The examiner can normally be reached Monday-Thursday: 8am - 6:30pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, RAM SHUKLA can be reached at 571-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/DANA H SHIN/Primary Examiner, Art Unit 1635
Prosecution Insights