DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
The preliminary amendment filed September 5, 2024 is acknowledged. Claims 1, 3-5, 7-12, 25-27 and 30-36 are pending and under examination.
This application is a CON of patented application 16/569336 and claims priority to provisional application 62/471342 March 14, 2017. The claimed invention appears completely supported by the provisional application. The effective filing date of the claimed invention is March 14, 2017.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1, 3-5, 7-12, 25-27 and 30-32 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 recites a first guide RNA and a second guide RNA “wherein the first and second guide RNAs comprising first and second targeting domains complementary to first and second sequences on opposites sides of positions of a 13 nucleotide (nt) target region of a human HBG1 or HBG2 gene, wherein on or both of the first and second sequences optionally overlaps the 13 nt target region”. The combination of the bolded/italicizes phrases makes the claim indefinite. “[O]n opposite sides of position of a 13 nt target region” means that the targeted sequences of the guide RNAs are on the sides (i.e., not overlapping) with the 13 nt target region. However, claim 1 optionally allows the target region to overlap the 13 nt target region. As such, it is not clear if the targeting sequences of the guide RNAs can include nucleotides from the 13nt target region.
Claims 3-5, 7-12, 25-27 and 30-32 are rejected for depending from claim 1 and not remedying the indefiniteness. It is noted that claims 7-9 only limit one targeting sequence to specific HBG1/2 promoter regions; however, as the 13 nt region is not defined and the other targeting sequence is not limiting, the claims are still indefinite as it is not clear if at least one guide RNA targeting sequence can overlap the 13 nt target region or not. Similarly, claim 10 only limits the sequence of one of the targeting sequences, and in the absence of defining the 13 nt target region, it is not clear if at least one guide RNA targeting sequence can overlap the 13 nt target region or not.
Claim 10 recites “differ by no more than 3 nucleotides from a targeting domain listed in Table 7.” Reference to tables in claims renders the claim indefinite when there is no practical way to define the invention in words. See MPEP 2173.05(s). Here, the tables contain exclusively text, and the appropriate text could simply be imported into the claim. Additionally, since the referenced text are sequences, Applicant could reference SEQ ID NOs in the claim. To overcome this rejection, Applicant must amend claim 10 such that it clearly sets forth a closed list of alternatives for the sequences from which the sequence of the targeting domains can differ by no more than 3 nucleotides.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 3-5, 7-12, 25, 30-36 are rejected under 35 U.S.C. 103 as being unpatentable over Traxler (Traxler et al., Nature Medicine (2016), 22: 987-990 and Supplemental Material) in view of Ran (Ran et al., Cell (2013), 154: 1380-1389) and Genbank (GU324926.1 Homo sapiens hemoglobin, gamma G (HBG2) gene, complete cds, available August 10, 2010, https://www.ncbi.nlm.nih.gov/nucleotide/GU324926.1, [retrieved April 28, 2026]).
Regarding claim 1, Traxler teaches hereditary persistence of fetal hemoglobin (HBHF) is a benign genetic mutation whereby the expression of fetal hemoglobin (HbF) is not attenuated during human development (Abstract). Traxler teaches method for treating hemoglobinopathies by increasing expression of HbF by increasing expression from the HBG1 and HBG2 genes, which encode HbF (Abstract). Traxler teaches a mutation in a 13-nt region of the HBG1/2 promoter using Cas9-mediated genome editing thereby recapitulating a naturally-occurring HBHF-associated mutation (Abstract). Traxler teaches the 13 nt region is at positions -102 to -114 of the HBG1 and HBG2 promoters (Figure 1). Traxler teaches Cas9 (i.e., an RNA-guided nuclease) complexed together with a first guide RNA (gRNA) targeted to the 13 nt region (Figures 1-2). Traxler teaches two different guide RNAs targeted to the 13 nt region (Figure 2). Traxler teaches Cas9/gRNA cleavage of the DNA resulted deletion of the 13 nt region and increased expression of HbF (Figure 2a-d). Traxler teaches the gRNAs were selected using a gRNA design tool for Cas9. (Methods, ¶1). Traxler teaches designing the Cas9 guide RNAs by using the 20-nt bases upstream of a the Cas9 PAM sequence NGG (Fig 1a). Traxler teaches there are potential off-target sites of the Cas9/gRNA system used (Supp Table 1). Traxler teaches future studies are needed to optimize the editing of HBG1 and HBG2 CCAAT box-DR site in hematopoietic stems cells and to minimize potentially harmful off-target mutations (¶ spanning pages 989-990).
Traxler does not teach a second guide RNA in a single composition with Cas9 and the first guide RNA.
Ran teaches mismatches between the gRNA targeting sequence and the target can be tolerated leading to off-target Cas9 cleavage (¶ spanning pages 1380-1381). Ran teaches using a Cas9 nickase (Cas9n) with a pair of offset gRNAs complementary to opposite strands of the target site can mediate indel formation at the targeted site, but with reduced off-target cleavage (Fig 2-3). Ran teaches modest to robust indel formation was observed with gRNA pairs that were offset by -4 to 100 base pairs (Fig 2; page 1382, ¶2). Ran teaches SpCas9 guide RNAs are designed by using the 20 bases 5’ of a PAM site that is NGG (Fig 1A; page 1386, ¶2).
Genbank teaches the sequence of the HBG2 promoter and sequences flanking the 13 nt deletion taught in Traxler (page 5, sequence in Traxler is underlined, red text caat….gac is the 13 nt deletion disclosed in Traxler). Genbank teaches there are multiple 5’-NGG and 5’-CCN (i.e., reverse complement of 5’-NGG on the opposite strand, which is not shown) sequences that flank the 13-nt deletion sequence taught in Traxler.
It would have been obvious to one skilled the art to modify Traxler’s method of mutating and/or fully recapitulating the naturally-occurring 13 nt deletion by using the double nicking strategy of Ran. It would have amounted to applying a known Cas9-based method for improving Traxler’s similar method of producing indels at a specific site by known means to yield predictable results (MPEP 2143, Rationale D). Traxler’s Cas9/sgRNA method for producing an indel is a “base method” upon which the claimed method can be seen as an improvement. The skilled artisan would have predicted that Ran’s double nicking strategy could be seen as an improvement to Traxler’s Cas9-one gRNA method because Traxler states that future optimization would be needed to mitigate off target mutations and Ran’s double nicking method results in fewer off-target mutations. The skilled artisan would have predicted that Ran’s method could be employed because the 13 nt region is within the off-set ranges presented in Ran and, as evidenced by Genbank, there are several SpCas9 PAM sites that flank the 13 nt site. The skilled artisan would have been motivated to apply Ran’s method to eliminate possible off-target indel formation of Traxler’s method.
Regarding claim 3, Traxler teaches the Cas9 is SpCas9 (i.e., the RNA-guided nuclease is an S. pyogenes Cas9) (Acknowledgements). Ran teaches the Cas9 is from S. pyogenes (page 1380, ¶2).
Regarding claims 4-5, both Traxler and Ran teach designing Cas9 guide RNAs by using the 20-nt adjacent sequence to the 5’-NGG PAM as indicated above for claim 1. The obviousness of using Ran’s doubling nicking strategy with the Cas9 nickase is recited above for claim 1. Ran also teaches the Cas9 nickase is produced by creating a D10A substitution in the RuvC domain (i.e., the nickase lacks RuvC activity (page 1381, ¶2; page 1382, ¶1).
Regarding claims 7-9, as indicated above for claim 1, Traxler teaches the 13-nt deletion is from position -102 to -114 in the HBG1/2 promoters (Fig 1a). Regarding claim 7, Genbank teaches in the 50 nucleotides upstream of the 13-nt target sequence (i.e., within -114 to -214) there are twelve “NGG” or “CCN” trinucleotides that could serve as a Cas9 PAM sequence to guide gRNA targeting design (page 5). Regarding claims 8-9, Genbank teaches in the 50 nucleotides downstream of the 13-nt target sequence (i.e., within -102 to -2 and within -102 to -52) there are eight “NGG” or “CCN” trinucleotides that could serve as a Cas9 PAM sequence to guide gRNA targeting design (page 5).
It would have been obvious to one skilled in the art to choose gRNA targeting sequences with 50 bp of the 13 nt deletion because Ran teaches to design guide RNAs for the paired nicking strategy the guide RNAs should be offset no farther than 100 bp.
Regarding claim 10, Traxler teaches the targeting sequence of gRNA-1 that targets a sequence overlapping the 13 nt region has the sequence GCTTGTCAAGGCTATTGGTCA (Fig 1a; Online Methods, ¶1), which includes a single additional nucleotide (i.e., differs by no more than 3 nucleotides) from SEQ ID NO 339, which is included in Table 7. Traxler teaches efficient Cas9 targeting to the HGB promoter by gRNA-1 and subsequent increase in HbF expression (Fig 1). Ran also teaches that indels and deletions also occur near the nicking sites of one or the other off-set gRNAs (Fig 2C and 6B).
It would have been obvious to one skilled in the art to use Traxler’s gRNA-1 in the method rendered obvious above because Traxler demonstrates that gRNA-1 can efficiently target Cas9 to the intended site.
Regarding claims 11-12, the method rendered obvious for claim 1 requires each of the guide RNAs to pair with a Cas9 nuclease. Thus, the obvious system would comprise a first and second RNA-guided nuclease, forming a first and second ribonuclease complex.
Regarding claims 25 and 30-32, the teachings of Traxler, Ran and Genbank and the obviousness of using a set of paired Cas9n/gRNA sequence-targeting nickases in a method to create indels at the 13-nt target sequence in the HBG1/2 promoter is recited above for claim 1. The obviousness of choosing at least one guide RNA that targets the HBG1/2 promoter within a region spanning positions -52 to -102 of the HBG1/2 promoter are recited above for claim 9. Traxler teaches transfecting CD34+ HSPCs with lentiviral vectors encoding Cas9 (online methods ¶5). Traxler teaches the transfected and edited cells were capable of differentiating into erythroblasts and erythrocytes (online methods, ¶-2-3; Supp Figs 2-3).
Regarding claim 33, the teachings of Traxler, Ran and Genbank and the obviousness of using a set of paired Cas9n/gRNA sequence-targeting nickases in a method to create indels at (i.e., alters) the 13-nt target sequence in the HBG1/2 promoter is recited above for claim 1. The obviousness of choosing at least one guide RNA that targets the HBG1/2 promoter within a region spanning positions -52 to -102 and within a region spanning -114 to -214 the HBG1/2 promoter are recited above for claims 7 and 9. Using guide RNAs with targeting sequences within the above ranges with the paired nickase strategy of Ran would comprise introducing a first SSB within the region of -114 to -214 (i.e., between c. -614 to -102) and a second SSB with the region -52 to -102 (i.e., between c.-114 to -1) of the human HBG2 gene.
Regarding claims 34-35, Ran teaches that in the double nickase method, the region between the two targeted sequences is often deleted (Fig 2).
It would have been entirely predictable that applying Ran’s method of double nicking to improve Traxler’s method would have resulted in a partial or complete deletion of the 13 nt region because Ran demonstrates the results of the paired nicking strategy results in indels and deletions of the sequence between the off-set guide RNA targeted sequences.
Regarding claim 36, Ran teaches that in the double nickase strategy, the two SSBs are repaired by NHEJ (i.e., in an error prone manner) (Fig 2B, legend).
Claims 26-27 are rejected under 35 U.S.C. 103 as being unpatentable over Traxler (Traxler et al., Nature Medicine (2016), 22: 987-990 and Supplemental Material), Ran (Ran et al., Cell (2013), 154: 1380-1389) and Genbank (GU324926.1 Homo sapiens hemoglobin, gamma G (HBG2) gene, complete cds, available August 10, 2010, https://www.ncbi.nlm.nih.gov/nucleotide/GU324926.1, [retrieved April 28, 2026]) as applied to claims 1, 3-5, 7-12, 25, 30-36 above, and further in view of Gundry (Gundry et al., Cell Reports (2016), 17: 1453-1461).
The teachings of Traxler, Ran and Genbank are recited above and applied as for claims 1, 3-5, 7-12, 25, 30-36. Traxler, Ran and Genbank do not teach contacting cells with Cas9/gRNA ribonucleoproteins (RNPs) via electroporation.
Regarding claims 26-27, Gundry teaches developing a CRISPR/Cas9-mediated gene disruption method in human HSPCs by delivering Cas9/gRNA RNPs (Abstract). Gundry teaches synthesizing pairs of gRNA, forming Cas9/gRNA RNPs with the gRNA pairs, and delivering the RNPs by electroporation to primary CD34+ cord blood cells (page 1459, ¶4-5; Figure S4G; Supplemental methods pages 12-13). Gundry teaches targeted gene disruption efficiency of 75% of human HPSCs using the Cas9/gRNA RNP electroporation method (Abstract).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have introduced the Cas9n/gRNA pairs into the HPSCs in the method rendered obvious above by electroporation of the RNP. It would have amounted to substitution of one means to introduce Cas9n/sgRNA pairs to a cell for another by known means to yield predictable results. The skilled artisan would have predicted that the Cas9n/sgRNA RNPs could be introduced by electroporation because the RNPs of Ran differ from the RNPs of Gundry by a single amino acid substitution (D10A) and the gRNA targeting sequence. Thus, it would have been entirely predictable that Cas9n/gRNA electroporated into cells would reach and edit their intended target. One would have been motivated to introduce the double nickase editing system by RNP electroporation because Gundry teaches that such a method results in extremely efficient gene disruption in human HPSCs, which is the purpose of Ran’s method, Traxler’s method, and the method rendered obvious for claim 1.
Statutory Double Patenting
A rejection based on double patenting of the “same invention” type finds its support in the language of 35 U.S.C. 101 which states that “whoever invents or discovers any new and useful process... may obtain a patent therefor...” (Emphasis added). Thus, the term “same invention,” in this context, means an invention drawn to identical subject matter. See Miller v. Eagle Mfg. Co., 151 U.S. 186 (1894); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Ockert, 245 F.2d 467, 114 USPQ 330 (CCPA 1957).
A statutory type (35 U.S.C. 101) double patenting rejection can be overcome by canceling or amending the claims that are directed to the same invention so they are no longer coextensive in scope. The filing of a terminal disclaimer cannot overcome a double patenting rejection based upon 35 U.S.C. 101.
Claim 10 is rejected under 35 U.S.C. 101 as claiming the same invention as that of claim 1 of prior U.S. Patent No. 11851690. This is a statutory double patenting rejection.
Patented claim 1 recites all the limitations of claim 1 of the examined application. Examined claim 10 recites the additional limitation “wherein at least one of the first and second targeting domains differ by no more than 3 nucleotides from a targeting domain listed in Table 7.” Table 7 recites 13 targeting domain sequences with SEQ ID NOs 277, 338, 327, 299, 276, 333, 278, 339, 310, 340, 940, 941, and 942, which are identical to the SEQ ID NOs and sequences recited in patented claim 1. Thus, examined claim 10 is coextensive with patented claim 1.
Nonstatutory Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 3-5, 7-9, 11-12, 25-27, 30-36 rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-12 of U.S. Patent No. 11851690. Claims 33-36 are rejected in view of Traxler (Traxler et al., Nature Medicine (2016), 22: 987-990 and Supplemental Material).
Patented claim 1 recites A genome editing system, comprising: an RNA-guided nuclease; a first guide RNA; a second guide RNA, and a nucleic acid template encoding a deletion of a 13 nt region of a human HBG1 or HBG2 gene, wherein the first and second guide RNAs comprise first and second targeting domains complementary to first and second sequences on opposite sides of positions of the 13 nt target region of a human HBG1 or HBG2 gene, wherein one or both of the first and second sequences optionally overlaps the 13 nt target region of the human HBG1 or HBG2 gene, and wherein at least one of the first and second targeting domains differs by no more than 3 nucleotides from a targeting domain selected from the group consisting of SEQ ID NOs: 277, 338, 327, 299, 276, 333, 278, 339, 310, 340, 940, 941, and 942. The recited SEQ ID NOs are the same as the SEQ ID NOs of the examined application and are present in Table 7 and also target recited HGB1/2 promoter regions of claims 7-9. Patented claims 2-6 recite the same limitations found in examined claims 3-5 and 11-12. Therefore, the patented claims anticipated examined product claims 1, 3-5, 7-9 and 11-12. Patented claim 7 recites A method of altering a cell, comprising contacting a cell with the genome editing system of claim 1. Patented method claims 8-12 recite the same limitations found in examined claims 26-27 and 30-33. Therefore, the patented claims anticipated examined method claims 25-27 and 30-32.
The patented methods to not expressly recite the patented systems create SSBs or DSBs in the targeted HGB1/2 promoter region.
The teachings of Traxler are recited above in paragraphs 12, 17-19, and 21 and are incorporated here. It would have been obvious to one skilled in the art that the patented methods using the patented systems would generate DSBs in the recited regions because Traxler teaches guide RNAs complexed with Cas9 and targeted to the same region produced DSBs and that result in indels and deletions upon repair of the targeted 13 nt region of the HGB1/2 promoter.
Conclusion
No claims are allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/CATHERINE KONOPKA/Primary Examiner, Art Unit 1635
Prosecution Insights