DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant’s correspondence received on 12/16/2025. Claims 1-2 and 5-10 are pending. Claims 1, 6, and 8-10 have been amended. Claims 3-4 have been cancelled. All pending claims are currently under examination.
Any rejection or objection not reiterated has been overcome. Applicant’s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow. This Office Action is Final.
Priority
The Applicant is claiming an earliest effective filing date to provisional applications such as 62/093,588 (filed 12/18/2014) and 62/239, 546 (filed 10/09/2015). However, instant SEQ ID NO: 47 does not appear to be disclosed within the continuity chain of the presently filed application until it is disclosed in application 15/881,684, filed 1/26/2018. Thus, the earliest effective filing date of the claimed subject matter of claim 9, drawn to SEQ ID NO: 47, is 1/26/2018.
Claim Rejections - 35 USC § 112 – Updated in Response to Amendments
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 6-9 rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claims 6 and 8, these claims recite “the X target specific spacer domain” and “the Z tracrRNA binding domain.” However, no “X” or “Z” domains are previously recited in these independent claims; recitation of these two domains therefor lacks proper antecedent basis and render the overall structure of the recited crRNA unclear.
Claims 7 and 9 depend from claims 6 and 8, respectively, and do not resolve this issue; claims 7 and 9 are therefore also rejected. With regards to claim 9, although claim 9 recites a specific sequence (SEQ ID NO: 47), it is unclear if this sequence reads on the independent claim 8 because the overall structure of claim 8 is unclear. For instance, from the language of claim 8, it is unclear what the “X” domain would be with regards to SEQ ID NO: 47.
Response to Arguments
The Applicant’s arguments filed 12/16/2025 have been considered but are not persuasive. The Applicant argues that their amendments clarify the previous antecedence issue. This argument is not persuasive because the amendments raise new antecedence issues. For instance, no “X target specific spacer domain” is previously recited in independent claims 6 and 8, therefore recitation of “the X target specific spacer domain” lacks antecedent basis.
Duplicate Claim Warning – New Warning Necessitated by Amendment
Applicant is advised that should claim 6 be found allowable, claim 8 will be objected to under 37 CFR 1.75 as being a substantial duplicate thereof. When two claims in an application are duplicates or else are so close in content that they both cover the same thing, despite a slight difference in wording, it is proper after allowing one claim to object to the other as being a substantial duplicate of the allowed claim. See MPEP § 608.01(m). In the present case, claim 8 has identical wording to claim 6.
Claim Rejections - 35 USC § 112 – New Rejection Necessitated by Amendment
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 9 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Regarding claim 9, claim 9 depends from claim 8, where claim 8 requires end modifications such as C3 or ZEN at the 5’ and/or 3’ ends. However, SEQ ID NO: 47, as recited in the sequence listing and in the specification (Table 8, page 47) does not comprise either C3 or ZEN modifications. Thus, claim 9 does not include the limitations required in the claim from which it depends because SEQ ID NO: 47 does not comprise either C3 or ZEN modifications. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 103 – New Rejection Necessitated by Amendment
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-2, 6, 8, and 10 are rejected under 35 U.S.C. 103 as being unpatentable over Cigan (WO 2015/026885 A1, filed 8/20/2014, published 2/26/2015) in view of Lennox (Lennox KA et al. Mol Ther Nucleic Acids. 2013 Aug 27;2(8):e117).
Regarding claim 1, Cigan teaches a crRNA “that is complementary to a nucleotide sequence in a target DNA” (page 24, lines 21-24) and a Cas endonuclease recognition domain “that interacts with a Cas endonuclease” (page 24, lines 25-26; see also Figures 1A which a crRNA molecule with 3’ and 5’ ends with variable targeting domains (VT) and Cas endonuclease recognition (CER) domains, i.e., Cigan teaches the “X” and “Z” domains recited in instant claim 1). Cigan teaches that the variable domain (VT) can vary in length, anywhere from 12-30 nucleotides (page 26, first paragraph); Cigan therefore teaches that the crRNA is “length modified” relative to wildtype because Cigan teaches that the variable region can span a number of nucleotides and is therefore inherently length-modified relative to a wildtype sequence (page 26, first paragraph). Cigan teaches that the gRNA may contain “synthetic, non-natural, or altered nucleotide bases” and therefore teaches “chemically modified” forms of the crRNA relative to wildtype (page 61, lines 19-20). Example 4 of Cigan teaches “modifying the nucleotide base, phosphodiester bond linkage or molecular topography of the guiding nucleic acid component(s) of the guide polynucleotide/Cas endonuclease system,” (page 104, final two lines to page 105, line 1). Furthermore, Cigan teaches, at Table 7 of Example 4 (top of page 107) examples of nuclease resistant nucleotide and phosphodiester bond modifications which include “2’-O-Methly RNA Bases,” “Locked Nucleic Acids,” (LNAs), and “phosphorothioate bonds” which may be introduced “to reduce unwanted degradation” of the gRNA (page 106 lines 16-17). With regards to these modifications and their location in the gRNA, Cigan teaches that:
“modifications may be introduced at the 5' and 3' ends of any one of the nucleic acid residues comprising the VT or GER domains to inhibit exonuclease cleavage activity, can be introduced in the middle of the nucleic acid sequence comprising the VT or GER domains to slow endonuclease cleavage activity or can be introduced throughout the nucleic acid sequences comprising the VT or GER domains to provide protection from both exo- and endo-nucleases” page 106, lines 19-25.
Cigan therefore teaches that the modifications which they teach reasonably encompass both the 5’ and 3’ ends, which includes the nucleotides from 1-12 of both ends as Cigan teaches that the modifications can occur either at the ends or middle of crRNA molecule or the middle. Furthermore, given that Cigan teaches that one purpose is to inhibit “exonuclase” activity, the practitioner can immediately envision putting the modifications at the end of the nucleic acid, where exonucleases target nucleic acids. Thus, the modifications taught by Cigan include 2’O-methyl, LNA, and phosphorothioate modifications within 12 nucleotides of both the 5’ and 3 ends (page 106, lines 19-25). Cigan teaches that the 2’-O-methyl modification can add the beneficial feature of modified and regulated molecular stability (page 27, second paragraph). Cigan therefore teaches the 2’-O-methyl modification, its role in enhancing molecular stability, and also teaches several nuclease-resistant modifications to be used in conjunction with the 2’-O-methyl modification (e.g., page 27, second paragraph). Cigan therefore teaches that modifications can occur at both the 5’ and 3’ ends the crRNA (above), which includes modifications within 12 nucleotides of either end, as recited in the present claim 1. Furthermore, at Example 5, Cigan teaches “some the nucleotide base and phosphodiester bond modifications described in Example 4 are introduced into the VT domain and/or CER domain of a crNucleotide,” (page 108, lines 16-18). Cigan teaches crRNA sequences with modifications near the ends or at the ends of VT and CER domains (e.g., sequences 64-69) (Table 8, page 109). Furthermore SEQ ID NOs 68-69 of Cigan comprise chemical modifications which include modifications up to and including the 12th nucleotide from both the 5’ and 3’ ends (Table 8 of Cigan). Cigan teaches that modifications “similar to those illustrated in Example 5 Table 8 can be introduced individually or in combination into the crRNA, crDNA, tracrRNA, tracrDNA, long guide RNA or long guide DNA nucleic acid components of the guide polynuclease system and synthesized per standard techniques,” and thereby teaches that such modifications can be used in combination with one another (page 113 lines 25-29). With regards to combining modifications taught by Cigan, Cigan teaches that “a locked nucleic acid (LNA),…a 2’-O-Methly RNA nucleotide, a phosphorothioate bond…or any combination thereof. These modifications can result in at least one additional benefit feature…selected from the group of a modified or regulated stability…modified resistance to cellular degradation, and increased cellular permeability,” (page 27, second paragraph). Thus, Cigan teaches that modifications to guide nucleic acids can have benefits such as enhanced stability (i.e., thermostability), resistance to degradation (i.e., nuclease-resistance), and increased cellular permeability, and further teaches that such modifications can be made in any combination with one another, where such modifications include LNAs, 2’O-methyl, and phosphorothioate modifications as recited in instant claim 1 (above).
Cigan teaches specific guide sequences with modifications at their ends. For instance, Cigan teaches that SEQ ID 64 of their document “includes phosphorothioate bonds at the 5' end of its nucleotide sequence (G*G*G*)” (page 14, lines 2-3). Cigan also teaches SEQ ID NO 66 which includes 2’-O-methy RNA nucleotides at its 5’ end (page 14, third paragraph). Cigan therefore teaches multiple embodiments of their invention with modifications occurring at the 5’ and 3’ ends including nuclease-resistant modifications at linkage sites and also 2’-O-methyl modification (page 14, lines 2-3, page 14, third paragraph). Cigan therefore teaches a plurality of modifications within 12 nucleotides of the “X” and “Z” domains of the crRNA molecule, where such chemical modifications can be made in combination with one another.
Cigan teaches the cleavage of target sequences using guide RNA/Cas nuclease complexes, and therefore teaches that the crRNA is active in a CRISPR/Cas system (e.g., Figures 3A and 8, and throughout).
Cigan’s embodiments of crRNA in Table 8 include crRNAs with a plurality of phosphorothioate modifications within 12 nucleotides of the 5’ and 3’ ends (the crRNA molecule rendered by SEQ ID numbers 64-65, where there are 3 PS linkages at the 5’ and 3’ ends), and a plurality of modifications within 12 nucleotides of the 5’ and 3’ ends which are 2’-O-methyl (the crRNAs rendered by SEQ ID numbers 66-67 and 68-69, to include “at least 2” 2’-O-methyl modifications at the 5’ and 3’ ends of the crRNA). Thus, Cigan teaches crRNAs with pluralities of modifications which read on items “g” + “h” and “e” + “f” of claim 1 (see Table 8). Furthermore, given that Cigan also teaches the benefits of LNAs, and additionally teaches that the modifications they teach can be used in combination with one another, a practitioner could also immediately envision a crRNA with a combination of LNAs (items “I” and “j” of claim 1), 2’-O-methyl, and phosphorothioate linkages given the strong motivational teaching of Cigan.
Cigan, while teaching length-modified and chemically modified crRNA does not specifically teach the end modifications C3 and ZEN.
Lennox is a research article which focuses on chemical modifications to improve synthetic nucleic acid molecules (Title, Abstract, and throughout). Lennox and Cigan therefore directly overlap in subject matter and field of endeavor. Lennox, like Cigan, teaches the benefits of using PS, LNA, and 2’ O methyl modifications when using targeting RNAs (Abstract). Further, Lennox teaches introduction of ZEN end modifications at both ends, used in combination with 2’ O methyl modification, to block exonuclease activity (Abstract). Lennox teaches functional embodiments of their invention, teach that such ZEN modifications block exonuclease activity and have relatively low toxcitiy in cells (Abstract). Furthermore, Lennox teaches that using the end modification C3 in combination with ZEN also results in nucleic acids that were “totally resistant” to degradation in serum and cell extracts (page 5, left column, first paragraph). Thus, Lennox teaches the end modifications ZEN and C3, reduces them to practice, where such modifications do not inhibit normal functionality of the molecules, and furthermore where the addition of ZEN and C3 has a desirable effect of reducing degradation and having lower toxicity (Abstract, page 5, left column, first paragraph).
It would have been obvious to a person of ordinary skill in the art before the effective filing date to combine the crRNAs and their modifications taught by Cigan with the ZEN and/or C3 end modifications taught by Lennox because such a combination is the simple combination of known prior art elements to arrive at a predictable result. Furthermore, the combination is not simply a combination of elements; the practitioner would be motivated to make the combination owing to the highly motivational teachings provided by Lennox who teaches that the addition of end modifications such as ZEN and C3 can totally prevent degradation of the molecule and have shown less cellular toxicity. Furthermore, Lennox has reduced such end modifications to practice using functional nucleic acids, where functionality was still demonstrated. Thus, the results are predictable, as the end modifications would be used for the same purpose in both Cigan (who teaches reduced degradation as a desirable quality) and Lennox, where both prior art documents are focused on modifications to functional RNA molecules.
Regarding claim 2, Cigan teaches that the protospacer domain (“VT” domain, so-called by Cigan) can be 17-20 nucleotides (page 26, first paragraph).
Regarding claim 6, for the purposes of this rejection, and in the interest of compact prosecution, the crRNA recited in claim 6 is being interpreted to share the structure of the crRNA recited in claim 1 (see 112(b) rejection, above). As discussed above, Cigan/Lennox renders obvious the crRNA structures recited in both claims 1 and 6 (see rejection of claim 1). Furthermore, Cigan also teaches a method of gene editing comprising contacting a target site with a crRNA and CRISPR/Cas endonuclease system, where the crRNA has a tracRNA binding domain (e.g., see page 2, final paragraph, page 44 second paragraph, page 46, and Figure 3A).
Regarding claim 8, for the purposes of this rejection, and in the interest of compact prosecution, the crRNA recited in claim 8 is being interpreted to share the structure of the crRNA recited in claim 1 (see 112(b) rejection, above). As discussed above, Cigan/Lennox render obvious the crRNA structures recited in both claims 1 and 8 (see rejection of claim 1). Furthermore, Cigan teaches:
“methods are provided employing a guide polynucleotide/Cas endonuclease system for genome modification of a target sequence in the genome of a cell or organism, for gene editing, and for inserting a polynucleotide of interest into the genome of a cell or organism. The methods and compositions employ a guide polynucleotide/Cas endonuclease system to provide for an effective system for modifying or altering target sites and editing nucleotide sequences of interest within the genome of cell, wherein the guide polynucleotide is comprised of a DNA, RNA or a DNA-RNA combination sequence,” (page 2, second paragraph).
Cigan teaches that the crRNA comprises a tracrRNA binding domain (Figure 3A).
Regarding claim 10, Cigan teaches “at least two phosphorothioate internucleotide linkages” at both the 5’ and 3’ ends within 12 nucleotides of the ends (elements “e” and “f” of claim 10, SEQ ID NOs 64-65 of Table 8, page 109). Cigan furthermore teaches “at least 2” 2’-O-methyl modifications at the 5’ and 3’ ends within 12 nucleotides of the ends (elements “g” and h” of claim 10, SEQ ID NOs 66-67 of Table 8, page 109). Furthermore, Cigan teaches that these modifications can be used in combination with on another (page 27, second paragraph). Cigan furthermore teaches that such modifications can not only be used in combination with one another, but that such modifications have beneficial outcomes (page 27, second paragraph). Thus, given that Cigan teaches each of elements “e,” “f,” “g,” and “h” of claim 10, and that such elements can be used in combination with another with beneficial outcomes, a practitioner could immediately envision a combination of the elements taught by Cigan (above). Furthermore, as discussed above, Lennox teaches combination of using the end modifications of ZEN and C3, as well as their beneficial properties of decreasing degradation and reducing cellular toxicity (Abstract).
Claims 5 and 7 are rejected under 35 U.S.C. 103 as being unpatentable over Cigan (WO 2015/026885 A1, filed 8/20/2014, published 2/26/2015) and Lennox (Lennox KA et al. Mol Ther Nucleic Acids. 2013 Aug 27;2(8):e117), as applied to claims 1-2, 6, 8, and 10, in view of Jinek (Jinek M et al. Science. 2012 Aug 17;337(6096):816-21).
Regarding claims 1-2, 6, 8, and 10, a discussion of these claims is given the 103 rejection and incorporated herein.
Regarding claims 5 and 7, Cigan teaches length modifications of the crRNA (page 26, first paragraph). Cigan does not specifically teach that the tracrRNA binding domain consists of SEQ ID NO 43.
Jinek is a research article which teaches structural analyses of dual-guide endonuclease systems (Title, Abstract, and throughout). Jinek teaches that the crRNA can be length-modified while still retaining its functionality (Figure 3B and 3C). For instance, Jinek teaches an embodiment of crRNA, wherein the crRNA comprises a protospacer/targeting domain which is 20 nucleotides in length (i.e., the “X” domain recited in claim 1), where various lengths of tracrRNA binding domain of the crRNA are still functional (i.e., domain “Z” of the crRNA recited in claim 1, Figures 3B and 3C). Jinek teaches an embodiment of crRNA comprising a tracrRNA binding domain wherein the crRNA is truncated (length-modified) to comprise nucleotides 1-32 and/or 1-36 of the crRNA:
AUAACUCAAUUUGUAAAAAAGUUUUAGAGCUA (crRNA fragment 1-32, Jinek, Figure 3B/3C
GUUUUAGAGCUAUGCU (RNA equivalent of SEQ ID NO 43, instant application) AUAACUCAAUUUGUAAAAAAGUUUUAGAGCUAUGCU (crRNA fragment 1-36, Jinek, Figure 3B/3C)
In the above alignment, note that the tracrRNA binding domain of the 1-36 crRNA fragment taught by Jinek in Figures 3B/3C is 100% identical to SEQ ID NO 43 (the tracrRNA domain is bold and underlined, the initial 20 nucleotides of the crRNA fragments taught by Jinek are simply modifiable target sequences). Furthermore, Jinek teaches that crRNAs with shortened/length-modified tracrRNA binding domains are fully functional (Figure 3B, column entitled “1-36,” which depicts cleaved target DNA using the 1-36 crRNA with truncated tracrRNA binding domain consisting of instant SEQ ID NO 43). Jinek therefore teaches that crRNA with tracrRNA binding domains consisting of SEQ ID NO 43 are not only known in the art but also fully functional, and are therefore known to be operational embodiments of CRISPR/Cas systems.
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the tracrRNA binding domains already taught by Cigan with truncated tracrRNA binding domains taught by Jinek because such a combination of prior art elements is the simple substitution of one known prior art element for another to obtain predictable results. In the present case, a practitioner would simply substitute the tracrRNA binding domains taught by Cigan with the tracrRNA binding domain taught by Jinek, where such truncated versions of the tracrRNA binding domain are already known to function in CRISPR/Cas systems. Furthermore, the substitution yields predictable results because both Cigan and Jinek are directed to targeted DNA cleavage using CRISPR/Cas systems and crRNAs; therefore, the combination is predictable because each of the elements of the references cited are not only known in the art but are also being used for the same purposes and designs as have already been taught and reduced to practice.
Claim 9 is rejected under 35 U.S.C. 103 as being unpatentable over Cigan (WO 2015/026885 A1, filed 8/20/2014, published 2/26/2015) in view of Lennox (Lennox KA et al. Mol Ther Nucleic Acids. 2013 Aug 27;2(8):e117), as applied to claims 1-2, 6, 8, and 10, above, and further in view of Rahdar (WO 2017/004261 A1, published 1/5/2017).
Regarding claims 1-2, 6, 8, and 10, a discussion of Cigan and Lennox is provided above and incorporated here.
Regarding claim 9, claim 9 recites SEQ ID NO: 47, which is a crRNA designed to target VEGF, where the ends are modified with PS modifications (see Table 8 on page 47 of the specification for a description of instant SEQ ID NO: 47). Cigan teaches a method of gene editing comprising contacting a target site with a crRNA and CRISPR/Cas endonuclease system, where the crRNA has a tracRNA binding domain (e.g., see page 2, final paragraph, page 44 second paragraph, page 46, and Figure 3A). Furthermore, Cigan teaches crRNA with end-modified nucleotides, including at the 5’ and 3’ ends, where such modifications can be PS modifications (see Table 8 of Cigan, second row).
Cigan, while teaching the targeting of specific loci, and teaching that end modifications of crRNA can include 3’ and 5’ PS linkages, does not specifically teach SEQ ID NO: 47.
Rahdar is a paten document which focuses on modified CRISPR Cas systems using modified crRNAs (Title, Abstract, and throughout). Rahdar and Cigan therefore directly overlap in subject matter and field of endeavor. Rahdar teaches crRNA modifications such as PS modifications page 36, final paragraph). Furthermore, Rahdar teaches length-modifying crRNAs, where such modifications render functional crRNAs (see Example 4). Furthermore, the crRNAs which are chemically and length modified taught by Rahdar are specifically designed to target VEGF (see Examples 3 and 4 of Rahdar, e.g., Tables 3 and 4). Regarding such crRNAs that target VEGF, an alignment of crRNA embodiments is shown below with reference to instant SEQ ID NO: 47:
ggtgagtgagtgtgtgcgtggttttagagctatgctgttttg – SEQ ID NO: 9 from Rahdar
ggtgagtgagtgtgtgcgtggttttagagctatgct – SEQ ID NO: 47, instant
gagugagugugugcgugguuutagagcta – SEQ ID NO: 13 from Rahdar
As shown above, SEQ ID NOs 9 and 13 taught by Rahdar (from Tables 3 and 4 of Rahdar) are 100% matches to instant SEQ ID NO: 47, where SEQ ID NO: 9 of Rahdar is longer than instant SEQ ID NO: 47 and SEQ ID NO: 13 is shorter. Note that one “t” nucleotide of SEQ ID NO: 13 replaces one “u” residue of SEQ ID NO: 47; however, this difference is not viewed as being significant, as both residues “t” and “u” base pair with adenine, and are therefore functionally equivalent. Furthermore, per Tables 3 and 4, SEQ ID NOs 9 and 13 of Rahdar comprise PS modifications at the 5’ and 3’ ends. Thus, Rahdar has already taught a range of functional crRNAs which target VEGF, share 100% sequence identity, and comprise PS linkages at the 5’ and 3’ ends.
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the crRNAs taught by Cigan with the VEGF-targeting crRNAs taught by Rahdar because such a combination is the simple substitution of one known prior art element for another with predictable results. In the present case, Rahdar teaches that VEGF has already been targeted with length- and chemically-modified crRNAs, where they teach range of acceptably length-modified crRNAs which encompasses instant SEQ ID NO: 47 and match it 100%. Thus, given that Rahdar has taught even shorter functional embodiments of SEQ ID NO: 47 and shown its functionality (i..e, Rahdar’s SEQ ID NO: 13), the results are predictable. Furthermore, the results are predictable because both CIgan and Rahdar teach modifications including PS modifications at the 5’ and 3’ ends, where Rahdar reduced such a crRNA to practice (SEQ ID NOs 9 and 13).
Response to Arguments
The Applicant’s arguments submitted 12/16/2025 have been reviewed but are not persuasive. The Applicant argues that Cigan does not teach ZEN or C3 modifications. This argument is found to be persuasive. However, as the requirement of ZEN and C3 end modifications is a newly recited required feature of the claims, a new search was performed. The new search uncovered Lennox, which teaches both ZEN and C3 modifications, and furthermore teaches that such end modifications block exonuclease attack when applied to nucleic acids (Abstract). Thus, Lennox teaches that the inclusion of such ZEN and C3 molecules is known to be useful for RNA applications, where furthermore CIgan teaches a direct motivation to prevent exonuclease degradation because they teach that a goal of their modifications is to block exonuclease degradation (see 103 rejection above). The claimed invention is therefore obvious because ZEN and C3 were known in the art to have to the same beneficial function of exonuclease degradation prevention that was the goal of Cigan’s modifications. The practitioner is therefore motivated to incorporate the teachings of Lennox with Cigan to arrive at the claimed invention.
The Applicant argues that Cigan is limited to terminal modifications, and does not teach the internal modifications “required” by their claim. This argument is not found to be persuasive because 1) Cigan teaches that their modifications can and should be made throughout the crRNA domains to prevent endonuclease attach, and are therefore not limited to only the ends of the crRNA molecules and 2) the present claims do not require internal modifications, where the present claims broadly encompass modifications only at the ends of the crRNA molecules (i..e, recitation of “10-12” nucleotides from the ends includes the ends). Furthermore, Cigan teaches the benefits of combining modifications, where furthermore Lennox also teaches the combination of multiple modifications for improvements (2’-O methyl plus ZEN, Abstract). Thus, the Applicant’s arguments that CIgan does not teach combinations of their modifications is not persuasive because Cigan does teach that the modifications can be combined (see 103 rejection, above) and Lennox also teaches that modifications such as ZEN can be combined with 2’-O methyl modifications with beneficial effect (Abstract). The combination of modifications such as LNA, PS, 2’O methyl, ZEN, and C3 is therefore obvious given the teachings of Cigan and Lennox.
Furthermore, Cigan and Lennox both teach that the modifications reduce degradation by exonucleases (see 103 rejection, above). Thus, a practitioner would immediately understand that such modifications could be made at the region 10-12 nucleotides from the 5’ and 3’ ends, as the practitioner would understand that exonucleases attack the ends of nucleic acids.
The Applicant argues that CIgan only offers generic teachings with regards to modifications and their placement. This argument is not persuasive . As an initial matter, Cigan teaches embodiments with modifications throughout the crRNA (e.g., Table 8, row 4). Cigan further teaches substantial motivation to include modifications throughout the molecule, to protect from both exonuclease (i..e, the ends) and endonucleases (i.e., throughout the molecule, page 106, final paragraph). The practitioner is therefore motivated to include modifications that are reasonably 10-12 nucleotides from either end of the crRNA. Furthermore, with regards to the argument that the present modifications are made within ‘narrowly defined’ domains: the claims are drawn to modifications spanning 12 nucleotides of both ends of crRNAs which are as short as 36 nucleotides long (e.g., SEQ ID NO: 47 and its nucleic acid sequence). The “narrowly defined” domains, as the Applicant argues, therefore encompass two-thirds of the molecule, and are therefore hardly “narrowly defined.” Given that Cigan teaches end modifications (which are embodiments of the present claims, i.e., within 1-3 nucleotides of the 5’ and 3’ ends falls within “10-12” nucleotides of the ends), and furthermore teaches modifying the internal sites of the crRNA, it would be obvious to a practitioner to follow the advice and teachings of Cigan, and to further combine the motivational teachings of Lennox to arrive at the present subject matter.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to DOUGLAS CHARLES RYAN whose telephone number is (571)272-8406. The examiner can normally be reached M-F 8AM - 5PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/D.C.R./Examiner, Art Unit 1635
/RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635
Prosecution Insights