DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Status
Claims 55-60, 69-72, 74-77, 81-83, 85-86, 89 are pending and examined here.
In the prior action, the Applicant in the Remarks of 07/15/2026 indicates the Flynn reference cited in the 102 and 103 rejections is a post-filing reference (pg. 16-26), thus both 102 and 103 rejections are withdrawn. This is a non-final rejection.
Priority
The claim to benefit of 63/224,901 and 63/293,851, filed on 07/23/2021 and 12/27/2021, respectively, via their CON applications of 18/405072 and PCT/US22/37794, filed on 01/05/2024 and 07/21/2022, is recognized.
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 119(e) as follows:
The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994).
The disclosure of the prior-filed applications, provisional application Nos. 63/224,901 and 63/293,851, fails to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application.
Priority is a claim by claim analysis. Here, claims 55-56, 69-72, 74-77, 81-83, 85-86, 89 will receive the benefit of 07/23/2021, while claims 57-60 will receive the benefit of 12/27/2021. The method of treatment of diseases by administering claimed dsRNA agents, including SEQ ID NO: 20 and 21 along with its modification pattern, is disclosed in 63/224,901 (see pg. 140, AD-1548488.1). Biodegradable limitation is not disclosed in 63/224,901 and not all cationic lipids are biodegradable, thus claim 57 and its dependents will receive the benefit of 12/27/2021.
Information Disclosure Statement
One of the information disclosure statement (IDS) submitted on 07/15/2026 was filed before the mailing date of instant Office Action. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
The other information disclosure statement, i.e. the “IDS,” filed 07/15/2026 fails to comply with the provisions of 37 CFR 1.97, 1.98 and MPEP § 609 because it provides a list of pending U.S. applications, U.S. Patents and U.S. Publications without noting inventors and publication date of U.S. Publication and Foreign patent documents require document number, country and publication. See MPEP 609.01(B)(1)(e)(i-iii).
It has been placed in the application file, but the information referred to therein has not been considered as to the merits. Applicant is advised that the date of any re-submission of any item of information contained in this information disclosure statement or the submission of any missing element(s) will be the date of submission for purposes of determining compliance with the requirements based on the time of filing the statement, including all certification requirements for statements under 37 CFR 1.97(e). See MPEP § 609.05(a).
Claim Objections
Objection to claims 69 and 77 is withdrawn. Claim 69 extra comma is removed and appropriate indefinite article is used; the latter is the appropriate correction for cl. 77.
Claim Rejections - 35 USC § 112
35 U.S.C. 112(a)
Rejection of cl. 89 under 112(a) lack of written description is withdrawn; the claim recites therapeutic agents with support for written description.
Enablement:
Rejection of claims 55-60, 69-72, 75-77, 82-83, 85-86, 89 under 112(a) scope of enablement is maintained.
Claims 55-60, 69-72, 75-77, 82-83, 85-86, 89 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a method of treating a subject having hepatocellular carcinoma (HCC), does not reasonably provide enablement for a method of treating a subject having any CTNNB1-associated cancer. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims.
When considering the scope of enablement, the Wands factors need to be reviewed, which poses whether the experimentation needed to practice the invention is undue or unreasonable. Determining undue experimentation requires analysis of, but not limited to: (A) The breadth of the claims; (B) The nature of the invention; (C) The state of the prior art; (D) The level of one of ordinary skill; (E) The level of predictability in the art; (F) The amount of direction provided by the inventor; (G) The existence of working examples; and (H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure.
In the instant case:
The breadth of the claims/nature of invention: Claim 69 is directed to a method of inhibiting expression of CTNNB1 gene in a cell, the method comprising contacting the cell with the claimed dsRNA agent for inhibiting expression of CTNNB1 in a cell. Dependent claims 70 and 71 are directed to the cell in a subject and the subject is a human, respectively. Under BRI, claim 69 can be broadly interpreted to encompass any cell in vivo or in vitro expressing CTNNB1, including both under- and over-expressing CTNNB1, with any type of CTNNB1-associated cancer. Similarly claim 77 is directed to administering to a subject a therapeutically effective amount of the claimed dsRNA agent for inhibiting expression of CTNNB1 in a cell. Similarly, under BRI, the claim can be broadly interpreted to administering to any subject with any type of CTNNB1-associated cancer, encompassing a subject with both under-expressing and over-expressing of CTNNB1, that would benefit from reduction of any amount of CTNNB1 expression.
The state of the prior art: There is uncertainty in the field of treating any type of cancer. Similarly, there is uncertainty in the art of CTNNB1 expression and its association with cancer, since pathophysiology of each cancer is unique. CTNNB1 is an intermediate signaling molecule in Wnt signaling pathway. Under normal condition in absence of Wnt ligands, CTNNB1 expression is kept at a low level (pg. 1, line 35-36). However, upon Wnt activation or genetic mutations of Wnt components, the CTNNB1 accumulates and migrates to the nucleus to activate expression of numerous oncogenes, and thus the “aberrant high expression of CTNNB1 leads to various diseases including cancer” (pg. 1, line 36 to pg. 2, line 1 ).
Tanabe et al. (2016 World J. of Stem Cells, 8, 384-395) using bioinformatics and gene array to investigate CTNNB1 pathway signaling in gastric cancer and stem cells disclose that CTNNB1, which is mutated in HCC (pg. 385), is involved in 21 pathway cascades and its inhibition induces apoptosis (pg. 389). Tanabe illustrates a complex network of molecules associated with CTNNB1, see Fig. 5. Focusing on a gastric adenocarcinoma, the authors noted that for cancers with CTNNB1 mutations also had several other gene mutations occurred concurrently (pg. 389). Merging results of bioinformatics and gene array analysis, illustrated in Fig. 5A and 5B, demonstrate multiple genes that are also mutated along with CTNNB1 in stomach adenocarcinoma along with CTNNB1 relationship in several signaling networks (see Fig. 5A, 5B, pg. 392). Thus, it is entirely possible that for certain cancers there is dysfunction of downstream regulators independent of or in addition to CTNNB1 and therefore decreasing CTNNB1 would not achieve the treatment goal of treating gastric cancer.
Calvisi et al. (2001, Cancer Research, 61, 2085-2091) characterized CTNNB1’s involvement in developing spontaneous liver cancer or with treatment with chemicals in certain transgenic mice (abstract). Focusing on animals that developed CTNNB1 mutations, Calvisi noted an often CTNNB1 mutant (Ser45 to Phe) that is also identified in HCC and other cancers (pg. 2086). In certain transgenic mice cells, it was noted that despite low activated CTNNB1 levels in certain mouse tumor cell lines, the Wnt target genes were still strongly upregulated, suggesting for some cancers that transcription of Wnt target oncogenes in the “absence of B-catenin activation” (pg. 2090). Thus, it is uncertain that administration of claimed dsRNA targeting CTNNB1 will result in treatment of any cancer and would require undue experimentation.
The level of one of ordinary skill: The level of one of ordinary skill in the art is high.
The level of predictability in the art: As noted above, based on studies of Tanabe and Calvisi that the art of treating cancer is unpredictable since there are complex pathways involved.
The amount of direction provided by the inventor/existence of working examples: Although prior art and specification strongly suggest involvement of CTNNB1 in HCC, the specification fails to demonstrate a method of treating any cancer, or at least several different types of cancers, followed by administration of claimed dsRNA agent in any subject. The specification demonstrates downregulation of CTNNB1 expression following administration of dsRNA agents targeting CTNNB1 in vitro and in vivo, including in non-human primates (pg. 199, Ex. 4), (see Ex. 1-4, Fig. 1), but does not demonstrate treatment of various types of cancers following downregulation of CTNNB1. As noted above, there is uncertainty in the art of treatment of any cancer when multiple signaling pathways are involved or in cancer with several concurrent mutations. Thus, it would require undue experimentation to determine that administration of claimed dsRNA agent targeting CTNNB1 will treat any cancer in a subject, since it would require testing in subjects with or models of various types of cancers that is commensurate with the scope of the broadly recited claims.
The quantity of experimentation: Thus, it would require undue experimentation that administration of claimed dsRNA agent targeting CTNNB1 will treat any CTNNB1-associated cancer in a subject, since it would require testing in subjects with various types of cancers or cellular model of cancers that is commensurate with the scope of the broadly recited claims. Thus, while the specification and prior art describe a method of treating a subject having hepatocellular carcinoma (HCC) as enabling, the specification does not reasonably provide enablement for a method of treating a subject having any cancer and would require undue experimentation.
Thus, claims 55-60, 69-72, 75-77, 82-83, 85-86, 89 are rejected under 35 USC 112(a).
Response to Arguments
Applicant's arguments filed 07/15/2026 (“the Remarks”) have been fully considered but they are not persuasive.
The Remarks traverses the enablement rejection by raising following arguments:
First, the claim has been amended to “CTNNB1-associated cancer” (pg. 9). There is sufficient nexus between delivery of the claimed dsRNA agents and the treatment of a subject having claimed cancer along with HCC as an exemplary CTNNB1-associated cancer (pg. 11). Further, cites the specification to note that “aberrant high expression of B-catenin leads to various diseases including cancer” (pg. 11).
The specification teaches making the claimed dsRNA agent and teaches methods of delivery and administering suitable doses for in vivo application of the recited dsRNA agents (pg. 9). Further, the specification discloses claimed dsRNA agent (AD-1548488) “potently inhibit CTNNB1 mRNA expression in vitro in Hep3B cells” and similar inhibitory activity in vivo in non-human primates (pg. 9-10).
Further, “clinical data is not required in order to prove an invention is enabled” and that “invention must be given the presumption of correctness and operativeness,” citing MPEP 2164.04 (pg. 11-12).
The argument is not persuasive.
Starting with argument 3), Examiner agrees that clinical data is not required and has not stated in the action that clinical data is required. Further, Examiner also would add that MPEP does not require “a disclosure of every operable species” when predictable factors are involved in the art (MPEP 2164.03). However, the language of “CTNNB1-associated cancer” is a very broad scope and MPEP requires that enablement is examined as to “whether everything within the scope of the claim is enabled” (MPEP 2164.08). The prior action has provided several species (gastric adenocarcinoma, including HCC and other cancers, see pg. 8) that have uncertainty regarding CTNNB1 mutations and cancer (i.e. “CTNNB1-associated cancer”); sometimes CTNNB1 mutations result in decreased expression of CTNNB1 levels but still have cancer (pg. 8 of 05/19/26 action). Thus, here there is uncertainty that a) due to various pathways that CTNNB1 is “associated with” and misregulation along the pathway of other factors can still result in cancer without any changes to CTNNB1 expression and b) how administration of claimed dsRNA agent in a cancer with low-expression of CTNNB1 would treat cancer.
E.g., as noted in prior action, aberrant high expression of CTNNB1 may not be the sole cause of any type of cancer, as Tanabe indicates that bioinformatic and gene array analysis indicates that multiple genes are also mutated along with CTNNB1 in stomach adenocarcinoma (see pg. 8 of 05/19/26 action). Thus, the rejection of claims reciting non-HCC related cancer is maintained.
Then to arguments 1 and 2, inhibition of CTNNB1 levels in vivo and in vitro and dsRNA agent method of delivery was not questioned nor were the claims reciting HCC rejected in the action, thus the argument is not relevant. The issue is regarding types of cancer that would be treated following administering the claimed dsRNA agents to a subject.
Thus, rejection of claims 55-60, 69-72, 75-77, 82-83, 85-86, 89 is maintained.
35 U.S.C. 112(b)
The rejection of cl. 69, 77 under 112(b) is withdrawn due to removal of reference to table or figure. However, rejection of cl. 72, 77, 89 and the dependent claims is maintained under indefiniteness.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 72, 77, 89 and their dependent claims, 55-60, 82-83, 85-86 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
The term “CTNNB1-associated” in claims 72, 77, 89 is a relative term which renders the claim indefinite, since it attempts to provide scope limitation of cancer. The term “CTNBB-1-associated” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The specification provides guidance that treatment encompasses “reducing at least one or more sign or symptoms of a CTNNB1-associated disorder” or “unwanted CTNNB1 expression” (pg. 22, line 22-25). The term is unclear since there is no metes or bounds to what is a “CTNNB1-associated cancer” nor does the specification provide guidance in which manner is the cancer “associated” with CTNBB1, except of removing “unwanted CTNNB1 expression”.
The dependent claims 55-60, 82-83, 85-86 are rejected for indefiniteness.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 55-56, 69, 77, 70-72, 74-76, 81-83, 85-86, 89 are rejected under 35 U.S.C. 103 as being unpatentable over Brown et al. (US20130109740, pub. 05/02/2013, “Brown”), as evidenced by The Glen Research Report (2004, 17, 1-12, of record) in view of Ui-Tei et al. (2008, Nucleic Acids Research, 36, 2136-2151, referred as Ui-Tei, of record), Foster et al. (2018, Molecular Ther., 26, pg. 708-717, referred as Foster, of record) and Parmar et al. (2016, Chem. Bio. Chem., 17, 985-989, of record).
The claimed SEQ ID NOs: 20 and 21 are the following sequences:
5′-usascuguugGfAfUfugauucgasasa-3′: SEQ ID NO: 20, a 21 nt. sense strand
5′-VPudTucdGadAucaadTcCfaacaguasgsc-3′: SEQ ID NO: 21, a 23 nt. antisense strand.
Regarding instant cl. 69 and 77, Brown discloses the full sequences of instant claims. Brown discloses a method of treating hepatocellular cancer following administration of dsRNA and/or dsRNA-containing composition of Brown and a pharmaceutically acceptable carrier to a subject in an amount sufficient to treat the subject ((par. 43) and discloses reducing CTNNB1 expression in a cell (par. 45). Brown discloses Dicer substrate siRNAs (dsiRNAs) that target beta-catenin (title/abstract). The dsiRNAs comprise longer sense and antisense strands with a duplex region of at least 25 bp (in excerpt of Fig. 1 below: “DsiRNA 25/27mer” has a 25 nt. sense strand (top) and 27 nt. antisense strand (bottom) of different SEQ ID NOs than ones cited in this action). The fig. 1 illustrates Dicer cleavage site with arrowheads (par. 101). Thus dsiRNAs are longer and can be considered a modified (also non-canonical) type of a siRNA compared to a canonical siRNAs of 21 nt. with a duplex region of 19 nt. but are processed by Dicer into a 21 nt. sense and antisense strands with 2 nt. overhangs (par. 164, see “siRNA 21mer” below).
PNG
media_image1.png
200
400
media_image1.png
Greyscale
Brown discloses a dsiRNA comprising an antisense strand sequence of SEQ ID NO: 1152, a 27 nt. sequence, and a sense strand sequence of SEQ ID NO: 43, a sequence of 25 nt. (the duplex is designated βc-1816, since its target start site begins at position 1816 on the transcript). Brown’s βc-1816, comprising SEQ ID NOs: 43 and 1152 comprises instant SEQ ID NOs: 20 and 21, respectively (the bold sequence in Brown’s SEQ ID NO: 43/1152 below represent the matching sequence of instant SEQ ID NOs:20/21). Another dsiRNA, designated βc-1821, comprises SEQ ID NOs: 238/1347, which targets 5 nt. downstream of βc-1816.
(S)-Instant SEQ ID NO: 20 - uacuguuggauugauucgaaa
(AS)- Instant SEQ ID NO: 21 UUUCGAAUCAAUCCAACAGUAGC
(S) Brown: SEQ ID NO: 43: ggcuacuguuggauugauucgaaat
(AS)Brown: SEQ ID NO: 1152 -5’ AUUUCGAAUCAAUCCAACAGUAGCCUU
(S) Brown SEQ ID NO: 238 sense: cuguuggauugauucgaaaucuugc
(AS) Brown SEQ ID NO: 1347 (AS): 1 gcaagauuucgaaucaauccaacagua 27
Table 14 (see figure below, right panel) indicates that treatment of dsiRNAs βc-1816 and βc-1821 resulted in ~ 5% of the transcript remaining in human HeLa cells (some dsiRNAs also have corresponding sites in mice CTNNB1 transcript, thus are able to be tested in both mice and humans, such as βc-1821).
PNG
media_image2.png
200
400
media_image2.png
Greyscale
An excerpt of Fig. 3 chart (left panel) shows dsiRNAs oligowalk, i.e. overlapping dsiRNAs tested across a region of CTNNB1 transcript, and each dsiRNA treatment’s respective % mRNA remaining. The chart indicates that there is an accessible region between positions ~1800 - ~2140 (boxed region) of CTNNB1 transcript that allows for dsiRNA binding with very effective inhibition (at least 80% inhibition across the region).
Thus Brown discloses that treatment with βc-1816 and βc-1821 (and βc-1820) result in an efficient inhibition of CTNNB1 transcript and βc-1816 and βc-1821 target the same region targeted by instant SEQ ID NO: 20/21. Fig. 3 indicates that the region between position 1800-2140 of the CTNNB1 transcript is accessible for binding and consequent inhibition of the transcript.
Further Brown discloses that the dsiRNA can be modified at the 2’-position of the ribose sugar with 2’-fluoro (2F) or 2’-O-methyl (2OMe) modifications and indicates that the “heavily modified duplexes” can be a potent triggers of RNAi in vitro and can improve performance and extend duration of action when used in vivo (par. 298). Brown demonstrated β-catenin targeting DsiRNA inhibited tumor cell growth in hepatocellular carcinoma cells lines (par. 428-431) and reduced CTNNB1 mRNA and protein expression in vivo; in vivo effects were seen with βc-1820 in mice (par. 432-435) (relevant to instant cl. 69, 77: Fig. 2 results demonstrate that inhibition is greater than at least 50%).
Brown does not disclose the inclusion of DNA in βc-1816 and βc-1821, nor the specific 23 nt. antisense length and 21 nt. sense strand, nor the motif of 2OMe, 2F, 2’-deoxy, phosphorothioate, and 5’-vinyl-phosphonate modifications of instant claims.
Regarding the differences in the modification pattern of the sense and antisense strands: Brown does not disclose a specific 23 nt. length antisense strand nor specific 21 nt. length sense strand, nor an exact modification pattern for the sense and antisense strands as instant SEQ ID NOs: 20/21.
Foster demonstrate substantial efficacy improvements can be achieved by optimizing the position of 2F and 2OMe modifications across both 23 nt. antisense and 21 nt. sense strands of the siRNA duplex to enhance stability without compromising intrinsic RNAi activity (abstract). Foster highlights that modifying the 2’ position of RNA can significantly enhance the stability of oligonucleotides and that the bulky 2OMe has a greater stabilizing effect than the less bulky 2F modification, however, steric bulk, “if not applied judiciously” results in reduction of RNAi activity (pg. 708). Before conducting bench studies, they conducted an in silico analysis based on a dataset of 1,890 duplexes with varying 2F and 2OMe composition across five targets and 15 target sites. The in silico results describing impact of 2F relative to 2OMe at each position in the antisense strand (AS) and sense strand (SS) was generated (Foster’s fig. 1A, B is provided below and indicates “Negative numbers indicate activity improvement with inclusion of 2’-F relative to 2’-OMe at that position, positive numbers reflect decreased activity. Asterisks (*) indicate significant differences between 2’-F and 2’-OMe at the noted positions” (pg. 709, 710, Fig. 1).
Foster also reduced the overall numbers of 2F with the rationale that 2OMe significantly enhances nuclease stability thus having a greater stabilizing effect while still maintaining inhibitory activity (pg. 708).
Foster: Fig. 1A, B, pg. 710.
PNG
media_image3.png
200
400
media_image3.png
Greyscale
Foster summarizes the in silico data: “Relative to the 5’ end of the respective strand, antisense strand positions 2, 6, and 14 (AS2, AS6, and AS14) as well as sense strand position 11 (S11) were found to exhibit the highest apparent preference for 2’-F” (pg. 709). Using the in silico data as a starting point, since Foster points out enormous possible permutations for sense and antisense strands (221 and 223, respectively), Foster tested various sense and antisense strands pattern modifications in vitro and in vivo with the aim to identify an optimal 2OMe and 2F modification pattern, while maintaining a low 2F content of a siRNA targeting a murine transthyretin gene (abstract, Fig. 1C, D, and other figures) and antithrombin. Thus, it is known in the art that substantial efficacy improvements can be achieved by optimizing the position of 2F and 2OMe modifications across both the strands of the dsRNA duplex to enhance stability without compromising intrinsic RNAi activity (abstract).
Instant antisense has a 2F at position 14, but a deoxyribose at position 2. It is known that deoxyribose, i.e. a H at 2’ position, is a less bulky ribose than a ribose with a 2OMe modification, as evidenced by a Glen Research Report that size of fluorine is between oxygen and hydrogen (pg. 7, 2004 Glen Research Report, 17, pg. 1-12), thus a deoxy modification is less bulky than a 2’ methoxy modification (OCH3) and size wise, closer to a 2F modification.
Regarding PS linkages, Foster introduced PS linkages in the antisense strand between positions 1 and 2, 2 and 3, 21 and 22, and 22 and 23, and for sense strands between positions 1 and 2 and 2 and 3 from 5’ end (all nt. positions are from 5’ end unless indicated otherwise). Foster discloses that PS linkages provide additional protection against 3’ and 5’ exonucleases and thus are placed at terminal ends (pg. 708). Thus modifying with PS linkages at the terminal ends is known in the art.
Regarding the inclusion of DNA nt. in the dsRNA agent, Ui-Tei, conducting a systemic analysis of DNA substitution throughout a siRNA, discloses that similar to nonmodified siRNAs, “nearly all luc gene activity was abolished subsequent to transfection with modified siRNAs with dsDNA substitution < 10 bp (Figure 1C) or 8 bp in length from the 5’ end of the guide strand” (guide strand is equivalent to antisense strand) (pg. 2139). DNA substitution only of the passenger strand (i.e. sense strand) had a minimal silencing effect (Figure 1F, 1G, pg. 2139). Ui-Tei disclose that DNA-RNA hybrid is less stable thermodynamically than RNA duplex and demonstrate that the calculated Tm in the ‘seed’ region of DNA modified siRNA was considerably lower than that of cognate nonmodified siRNA (pg. 2145). Fig. 1E also provides that nt. substitution with DNA up to position 12 from 5’ end of guide strand demonstrates ~80-50% inhibition depending on cell-type. Ui-Tei disclose a reduction in seed-sequence based off-target effect in gene silencing due to transfection with functional DNA-modified siRNAs and demonstrate the decreased off-target effect by genome-wide analysis (pg. 2145-2146. Fig. 6). Thus, replacing RNA with DNA within the seed region of the antisense strand can reduce off-target silencing effects.
Further although Ui-Tei does not specifically address substitution of U for T bases, as evidenced by instant specification, U and T bind to A (pg. 42, line 10), thus U and T are obvious equivalents and not patentably distinct since one can be substituted for the other and either’s complementary base is adenine (A).
Regarding the 5’-terminal vinyl-phosphonate (VP) at the antisense strand, Parmar discloses a fully modified siRNA duplex targeting several non-β-catenin genes and comprising an antisense strand with an E-vinylphosphonate (VP) modification at the 5’-end, mimicking a 5’-phosphate group, that is more stable and is critical for efficient RISC loading of the antisense strand, shown by improved 5’-VP loading (Table 3, pg. 987) and also enhances the potency of the siRNA, ranging from 3 to 20 fold increase in inhibition in vitro and up to 3-fold increase in inhibition in vivo (Table 2 and Fig. 2, pg. 987).
The KSR’s “obvious to try” rationale for supporting conclusion of obviousness requires the following three findings:
(1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem; (2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem; (3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success.
First, regarding the length of 23 nt. antisense and 21 nt. sense strand, it would be obvious to try substituting any of the dsiRNA βc-1816 or βc-1821 or βc-1821of Brown and test a 23 nt. antisense and 21 nt. sense duplex in a similar oligowalk method conducted by Brown to identify optimal binding region to the target transcript.
Second, regarding the DNA placements in the siRNA, one of the issues regarding siRNAs is its off-target effects, and Ui-Tei provides that changes up to 12 nt. from the 5’ end of the guide strand results in target inhibition with reduced off-target effects. Thus, a skilled artisan can replace RNA with deoxyribose nucleotides and maintain similar inhibition levels and reduce off-target effects, thus a skilled artisan would introduce deoxyribose modifications within these finite positions of the siRNA duplex.
Third, regarding the modification pattern, Foster recognized the less stabilizing effect of a less bulky 2F modifications than a 2OMe modification, thus sought to increase the 2OMe content while decreasing the 2F content. Also, Ui-Tei discloses that “DNA-RNA hybrid is generally less stable thermodynamically than RNA duplex” (pg. 2145), thus another reason to increase the 2OMe modification content in the siRNA duplex to overcome the decreased stability due to introduction of DNA into the siRNA. Thus, a skilled artisan would try to modify the positioning of 2OMe and 2F based on the success of Foster to further improve upon the efficacy of a fully modified 2OMe and 2F siRNA by refining the positions of the finite 2OMe and 2F nt. modifications on a siRNA.
One of the KSR rationale that may be used to support a conclusion of obviousness is obvious to try. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have tried to modify dsiRNA βc-1816 or βc-1821of Brown in view of Ui-Tei, Foster and Parmar and arrive at the claimed invention with a reasonable expectation of success. Based on the success of Brown’s βc-1816 or βc-1821 dsiRNA to inhibit β-catenin expression, and of Foster to further optimize a modified siRNA-GalNac duplex with 23 nt. antisense and 21 nt. sense lengths, and of Ui-Tei to incorporate up to 12 nt. modified with deoxyribose in the guide strand from the 5’ end without interfering inhibition levels but reduce off-target effects, and Parmar for introducing a 5’-VP on a siRNA duplex to increase siRNA’s potency up to 3 fold in vivo, a skilled artisan would expect reasonable success in trying to modify the siRNA comprising antisense and sense sequence of βc-1816 and βc-1821 to target CTNNB1 of Brown with 5’-VP of Parmar to increase potency, to try introducing DNA within the siRNA to reduce off-target effects of Ui-Tei, and to try various modification patterns by increasing 2OMe, while reducing 2F content in a 23 nt. antisense and 21 sense strands of Foster. Thus, claims 69 and 77 are obvious.
Regarding instant cl. 70, 76, 83, Brown demonstrates that treatment with various dsiRNAs, including βc-1820, results in remarkable effective inhibition of mouse CTNNB1 mRNA and protein expression in vivo in normal mouse liver (par. 432; Fig. 30). Further, based on Brown’s results, the resulting effect of administration of dsiRNA of decreasing expression in vivo in mouse liver would be decrease in CTNNB1 expression in the serum by at least 50% (regarding instant cl. 76).
Regarding instant cl. 71, 82, Brown discloses method of addition of dsiRNA agent composition is amenable to whole organism, including humans (par. 366).
Regarding instant cl. 72, 74, 81, Brown demonstrates that dsiRNA agent treatment of hepatocarcinoma cells (HepG2) resulted in decrease in cell numbers (par. 421, Fig. 7). Based on the success of Brown demonstrating that dsiRNA agents inhibited hepatocarcinoma cells in vitro, a skilled artisan would reasonably expect success that transduction of HepG2 in mice will result in decreased cell growth of HepG2.
Regarding instant cl. 75, Brown demonstrates that dsiRNA contact with cells in vitro results in inhibition up to ~90% of β-catenin expression (see Fig. 4).
Regarding instant cl. 85-86, Brown method claim 19 discloses administration via intravenous or subcutaneous injection.
Regarding instant cl. 89, Brown discloses additional chemotherapeutic agents combined with or used in conjunction with the dsiRNA molecules for the therapeutic purposes (par. 444).
Regarding instant cl. 55, 56 Brown discloses dsiRNA administered to a subject in an effective delivery vehicle (e.g. effective lipid nanoparticle) (par. 130), including cationic lipids (par. 300).
Claims 57-60 are rejected under 35 U.S.C. 103 as being unpatentable over Brown et al. (US20130109740, pub. 05/02/2013, “Brown”), as evidenced by The Glen Research Report (2004, 17, 1-12, of record) in view of Ui-Tei et al. (2008, Nucleic Acids Research, 36, 2136-2151, referred as Ui-Tei, of record), Foster et al. (2018, Molecular Ther., 26, pg. 708-717, referred as Foster, of record) and Parmar et al. (2016, Chem. Bio. Chem., 17, 985-989, of record), as applied to claims 55, 56, 69, 77, 70-72, 74-76, 81-86, 89, above, and further in view of Jayaraman et al. (WO2020072324, pub. 04/09/2020, referred as Jayaraman, of record).
Disclosure of Brown, Ui-Tei, Foster and Parmar is noted above.
Brown, Ui-Tei and Foster and Parmar do not disclose a lipid comprising the following structure
PNG
media_image4.png
88
347
media_image4.png
Greyscale
, cholesterol, DSPC, and PEG-DMG; nor composition with recited ratio of the lipids.
Regarding lipids, Jayaraman et al. (WO2020072324, pub. 04/09/2020) discloses lipid nanoparticles (LNP) composed of biodegradable cationic lipids and other lipid components, such as a neutral lipid, a sterol, and lipid capable of reducing aggregation (e.g. the preferred PEG-DMG) cholesterol, PEG lipids to facilitate transport of nucleic acid agents, such as siRNA (pg. 5, relevant to instant cl. 57); discloses that combination of these lipids exhibit enhanced efficacy for the delivery of an active agent (pg. 6); discloses these LNPs protect the nucleic acid from degradation and clearance in serum, is suitable for systemic delivery, provide intracellular delivery of the nucleic acid and should be well-tolerated with reduced toxicity (pg. 5-6); disclose lipids that are biodegradable cationic lipids for delivery of active agents, including siRNA agents (pg. 5); discloses a formulation AF-070 (see below, a cationic lipid with the same structure as instant structure of claims 58-60) and a very similar AF-068, which has 4 carbons in the polar amino head group (pg. 46); discloses preparation of LNP comprising AF-070, DSPC, PEG-DMG, and cholesterol, along with the ratios tested (see below for excerpt of Ex. 5, pg. 46) (relevant to instant claim 59-60).
PNG
media_image5.png
116
383
media_image5.png
Greyscale
PNG
media_image6.png
250
216
media_image6.png
Greyscale
The results demonstrated a dose-dependent inhibition with siRNA targeting factor VII protein (see Fig. 4, Example 4, excerpts of fig. 4 above); further testing of siRNA-LNP formulations (including AF-070) targeting liver-produced F12 protein in non-human primates also showed maximum inhibition of about 80-90% at day 15 after single-dose treatment (see Example 5, Figure 5); Jayaram discloses the molar lipid ratio with regard to mol% cationic lipid/DSPC/Chol/PEG-DMG ranging from approximately 40/10/30/5, 35/15/40/10 or 52/12/30/5 (pg. 31) (relevant to instant claims 59-60).
MPEP 2144.05(I) provides that a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap but are merely close. Here, the claimed ratio is 50:12:36:2, which is close to ranges in Jayaram, therefore a prima facie case of obviousness.
One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the dsiRNA targeting β-catenin of Brown in view of Jayaraman and arrive at the claimed invention with a reasonable expectation of success. Based on the success of Jayaraman, one of ordinary skill in the art would have been motivated to combine prior arts and deliver the modified ASO of Brown using the LNP formulated with cationic lipid recited in claims 17, 18 and DSPC, PEG-DMG and cholesterol in the ratios recited for improved delivery to target cells in non-human primates as taught by Jayaraman. Thus, claims 57-60 are obvious.
Response to Arguments
Applicant’s arguments, see pg. 21-26, filed 07/15/2026, with respect to the rejection of claims 55-60, 69-72, 74-77, 81-83, 85-86, 89 under 103 have been fully considered and are persuasive. Therefore, the rejection has been withdrawn. However, upon further consideration, a new ground(s) of rejection is made as noted above.
Double Patenting
The rejection of claims under nonstatutory double patenting rejection in view of Application 19/467969 is withdrawn since ‘969 recites SEQ ID NO: 823/1164. Rejection of examined claims is maintained in view of ‘511, see below.
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 55-60, 69-72, 74-77, 81-83, 85-86, 89 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 7, 8, 14-19, 30 of copending Application No. 18/581,511 (“Alnylam”). Although the claims at issue are not identical, they are not patentably distinct from each other.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
The following rejection is in view of the decision of the Court of Appeals for the Federal Circuit in Pfizer Inc, v Teva pharmaceuticals USA Inc., 86 USPQ2d 1001, at page 1008 (March 2008), which indicates that there is no patentable distinction between claims to a product and a method of using that product disclosed in the specification of the application and that the preclusion of such a double patenting rejection under 35 USC 121 does not apply where the present application is other than a divisional application of the patent application containing such patentably indistinct claims.
Alnylam is not a divisional of instant application.
Here, the claims recite the method claims of product claims of Alnylam and Alnylam claims 1, 7, 14, 15-19, corresponds to instant cl. 69, 77, respectively, since Alnylam claims 1, 7, and 30 teach SEQ ID NO: 20 and 21 that are identical to instant SEQ ID NO: 20 and 21.
Further claims 19 and 30 disclose lipid pharmaceutical composition of instant claim 60.
The remaining examined claims of instant application are method claims of the product of Alnylam and are obvious based on Pfizer.
Response to Arguments
Applicant's arguments filed 07/15/2026 (“the Remarks”) have been fully considered but they are not persuasive.
The Remarks insist that when the claims are allowed then the Applicant will consider submitting, if appropriate, a terminal disclaimer (pg. 27).
The argument is not persuasive.
Since the Remarks do not provide further evidence or arguments, the rejection of examined claims is maintained.
Allowable Subject Matter
No claim allowed.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEYUR A VYAS/Examiner, Art Unit 1637 /Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
