Prosecution Insights
Last updated: April 19, 2026
Application No. 18/407,073

KITS AND METHODS FOR DIAGNOSING LUNG CANCER

Non-Final OA §103
Filed
Jan 08, 2024
Examiner
JOHANNSEN, DIANA B
Art Unit
1682
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Nucleix Ltd.
OA Round
3 (Non-Final)
53%
Grant Probability
Moderate
3-4
OA Rounds
4y 2m
To Grant
94%
With Interview

Examiner Intelligence

Grants 53% of resolved cases
53%
Career Allow Rate
262 granted / 492 resolved
-6.7% vs TC avg
Strong +41% interview lift
Without
With
+41.1%
Interview Lift
resolved cases with interview
Typical timeline
4y 2m
Avg Prosecution
44 currently pending
Career history
536
Total Applications
across all art units

Statute-Specific Performance

§101
17.0%
-23.0% vs TC avg
§103
26.0%
-14.0% vs TC avg
§102
14.6%
-25.4% vs TC avg
§112
34.2%
-5.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 492 resolved cases

Office Action

§103
DETAILED ACTION The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 24 October 2025 has been entered. Claims 1 and 7 have been amended. Claims 3 and 9 remain withdrawn, and claims 1 and 5-8 remain under consideration herein. Applicant’s amendments and arguments have been thoroughly reviewed and have overcome the prior rejection of claims under 35 USC 103, in view of the amendment of independent claim 1 to require forward and reverse primers “configured to amplify” the restriction locus of SEQ ID NO: 2 “by specifically hybridizing to a sequence comprised with the restriction locus and/or an" upstream/downstream “flanking sequence located within 1-60 bases of the restriction locus”, as well as a probe that “specifically hybridizes to a sequence within the restriction locus or the complementary sequence of the restriction locus”. However, claims 1 and 5-8 remain rejected under 35 USC 103 for the reasons given below. Any rejections and/or objections not reiterated in this action have been withdrawn. This action is non-final. Election/Restrictions Applicant’s election without traverse of the species of SEQ ID NO: 2 in the reply filed on 11/15/2024 is again acknowledged. Claims 3 and 9 remain withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 11/15/2024. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 1, 5, and 8 are rejected under 35 U.S.C. 103 as being unpatentable over Furness et al (US 6,673,549 B1 [06 Jan 2004]; previously cited) in view of OSU (Procedures and Recommendations for Quantitative PCR, PMGF at The Ohio State University, version 1.2 [April 2003]; previously cited), Shemer et al (The Journal of Biological Chemistry 265(2):1010-1015 [1990]; previously cited), and Ahern (The Scientist 9(15):20 [1995]; previously cited). Furness et al teach a variety of cDNAs that were found to be differentially expressed in human liver cell cultures treated with steroids, teaching that such cDNAs may be employed “to detect metabolic and toxicological responses to treatments with steroids and steroid antagonists, to diagnose, to stage, to treat, or to monitor the treatment of a subject with an steroid responsive disorder” (see the entire reference, particularly the Abstract). Furness et al teach a variety of disorders/conditions to which such usages of their disclosed cDNAs may apply (including diagnosis/detection of liver carcinoma/cancer, and/or the monitoring of therapy responses to treatments therefor), and several possible techniques for carrying out such applications (see, e.g., the Summary at col 4, line 40-col 5, line 27, and col 14, line 26-col 17, line 15). Among the methods taught by Furness et al for use in such applications are the use of their cDNAs or fragments or complements thereof in “various hybridization technologies”, including via the labeling of such cDNAs by PCR or other techniques (disclosed as encompassing the use of not just double stranded cDNAs, but cDNAs “at least 18 contiguous nucleotides in length and….usually single stranded”), the use of such nucleic acids in hybridization techniques for detection of complementary sequences, the use of oligonucleotides/fragments of the cDNAs in PCR to detect targets in samples, and/or in various types of blotting assays as well as array based detection methods, etc., the labeling of cDNAs for use in such methods with various well-known label types (including fluorescent labels), “Diagnostics” including the use of labeled cDNAs or fragments in qualitative or quantitative hybridization and/or amplification assays, and gene expression profiling methods (see in particular col 15, line 35-col 16, line 42, and col 20, line 1-col 21, line 33); Furness et al thus disclose a variety of uses of their cDNAs and fragments/complements thereof (particularly fragments/complements at least 18 nucleotides in length). Furness et al’s disclosure of such oligonucleotides/ fragments includes a disclosure of preferred embodiments such as amplimers and primers (with preferred embodiments being taught as being about 18-60 nucleotides in length, for use in hybridization or amplification technologies; see col 10, lines 6-11); further, with regard to the requirement for primers and probes that “specifically hybridize” to target sequences, Furness et al clearly teach oligonucleotides that hybridize under “high stringency” conditions – including oligonucleotides “completely complementary” to target sequences (see again col 15, line 35-col 16, line 42), thereby clearly teaching primers/probes that “specifically hybridize” to complementary target sequences. Furness et al also disclose the design and use of primers for amplification of each of their cDNAs, as well as the use of nested primers or random primers in such methods; see col 25, line 53-col 26, line 67), and the use of Cy3 and Cy5 labeled cDNAs in hybridization and detection methods (col 29, line 48-col 49, line 49). Among the cDNAs taught by Furness et al is their SEQ ID NO: 630, which is described as a “Human CpG island DNA genomic Mse1 fragment” (see description in Table 1 at columns 57-58). Instant SEQ ID NO: 2 is 100% identical to nucleotides 582-650 of SEQ ID NO: 630 of Furness et al, as shown below: Query Match 100.0%; Score 69; Length 1145; Best Local Similarity 100.0%; Matches 69; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CGGTCCCGCAGCGCCCGCCACACACCCGCGCCAGAGGTCCAGCGCATGTGCAGTGAAATG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 582 CGGTCCCGCAGCGCCCGCCACACACCCGCGCCAGAGGTCCAGCGCATGTGCAGTGAAATG 641 Qy 61 GCCTAGCCC 69 ||||||||| Db 642 GCCTAGCCC 650 Furness et al thus disclose a cDNA including instant SEQ ID NO: 2, and teach that this cDNA may be labeled for use as a probe (including via fluorescent labeling), and that it may function as a target of detection via methods including quantitative and quantitative hybridization and amplification, and Furness et al also teach fragments of their SEQ ID NO: 630 – for example 18-60 nucleotides in length – and the use of such fragments as primers/probes (as discussed above). It is also reiterated that Furness et al clearly disclose that such fragments hybridize under high stringency conditions to completely complementary sequences (i.e., meet the requirement of “specifically hybridizing” to complementary sequences); further, it is an inherent property of any 18-60 nucleotide fragment of Furness et al’s SEQ ID NO: 630 (which are also embodiments of Furness et al’s invention) that they will “specifically hybridize” to their complementary sequences. While Furness et al teach that PCR amplification of each of their disclosed cDNAs (including quantitative PCR amplification), as well as detection via hybridization with a labeled probe, are embodiments of their invention, Furness et al do not explicitly teach a combination of a forward and reverse primer and “corresponding” labeled oligonucleotide probe targeting (and “specifically hybridizing to”) the portion of their SEQ ID NO: 630 corresponding to instant SEQ ID NO: 2 and/or flanking sequences located within 1-60 nucleotides thereof (as recited in amended claim 1); furthermore, Furness et al do not teach a kit comprising such reagents, as is required by claim 1. With regard to combinations of forward and reverse primers and a corresponding fluorescently labeled probe for use together in detecting a specific target sequence, OSU teaches “Procedures and Recommendations for Quantitative PCR”, stating that such methods – via the real-time monitoring of product formation – allow for the accurate determination of the starting concentration of a target template (and further that such assays may be performed as multiplex reactions) (see entire reference, particularly the “Introduction” at page 1). OSU also teaches that a target template “can be genomic DNA, cDNA, mRNA or any other species of DNA that needs to be accurately measured” (page 1 under Experimental Design – Selection of Targets); thus, the teachings of OSU are applicable to cDNA targets, such as those taught by Furness et al. OSU provides detailed guidance on selection of probes (of which several alternatives are taught as being available) as well as primers for use therewith (pages 2-4), as well as guidance on experimental procedures (pages 4-6). Among the alterative probe types taught by OSU are probes including fluorescent labels (inclusive of probes of the type set forth in dependent claim 8, in which a single probe includes a fluorescent moiety and a quencher moiety, with cleavage resulting in increased fluorescence intensity when the assay is performed; see again pages 2-3). With regard to the targeting of instant SEQ ID NO: 2 (as a target region within Furness et al’s SEQ ID NO: 630), Shemer et al teach that “expression of mammalian genes often correlates with their pattern of methylation”, and disclose employing methylation analysis of human liver cell lines with regard to relationships between expression and methylation patterns, specifically with regard to the apo-AI gene (see entire reference, particularly page 1010, right column). Shemer et al disclose the use of methylation sensitive restriction enzymes (including HhaI, taught as targeting GCGC sites) in their methods (see page 1011, left column). It is reiterated that Furness et al disclose studying differential expression in human liver cell cultures treated with steroids, and further that their SEQ ID NO: 630 is described as a “Human CpG island DNA genomic Mse1 fragment”; additionally, it is a property of the region of SEQ ID NO: 630 containing instant SEQ ID NO: 2 that it includes multiple target sites for HhaI (as is illustrated in the above alignment). In view of the teachings of OSU and Shemer et al, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have prepared primer pair and fluorescently labeled probe combinations targeting instant SEQ ID NO: 2 (inclusive of primers specifically hybridizing within SEQ ID NO: 2 and/or within upstream/downstream flanking sequences located within 1-60 nucleotides thereof). First, Furness et al teaches their SEQ ID NO: 630 as a target sequence and teach the use of PCR/qPCR in detection thereof, but fail to provide specific guidance regarding preparation of primers/probes for use in such methods, while OSU provides such specific guidance (the type of which an ordinary artisan would have sought out in order to successfully implement what is taught and suggested by Furness et al). An ordinary artisan would have been motivated to have substituted the specific qPCR methods of OSU for the more general methods taught by Furness et al simply for the benefit of efficiency and accuracy in implementing the methods taught by Furness et al (given their lack of more specific guidance, and the efficiency provided by using available prior art guidance such as that provided by OSU). Additionally or alternatively, an ordinary artisan would have been motivated to have employed qPCR in lieu of other types of diagnostic/detection methods taught by Furness et al by the teachings of OSU regarding advantages provided by qPCR, such as accuracy in quantifying a target (including a cDNA target), and the ability to perform multiplex reactions. Second, both Furness et al and Shemer et al pertain to the study of differential expression, with Shemer et al focusing on differential methylation as a potential cause thereof. Given Shemer et al’s disclosure of methylation analysis comprising the use of HhaI (taught as targeting GCGC sites), and the fact that the region of SEQ ID NO: 630 containing instant SEQ ID NO: 2 includes multiple such target sites for HhaI, an ordinary artisan would have been further motivated to have targeted this region of Furness et al’s SEQ ID NO: 630 for methylation analysis – and thereby to have prepared and employed a primer pair and probe targeting instant SEQ ID NO: 2, as recited in the claims – simply in order to have assayed one disclosed characteristic associated with differential expression (altered methylation) for the benefit of determining how (and whether) methylation relates to or causes the altered expression of interest (such as that studied by Furness et al). It is particularly noted that while the claims do require primers and probe that “specifically hybridize” to recited target sequences, this claims set forth a broad range of potential targets that are generally suggested by the teachings of the references (rather than, e.g., a specific/particular primer pair/probe combination for which unexpected results have been demonstrated). None of Furness et al, OSU, and Shemer et al disclose packaging their suggested primer pair/probe combinations into kits. However, Ahern teaches that researchers purchase premade reagents and kits “because they are convenient and they save time”, further teaching that the provision of all materials needed for a particular application in a single kit allows investigators to avoid “browsing through catalogs and buying individual chemicals from one or several suppliers” (page 4/6). Ahern additionally teaches that purchasing such prepared products may also save practitioners money (page 3/6). Thus, the teachings of Ahern provide motivation to package together in kits materials for use together in a common method - including materials such as those suggested for use together by the combined teachings of Furness et al, OSU, and Shemer et al - for the benefits of cost- and time-savings. Accordingly, in view of the teachings of Furness et al, OSU, Shemer et al, and Ahern, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have prepared kits meeting the requirements of amended claim 1 (and dependent claim 8). With further regard to dependent claim 5, it is reiterated that Shemer et al disclose the use of methylation sensitive restriction enzymes (including HhaI, taught as targeting GCGC sites) in their methods (see page 1011, left column). Thus, in view of the teachings of Shemer et al, it also would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have included in the kits suggested by Furness et al, OSU, Shemer et al, and Ahern a methylation sensitive restriction enzyme (including HhaI). Again, as such enzymes are taught as being used in the methods of Shemer et al, and as suggested by the combined teachings of Furness et al, OSU, and Shemer et al, an ordinary artisan would have been motivated to have included them in such kits for the same reasons taught by Ahern noted above, i.e., for the benefits of cost- and time-savings in performing the suggested methods. Claim(s) 6 and 7 are rejected under 35 U.S.C. 103 as being unpatentable over Furness et al in view of OSU, Shemer et al, and Ahern et al, as applied to claims 1, 5, and 8, above, and further in view of Ibrahim et al (Nucleic Acids Research 34(20):e136 [2006]; previously cited). The teachings of Furness et al, OSU, Shemer et al, and Ahern are set forth above. While Shemer et al teaches multiple methylation-sensitive restriction enzymes, including HhaI, and provides motivation to include such enzymes in kits (as discussed above), none of Furness et al, OSU, Shemer et al, or Ahern teaches the particular such enzyme HinP1I, as required by claim 6. Ibrahim et al teach methods “for identifying genome-wide CpG island methylation” in which publicly available CpG island microarrays are employed to directly compared methylated and unmethylated sequences in a sample of interest (see entire reference, particularly the Abstract and page 2/12). Ibrahim et al teach that their method - which employs both HinP1I and HhaI, the preferred methylation sensitive restriction enzymes of dependent claim 6 - provides “improved sensitivity and statistical power for high-throughput microarray identification of differential methylation” as compared to prior methods (see the Abstract, and page 2/12, right column under “Preparation of genomic DNA”). In view of the teachings of Ibrahim et al, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have included in the kits suggested by Furness et al in view of OSU, Shemer et al, and Ahern the additional enzyme HinP1I. An ordinary artisan would have been motivated to have made such a modification for the benefit of providing in a convenient format for a practitioner an additional enzyme taught in the art as being usable in methylation analysis (either for use in methods as suggested by Shemer et al, or in methods as taught by Ibrahim et al, as it is noted that the claims are directed to products, and thus do not require that a practitioner employ kit components in any particular manner). With further regard to dependent claim 7, which is directed to kits further including an amplification primer pair and corresponding probe targeting a “control locus in the human genome that is not cut by the methylation-sensitive restriction enzyme(s) in the kit”, with primers “configured to amplify” the control locus “and/or an upstream/downstream flanking sequence thereof” by specifically hybridizing thereto (as well as probe that “specifically hybridizes to a sequence within the control locus”): a) Furness et al disclose employing control mRNAs when preparing their cDNAs of interest (see col 28, line 62-col 29, line 47), and Furness et al also disclose the use of such a control cDNA in arrays employed in the methods (see, e.g., col 8, lines 46-53, as well as col 29, line 48-col 49, line 49), providing general motivation to prepare and use a control cDNA; b) OSU (which provides specific teachings with regard to the design and use of primer pair/probe combinations, as discussed above) teaches with regard to “Selection of Targets” that “assaying a reference gene is strongly recommended to control for the variations in quality and quantity of target mRNA between experimental and control samples” (citing as examples of such controls/reference genes the beta-actin and glyceraldehyde-phosphate dehydrogenase genes), thus providing motivation to employ PCR controls (see page 1 bridging to page 2); and c) Ibrahim et al teach that their method for comparing methylated and unmethylated sequences employ both methylated and unmethylated “spike control” amplicons prepared by PCR (see page 2), thus providing both a teaching and suggestion to prepare restriction digestion controls, and to prepare such controls via PCR. Accordingly, in view of the teachings of Furness et al, OSU, and Ibrahim et al, it also would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have included in such a kit (of the type suggested by Furness et al in view of OSU, Shemer et al, and Ahern) a control amplification primer pair and oligonucleotide as specified in claim 7 for use in amplifying/preparing a control target as suggested by Furness et al as well as OSU - and particularly for amplifying/detecting a target usable in preparing control amplicons of the type suggested by Ibrahim et al (and thus encompassing targets “not cut” by methylation-sensitive restriction enzymes) - for the benefit of providing reagents needed for preparation of a control, and particularly a control meeting the requirements of, and having the benefits of, those taught by Furness et al, OSU, and Ibrahim et al. It is noted that the traversal of prior rejections under 35 USC 103 set forth in the reply of 24 October 2025 have been reviewed to the extent that they may apply to the present rejections, but are not found persuasive; the amended claims are now rejected on the grounds set forth above. More particularly, the limitations that are the focus of Applicant’s arguments at page 5-7 (regarding the particular sequence of SEQ ID NO: 2 and its relationship to SEQ ID NO: 630 of Furness et al) and page 8 (the nature of the “control locus” of claim 7) are address in the current rejection of the claims. Regarding Applicant’s argument that Ibrahim et al do not “resolve the deficiencies” of the other references, it is noted that Ibrahim et al is relied upon in the current rejection for its teachings set forth above in paragraph 9 (which pertain to particular enzymes and controls for the use thereof). Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to DIANA B JOHANNSEN whose telephone number is (571)272-0744. The examiner can normally be reached Monday-Friday, 7:30 am-3:30 pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Wu-Cheng Winston Shen can be reached at (571) 272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /DIANA B JOHANNSEN/Primary Examiner, Art Unit 1682
Read full office action

Prosecution Timeline

Jan 08, 2024
Application Filed
Dec 06, 2024
Non-Final Rejection — §103
Apr 11, 2025
Response Filed
Jul 22, 2025
Final Rejection — §103
Oct 24, 2025
Request for Continued Examination
Oct 27, 2025
Response after Non-Final Action
Nov 24, 2025
Non-Final Rejection — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12595513
METHODS AND MATERIALS FOR ASSESSING LOSS OF HETEROZYGOSITY
2y 5m to grant Granted Apr 07, 2026
Patent 12595517
METHOD TO TREAT AND STRATIFICATE A PATIENT SUFFERING FROM A CANCER
2y 5m to grant Granted Apr 07, 2026
Patent 12590338
METHOD AND DEVICE FOR DETECTION OF AMPICILLIN-RESISTANT NON-TYPHOIDAL SALMONELLA
2y 5m to grant Granted Mar 31, 2026
Patent 12590339
METHOD FOR MULTIPLEXED DETECTION OF NUCLEIC ACIDS USING SPECTRALLY ENCODED BEADS
2y 5m to grant Granted Mar 31, 2026
Patent 12590335
TARGETED MEASURE OF TRANSCRIPTIONAL ACTIVITY RELATED TO HORMONE RECEPTORS
2y 5m to grant Granted Mar 31, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
53%
Grant Probability
94%
With Interview (+41.1%)
4y 2m
Median Time to Grant
High
PTA Risk
Based on 492 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month