Prosecution Insights
Last updated: May 29, 2026
Application No. 18/407,298

RECOMBINANT AAV VECTORS EXPRESSING OSTEOPROTECTIVE GENES, INCLUDING HAS2 AND LUBRICIN, USEFUL IN THE TREATMENT OF OSTEOARTHRITIS AND RELATED JOINT CONDITIONS IN MAMMALS

Non-Final OA §103§112
Filed
Jan 08, 2024
Priority
Jan 13, 2016 — provisional 62/278,243 +2 more
Examiner
NGUYEN, QUANG
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Genzyme Corporation
OA Round
1 (Non-Final)
38%
Grant Probability
At Risk
1-2
OA Rounds
1y 8m
Est. Remaining
91%
With Interview

Examiner Intelligence

Grants only 38% of cases
38%
Career Allowance Rate
281 granted / 736 resolved
-21.8% vs TC avg
Strong +53% interview lift
Without
With
+52.8%
Interview Lift
resolved cases with interview
Typical timeline
4y 0m
Avg Prosecution
44 currently pending
Career history
805
Total Applications
across all art units

Statute-Specific Performance

§101
0.4%
-39.6% vs TC avg
§103
58.2%
+18.2% vs TC avg
§102
6.7%
-33.3% vs TC avg
§112
10.1%
-29.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 736 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claims 3-11 and 21-31 are pending in the present application. Applicant’s election without traverse of Group I in the reply filed on 04/30/2026 is acknowledged. Applicant also elected CMV IE promoter as a species of a promoter. Accordingly, claims 11 and 21-31 are withdrawn from further considerations because they are drawn to non-elected inventions. Thus, claims 3-10 are examined on the merits herein with the above elected species. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claim 5 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 5 recites the limitation “an amino acid sequence as set forth in SEQ ID NO: 7”, which encompasses any amino acid sequence of any length in SEQ ID NO: 7. However, claim 4 from which claim 5 is dependent upon already recites the limitation “an amino acid sequence at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 7”. Thus, the scope of dependent claim 5 is broader and outside of the scope of claim 4 from which it is dependent upon. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Additionally, should Applicant amend claim 5 to recite “the amino acid sequence as set forth in SEQ ID NO: 7”, this rejection is obviated. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 3, 5 and 7-10 are rejected under 35 U.S.C. 103 as being unpatentable over Monahan et al (US 9,169,492; IDS) in view of Flannery et al (US 7,642,236; IDS). The instant claims are directed to a recombinant adeno-associated virus (rAAV) comprising a rAAV vector, wherein the rAAV vector comprising a nucleic acid sequence encoding a canine lubricin operably linked to a promoter; the same rAAV comprising an AAV5 capsid; and a pharmaceutical composition comprising the same rAAV and at least one pharmaceutically acceptable carrier, excipient, or vehicle. It is noted that a canine lubricin polypeptide of the present application encompasses the lubricin polypeptide having an amino acid sequence selected from a polypeptide having at least 90% identity to the sequence of SEQ ID NO: 7, a fragment, a variant, and a homolog thereof having, each exhibiting lubricin activity in vivo in a subject (see paragraph [0099] of the specification). Monahan et al already disclosed a composition comprising: (a) an adeno-associated virus (AAV) vector (e.g., AAV2, AAV5, AAV8) comprising a heterologous nucleic acid of interest, wherein AAV vector genome is oversized relative to a wild type AAV genome, and (b) a proteasome inhibitor for at least delivery a nucleic acid of interest to a cell in a joint or osteochondral site in a subject in need thereof (e.g., humans, canines, equines, felines); and the AAV vector can comprise a single stranded AAV vector genome or a double-stranded (self-complementary) AAV vector genome (see at least Abstract; Summary of the Invention; particularly, col. 1, lines 37-46; col. 2, lines 11-19; col. 3, lines 22-26; col. 5, line 58 continues to line 2 on col. 6; col. 13, lines 41-43; col. 16, line 61 continues to line 2 on col. 17; Examples 1-2; Figs. 1 and 7; and issued claims 1-13). Monahan et al define the term “virus vector” or “vector” to refer to a virus (e.g., AAV) particle which comprises a vector genome packaged within an AAV capsid (col. 7, line 64 continues to line 1 on col. 8). Monahan et al also disclosed that any heterologous nucleic acid of interest with a biological effect to treat or ameliorate the symptoms associated with any disorder may be utilized, including those encoding anti-inflammatory factors such as IRAP and TNF-α soluble receptor for treating arthritis (col. 12, line 61 continues to line 57 on col. 13), and a pharmaceutical formulation comprising the disclosed composition with a pharmaceutically acceptable carrier (col. 16, lines 23-45). Monahan et al stated “Those skilled in the art will appreciate that a variety of promoter/enhancer elements may be used depending on the level and tissue-specific expression desired. The promoter/enhancer may be constitutive or regulatable, depending on the patterns of expression desired” (col. 15, lines 47-51), and exemplary promoters used include chicken beta-actin (CBA) promoter (col. 18, lines 46-60). Monahan et al demonstrated in Example 1 that the presence of proteasome inhibitor bortezomib increases green fluorescent protein (GFP) expression in 293T cells transduced with conventional single strand AAV2 vectors or with self-complementary AAV2 vectors to similar extent (col. 25, lines 10-22; and Fig. 1). Monahan et al further demonstrated in Example 2 that hemophilic FVIII-/- mice receiving treatment with AAV serotype 5 encoding an oversized transgene Factor VIII vector via intraarticular injection and subsequently injured were partially protected from pathologic changes, but coadministration of proteasome inhibitor bortezomib with the AAV5.FVIII resulted in the greatest protection from subsequent injury (col. 4, lines 33-37; col. 25, lines 45-62; and Fig. 7). Monahan et al did not teach specifically a recombinant AAV5 virus comprising a nucleic acid sequence encoding a canine lubricin as a therapeutic agent for arthritis treatment. Before the effective filing date of the present application (01/13/2016), Flannery et al already disclosed recombinant lubricin molecules for enhancing lubrication in joints, and isolated polynucleotides encoding them, including at least the polynucleotide of SEQ ID NO: 10 (3024 bases), or 14 (3117 bases) (Abstract; Summary of the Invention; particularly col. 1, lines 19-27; lines 54-62; col. 2, lines 1-45; and Table 1). Flannery et al taught that reduced lubrication contributes to cartilage matrix degradation and fibrillation, and these in turn contribute to joint dysfunction and pain in both osteoarthritis and rheumatoid arthritis (col. 1, lines 19-27). Each of the exemplary SEQ ID NOs. 10 and 14 encodes at least a canine lubricin amino acid sequence of the shortened canine lubricin molecule of SEQ ID NO: 7 of the present application (see the attached sequence searches below). Flannery et al also stated “Polynucleotides of the present invention can also be used for gene therapy. Such polynucleotides can be introduced either in vivo or ex vivo into cells for expression in a subject (e.g., a mammal). Polynucleotides of the invention may also be administered by other known methods for introduction of nucleic acid into a cell or organism (including, without limitation, in the form of viral vectors or naked DNA)” (col. 20, lines 48-54). It would have been obvious before the effective filing date of the present application for an ordinary skilled artisan to modify the teachings of Monahan et al by also selecting at least a nucleic acid sequence encoding a canine lubricin amino acid sequence such as the lubricin polynucleotide construct of SEQ ID NO: 10 or 14 of Flannery et al as a therapeutic agent in the form of a recombinant AAV5 virus for arthritis treatment, in light of the teachings of Flannery et al as presented above. An ordinary skilled artisan would have been motivated to carry out the above modification because Flannery et al already taught recombinant lubricin molecules for enhancing lubrication in joints, and isolated polynucleotides encoding them, including at least the polynucleotide of SEQ ID NO: 10 (3024 bases), or 14 (3117 bases); and the disclosed polynucleotides can be used for gene therapy to reduce cartilage matrix degradation and fibrillation in osteoarthritis and rheumatoid arthritis. An ordinary skilled artisan would have a reasonable expectation of success of making a recombinant AAV as claimed in light of the teachings of Monahan et al and Flannery et al; coupled with a high level of skill for an ordinary skilled artisan in the relevant art. The recombinant AAV5 virus resulting from the combined teachings of Monahan et al and Flannery et al as set forth above is indistinguishable and encompassed by the presently claimed invention. Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary. Claim 7 (the elected CMV IE promoter embodiment) is rejected under 35 U.S.C. 103 as being unpatentable over Monahan et al (US 9,169,492; IDS) in view of Flannery et al (US 7,642,236; IDS) as applied to claims 3, 5 and 7-10 above, and further in view of Fischer (WO 2009/046464). The combined teachings of Monahan et al and Flannery et al were presented above. However, none of the cited references teaches specifically using a CMV IE promoter. Before the effective filing date of the present application (01/13/2016), Fischer already taught the use of a strong promoter such as the preferred immediate early cytomegalovirus promoter (CMV-IE) of human or murine origin in a recombinant vector for expressing a BMP-7 polypeptide for the treatment of osteoarthritis in a mammal (Abstract; Summary of the Invention; particularly lines 5-32 at page 24). Accordingly, it would have been obvious before the effective filing date of the present application for an ordinary skilled artisan to further modify the combined teachings of Monahan et al and Flannery et al by also using the strong CMV-IE promoter for expressing a nucleic acid sequence encoding a canine lubricin, in light of the teachings of Fischer as presented above. An ordinary skilled artisan would have been further motivated to carry out the above modifications because Fischer already taught using a strong promoter such as the preferred immediate early cytomegalovirus promoter (CMV-IE) of human or murine origin in a recombinant vector for expression of a BMP-7 polypeptide in the treatment of osteoarthritis in a mammal. An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Monahan et al, Flannery et al and Fischer; coupled with a high level of skill for an ordinary skilled artisan in the relevant art. The recombinant AAV5 virus resulting from the combined teachings of Monahan et al, Flannery et al and Fischer as set forth above is indistinguishable and encompassed by the presently claimed invention. Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary. Examiner’s Comment The prior art did not teach or fairly suggest a nucleic acid sequence encoding a canine lubricin polypeptide that has at least 90% identity to the nucleotide sequence of SEQ ID NO: 6 of the present application; or a nucleic acid sequence encoding a canine lubricin polypeptide comprising the amino acid sequence at least 90% identical to the amino acid sequence of SEQ ID NO: 7 of the present application. Conclusion No claim is allowed. Claims 4 and 6 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Quang Nguyen, Ph.D., whose telephone number is (571) 272-0776. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s SPE, James D. Schultz, may be reached at (571) 272-0763. Any inquiry of a general nature or relating to the status of this application or proceeding should be directed to (571) 272-0547. Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll-free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. /QUANG NGUYEN/Primary Examiner, Art Unit 1631 Sequence 10, Patent No. 7642236 Recombinant PRG4-Lub:2 cDNA construct. Alignment Scores: Length: 3024 Score: 3934.00 Matches: 765 Percent Similarity: 82.3% Conservative: 69 Best Local Similarity: 75.5% Mismatches: 141 Query Match: 75.0% Indels: 38 Gaps: 17 US-18-407-298-7 (1-981) x US-10-567-764-10 (1-3024) Qy 1 MetGlnTrpLysIleLeuProIleTyr---LeuLeuLeuLeuSerValPheLeuIleGln 19 ||| |||||| |||||||||||| |||||||||||||||||||||:::|||||| Db 1 ATGGCATGGAAAACACTTCCCATTTACCTGTTGTTGCTGCTGTCTGTTTTCGTGATTCAG 60 Qy 20 GlnValSerSerGlnAspLeuProSerCysAlaGlyArgCysGlyGluGlyTyrSerArg 39 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Db 61 CAAGTTTCATCTCAAGATTTATCAAGCTGTGCAGGGAGATGTGGGGAAGGGTATTCTAGA 120 Qy 40 AspAlaIleCysAsnCysAspTyrAsnCysGlnHisTyrMetGluCysCysProAspPhe 59 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 GATGCCACCTGCAACTGTGATTATAACTGTCAACACTACATGGAGTGCTGCCCTGATTTC 180 Qy 60 LysLysAlaCysThrValGluLeuSerCysLysGlyArgCysPheGluSerPheAlaArg 79 |||::: |||||| |||||||||||||||||||||||||||||||||||| ||| Db 181 AAGAGAGTCTGCACTGCGGAGCTTTCCTGTAAAGGCCGCTGCTTTGAGTCCTTCGAGAGA 240 Qy 80 GlyArgGluCysAspCysAspSerAspCysLysLysTyrGlyLysCysCysProAspTyr 99 |||||||||||||||||||||::: |||||||||||| |||||||||||||||||| Db 241 GGGAGGGAGTGTGACTGCGACGCCCAATGTAAGAAGTATGACAAGTGCTGTCCCGATTAT 300 Qy 100 GluAspPheCysGlyArgValHisAsnProThrSerProProSerSerLysThrAlaPro 119 ||| |||||| ||||||||||||||||||||||||||||||||| |||||| Db 301 GAGAGTTTCTGTGCAGAAGTGCATAATCCCACATCACCACCATCTTCAAAGAAAGCACCT 360 Qy 120 ProSerProGlyAlaSerGlnThrIleLysSerThrAlaLysArgSerProLysAlaPro 139 ||| ||||||||||||||||||||||||||| ||||||||||||||| ||| Db 361 CCACCTTCAGGAGCATCTCAAACCATCAAATCAACAACCAAACGTTCACCCAAACCACCA 420 Qy 140 AsnLysLysLysThrLysLysValIleGluSerGluGluIleThrGluGluHisSerVal 159 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 AACAAGAAGAAGACTAAGAAAGTTATAGAATCAGAGGAAATAACAGAAGAACATTCTGTT 480 Qy 160 SerGluAsnGlnGlu------SerSerSerSerSerSerSerSerSerSerThrIleArg 177 ||||||||||||||| |||||||||||||||||||||||||||||||||||| Db 481 TCTGAAAATCAAGAGTCCTCCTCCAGTAGCAGTTCAAGTAGTTCGTCGTCGACAATTTGG 540 Qy 178 LysIleLysSerSerLysAsnSerAlaAlaAsnLysGluLeuLysLysLysProLysVal 197 |||||||||||||||||||||||||||||||||:::||||||:::|||||| |||||| Db 541 AAAATCAAGTCTTCCAAAAATTCAGCTGCTAATAGAGAATTACAGAAGAAACTCAAAGTA 600 Qy 198 LysAspAsnLysLysGluArgThrProLysLysLysProProProGluProProValVal 217 ||||||||||||||| |||||| |||||||||||| |||:::|||||||||||| Db 601 AAAGATAACAAGAAGAACAGAACT---AAAAAGAAACCTACCCCCAAACCACCAGTTGTA 657 Qy 218 AspGluAlaGlySerGlyLeuAspAsnGlyAspIleLysLeuThrProThrProAspIle 237 ||||||||||||||||||||||||||||||||| |||:::||| ||||||||| Db 658 GATGAAGCTGGAAGTGGATTGGACAATGGTGACTTCAAGGTCACA---ACTCCTGACACG 714 Qy 238 ProThrThrGlnArgAsnLysValThrThrSerProLysPheThrThrGlyLysProIle 257 ||||||||| |||||||||:::|||||||||||| |||||| ||||||||| Db 715 TCTACCACCCAACACAATAAAGTCAGCACATCTCCCAAGATCACAACAGCAAAACCAATA 774 Qy 258 AsnProLysProSerLeuProProAsnThrAspThrSerLysGluThrSerSerThrPro 277 ||||||:::||||||||||||||||||:::||||||||||||||||||||| ||| Db 775 AATCCCAGACCCAGTCTTCCACCTAATTCTGATACATCTAAAGAGACGTCTTTGACAGTG 834 Qy 278 AsnLysGluThrThrValLysSerLysGlu---ThrLeuAlaAsnLysGluThrSerSer 296 ||||||||||||||||||::::::|||||| ||| ||||||:::||||||::: Db 835 AATAAAGAGACAACAGTTGAAACTAAAGAAACTACTACAACAAATAAACAGACTTCAACT 894 Qy 297 LysAlaLysGluLysIleThrSerAlaLysGluThrArgSerAlaGluLysThrProAla 316 ||||||||| ||||||||||||||||||:::||| ||||||||| ||| Db 895 GATGGAAAAGAGAAGACTACTTCCGCTAAAGAGACACAAAGTATAGAGAAAACATCTGCT 954 Qy 317 LysAspPheValProThrThrLysAlaProValLysSerThrProLysAlaGluSerThr 336 |||||| ||||||:::||| ||| |||||||||||||||:::||| Db 955 AAAGATTTAGCACCCACATCTAAAGTGCTGGCTAAACCTACACCCAAAGCTGAAACTACA 1014 Qy 337 ThrLysSerProAlaProThrThrThrLysGluProThrProThrThrThrLysLysPro 356 |||||| |||||| |||||| ||||||||||||||||||||| |||:::||| Db 1015 ACCAAAGGCCCTGCTCTCACCACTCCCAAGGAGCCCACGCCCACCACTCCCAAGGAGCCT 1074 Qy 357 AlaProThrThrProLysLysPro---------------------AlaProThrThrPro 369 ||| ||||||||||||:::||| ||||||||||||||| Db 1075 GCATCTACCACACCCAAAGAGCCCACACCTACCACCATCAAGAGCGCGCCCACAACTCCA 1134 Qy 370 LysGluProValProThrThrThrLysGlyProProThrThrProLysLysProGluPro 389 ||||||||| ||||||||||||||| |||||||||||||||:::||| ||| Db 1135 AAAGAGCCCGCACCTACCACGACAAAGTCAGCTCCTACTACGCCCAAAGAGCCAGCGCCG 1194 Qy 390 ThrThrProLysAspProAlaProThrThrThrLysGluProThrProThrThrProLys 409 |||||| |||:::||||||||||||||| ||||||||| ||||||||| ||| Db 1195 ACGACTACTAAAGAACCGGCACCCACCACGCCTAAAGAACCAGCCCCTACTACGACAAAG 1254 Qy 410 LysPro---------------------AlaProThrThrProLysGluProValProThr 422 :::||| |||||||||||||||||||||||| |||||| Db 1255 GAGCCTGCACCCACAACCACGAAGAGCGCACCCACAACACCAAAGGAGCCGGCCCCTACG 1314 Qy 423 Thr---------ThrGluProAlaProAlaSerLeuGluThrProAlaProThrThrSer 439 ||| :::||||||||| ::: ||||||||| |||||||||||| Db 1315 ACTCCTAAGGAACCCAAACCGGCACCAACCACTCCGGAAACACCTCCTCCAACCACTTCA 1374 Qy 440 AspAlaPheThrThrThrThrThrMetGluProProThrThrProLysAsnProAlaGlu 459 ::: ||| ||||||||| |||||| ||| |||:::||| ||| Db 1375 GAGGTCTCTACTCCAACTACCACCAAGGAGCCTACCACTATCCACAAAAGCCCTGATGAA 1434 Qy 460 SerThrProLysPheProAlaGluProThrProLysProLeuGluAsnSerProLysGlu 479 |||||||||::: |||||||||||||||||| ||||||||||||||||||||| Db 1435 TCAACTCCTGAGCTTTCTGCAGAACCCACACCAAAAGCTCTTGAAAACAGTCCCAAGGAA 1494 Qy 480 ProValValProIleThrLysAlaProGluValThrLysProGluMetThrThrThrAla 499 ||| |||||| |||||| ||| ||||||||||||||||||||||||||| Db 1495 CCTGGTGTACCTACAACTAAGACGCCGGCGGCGACTAAACCTGAAATGACTACAACAGCT 1554 Qy 500 LysAspLysThrThrGluLysAspIle------IleProGluIleThrThrAlaValPro 517 ||||||||||||||||||:::|||::: |||||| ||||||||| ||| Db 1555 AAAGACAAGACAACAGAAAGAGACTTACGTACTACACCTGAAACTACAACTGCTGCACCT 1614 Qy 518 LysIleThrThrGlnGluThrAlaThrProThrGluGluThrThrThrGluSerLysThr 537 |||::: |||:::|||||||||||| ||||||:::|||||| ||| Db 1615 AAGATG---ACAAAAGAGACAGCAACTACAACAGAAAAAACTACCGAATCCAAAATAACA 1671 Qy 538 SerThrThrThrGlnValThrSerThrThrSerSerLysAsnThrPro------------ 553 :::|||||||||||||||||||||||||||::: |||||| Db 1672 GCTACAACCACACAAGTAACATCTACCACAACTCAAGATACCACACCATTCAAAATTACT 1731 Qy 554 ------LysAlaThrThrLeuAlaProLysValMetThrAlaThrGlnLysThrThrThr 571 ||| ||||||||||||||||||||| ||| |||:::|||||| ||| Db 1732 ACTCTTAAAACAACTACTCTTGCACCCAAAGTA---ACTACAACAAAAAAGACAATTACT 1788 Qy 572 ThrGluGluThrMetAsnLysProGluGluThrThrAlaValProLysAspThrAlaThr 591 ||| ||| |||||||||||||||||| |||||| ||||||||| |||||| Db 1789 ACCACTGAGATTATGAACAAACCTGAAGAA---ACAGCTAAACCAAAAGACAGAGCTACT 1845 Qy 592 SerThrLysValSerThrProArgProArgLysProThrLysAlaProLysLysProThr 611 ::::::||| :::||||||:::|||:::|||||||||||||||||||||||||||||| Db 1846 AATTCTAAAGCGACAACTCCTAAACCTCAAAAGCCAACCAAAGCACCCAAAAAACCCACT 1905 Qy 612 SerThrLysLysProAsnThrIleProLysArgLysLysProLysThrThrProThrPro 631 ||||||||||||||| |||:::|||::: :::|||||||||||||||||||||||| Db 1906 TCTACCAAAAAGCCAAAAACAATGCCTAGAGTGAGAAAACCAAAGACGACACCAACTCCC 1965 Qy 632 ProLysMetThrThrSerThrMetProLysLeuHisProThrSerSerVal---GluAla 650 |||||| |||||||||||||||:::|||:::||||||||| ::: |||||| Db 1966 CGCAAGATG---ACATCAACAATGCCAGAATTGAACCCTACCTCAAGAATAGCAGAAGCC 2022 Qy 651 MetLeuGlnThrThrThrSerProAsnGlnArgProAsnSerGluIleValGluValAsn 670 |||||||||||||||||| ||||||||| |||||||||::::::|||||||||||| Db 2023 ATGCTCCAAACCACCACCAGACCTAACCAAACTCCAAACTCCAAACTAGTTGAAGTAAAT 2082 Qy 671 Pro---AsnGluAspThrAspAlaAla---GlyLysLysProHisMetPheProArgPro 688 ||| :::|||||| ||| |||::: ||||||||| |||||| Db 2083 CCAAAGAGTGAAGATGCAGGTGGTGCTGAAGGAGAAACACCTCATATGCTTCTCAGGCCC 2142 Qy 689 ProValLeuThrProIlePheIleProGlyThrAspIleLeuValArgGlySerAsnGln 708 ||| ||| ||| ||| ||| ||| |||||| Db 2143 CATGTGTTCATGCCTGAAGTTACTCCCGACATGGATTACTTACCGAGAGTACCCAATCAA 2202 Qy 709 AspIleAlaIleAsnProMetLeuSerAspGluThrAsnLeuCysAsnGlyLysProVal 728 ||| ||||||||||||||||||||||||||||||:::|||||||||||||||||| Db 2203 GGCATTATCATCAATCCCATGCTTTCCGATGAGACCAATATATGCAATGGTAAGCCAGTA 2262 Qy 729 AspGlyLeuThrThrLeuArgAsnGlyThrMetValAlaPheArgGlyHisTyrPheTrp 748 ||||||||||||||||||||||||||||||:::||||||||||||||||||||||||||| Db 2263 GATGGACTGACTACTTTGCGCAATGGGACATTAGTTGCATTCCGAGGTCATTATTTCTGG 2322 Qy 749 MetLeuSerProSerAsnProProSerProProArgLysIleThrGluValTrpGlyIle 768 |||||||||||| :::|||||||||||| |||:::||||||||||||||||||||| Db 2323 ATGCTAAGTCCATTCAGTCCACCATCTCCAGCTCGCAGAATTACTGAAGTTTGGGGTATT 2382 Qy 769 ProSerProIleAspThrValPheThrArgCysAsnCysGluGlyLysThrPhePhePhe 788 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2383 CCTTCCCCCATTGATACTGTTTTTACTAGGTGCAACTGTGAAGGAAAAACTTTCTTCTTT 2442 Qy 789 LysGlySerGlnTyrTrpArgPheThrAsnAspIleLysAspAlaGlyTyrProLysGln 808 ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2443 AAGGATTCTCAGTACTGGCGTTTTACCAATGATATAAAAGATGCAGGGTACCCCAAACCA 2502 Qy 809 IleValLysGlyPheGlyGlyLeuAsnGlyArgIleValAlaAlaLeuSerIleAlaLys 828 ||| |||||||||||||||||| |||:::|||||||||||||||||| |||||| Db 2503 ATTTTCAAAGGATTTGGAGGACTAACTGGACAAATAGTGGCAGCGCTTTCAACAGCTAAA 2562 Qy 829 TyrLysAspArgProGluSerValTyrPhePheLysArgGlyGlySerValGlnGlnTyr 848 ||||||::: ||||||||||||||||||||||||||||||||||||:::||||||||| Db 2563 TATAAGAACTGGCCTGAATCTGTGTATTTTTTCAAGAGAGGTGGCAGCATTCAGCAGTAT 2622 Qy 849 ThrTyrLysGlnGluProIleLysLysCysThrGlyArgArgProAlaIleAsnTyrPro 868 |||||||||||||||::::::|||||| |||||||||||||||:::||||||||| Db 2623 ATTTATAAACAGGAACCTGTACAGAAGTGCCCTGGAAGAAGGCCTGCTCTAAATTATCCA 2682 Qy 869 ValTyrGlyGluThrThrGlnValArgArgArgArgPheGluArgAlaIleGlyProSer 888 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Db 2683 GTGTATGGAGAAATGACACAGGTTAGGAGACGTCGCTTTGAACGTGCTATAGGACCTTCT 2742 Qy 889 GlnThrHisThrIleArgIleHisTyrSerProIleArgValSerTyrGlnAspLysGly 908 ||||||||||||||||||||| ||||||||| |||::::::||||||||||||||| Db 2743 CAAACACACACCATCAGAATTCAATATTCACCTGCCAGACTGGCTTATCAAGACAAAGGT 2802 Qy 909 PheLeuHisAsnGluValLysMetSerSerGlnTrpArgGlyPheProAsnValValThr 928 ||||||||||||||||||:::||| ||||||||| ||||||||||||||| Db 2803 GTCCTTCATAATGAAGTTAAAGTGAGTATACTGTGGAGAGGACTTCCAAATGTGGTTACC 2862 Qy 929 SerAlaIleAlaLeuProAsnIleArgLysProAspGlyTyrAspTyrTyrAlaPheSer 948 |||||||||:::|||||||||||||||||||||||||||||||||||||||||||||||| Db 2863 TCAGCTATATCACTGCCCAACATCAGAAAACCTGACGGCTATGATTACTATGCCTTTTCT 2922 Qy 949 ArgAsnGlnTyrTyrAsnIleAspValProSerArgThrAlaArgValValThrThrArg 968 ::::::||||||||||||||||||||||||||||||||||||||| :::||||||||| Db 2923 AAAGATCAATACTATAACATTGATGTGCCTAGTAGAACAGCAAGAGCAATTACTACTCGT 2982 Qy 969 PheGlyArgThrLeuSerAsnIleTrpTyrAsnCysPro 981 |||:::||||||||| :::||||||||||||||| Db 2983 TCTGGGCAGACCTTATCCAAAGTCTGGTACAACTGTCCT 3021 Sequence 14, Patent No. 7642236 Recombinant PRG4-Lub:3 cDNA construct. Alignment Scores: Length: 3117 Score: 3936.50 Matches: 769 Percent Similarity: 80.3% Conservative: 69 Best Local Similarity: 73.7% Mismatches: 137 Query Match: 75.1% Indels: 69 Gaps: 18 US-18-407-298-7 (1-981) x US-10-567-764-14 (1-3117) Qy 1 MetGlnTrpLysIleLeuProIleTyr---LeuLeuLeuLeuSerValPheLeuIleGln 19 ||| |||||| |||||||||||| |||||||||||||||||||||:::|||||| Db 1 ATGGCATGGAAAACACTTCCCATTTACCTGTTGTTGCTGCTGTCTGTTTTCGTGATTCAG 60 Qy 20 GlnValSerSerGlnAspLeuProSerCysAlaGlyArgCysGlyGluGlyTyrSerArg 39 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Db 61 CAAGTTTCATCTCAAGATTTATCAAGCTGTGCAGGGAGATGTGGGGAAGGGTATTCTAGA 120 Qy 40 AspAlaIleCysAsnCysAspTyrAsnCysGlnHisTyrMetGluCysCysProAspPhe 59 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 GATGCCACCTGCAACTGTGATTATAACTGTCAACACTACATGGAGTGCTGCCCTGATTTC 180 Qy 60 LysLysAlaCysThrValGluLeuSerCysLysGlyArgCysPheGluSerPheAlaArg 79 |||::: |||||| |||||||||||||||||||||||||||||||||||| ||| Db 181 AAGAGAGTCTGCACTGCGGAGCTTTCCTGTAAAGGCCGCTGCTTTGAGTCCTTCGAGAGA 240 Qy 80 GlyArgGluCysAspCysAspSerAspCysLysLysTyrGlyLysCysCysProAspTyr 99 |||||||||||||||||||||::: |||||||||||| |||||||||||||||||| Db 241 GGGAGGGAGTGTGACTGCGACGCCCAATGTAAGAAGTATGACAAGTGCTGTCCCGATTAT 300 Qy 100 GluAspPheCysGlyArgValHisAsnProThrSerProProSerSerLysThrAlaPro 119 ||| |||||| ||||||||||||||||||||||||||||||||| |||||| Db 301 GAGAGTTTCTGTGCAGAAGTGCATAATCCCACATCACCACCATCTTCAAAGAAAGCACCT 360 Qy 120 ProSerProGlyAlaSerGlnThrIleLysSerThrAlaLysArgSerProLysAlaPro 139 ||| ||||||||||||||||||||||||||| ||||||||||||||| ||| Db 361 CCACCTTCAGGAGCATCTCAAACCATCAAATCAACAACCAAACGTTCACCCAAACCACCA 420 Qy 140 AsnLysLysLysThrLysLysValIleGluSerGluGluIleThrGluGluHisSerVal 159 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 AACAAGAAGAAGACTAAGAAAGTTATAGAATCAGAGGAAATAACAGAAGAACATTCTGTT 480 Qy 160 SerGluAsnGlnGlu------SerSerSerSerSerSerSerSerSerSerThrIleArg 177 ||||||||||||||| |||||||||||||||||||||||||||||||||||| Db 481 TCTGAAAATCAAGAGTCCTCCTCCAGTAGCAGTTCAAGTAGTTCGTCGTCGACAATTTGG 540 Qy 178 LysIleLysSerSerLysAsnSerAlaAlaAsnLysGluLeuLysLysLysProLysVal 197 |||||||||||||||||||||||||||||||||:::||||||:::|||||| |||||| Db 541 AAAATCAAGTCTTCCAAAAATTCAGCTGCTAATAGAGAATTACAGAAGAAACTCAAAGTA 600 Qy 198 LysAspAsnLysLysGluArgThrProLysLysLysProProProGluProProValVal 217 ||||||||||||||| |||||| |||||||||||| |||:::|||||||||||| Db 601 AAAGATAACAAGAAGAACAGAACT---AAAAAGAAACCTACCCCCAAACCACCAGTTGTA 657 Qy 218 AspGluAlaGlySerGlyLeuAspAsnGlyAspIleLysLeuThrProThrProAspIle 237 ||||||||||||||||||||||||||||||||| |||:::||| ||||||||| Db 658 GATGAAGCTGGAAGTGGATTGGACAATGGTGACTTCAAGGTCACA---ACTCCTGACACG 714 Qy 238 ProThrThrGlnArgAsnLysValThrThrSerProLysPheThrThrGlyLysProIle 257 ||||||||| |||||||||:::|||||||||||| |||||| ||||||||| Db 715 TCTACCACCCAACACAATAAAGTCAGCACATCTCCCAAGATCACAACAGCAAAACCAATA 774 Qy 258 AsnProLysProSerLeuProProAsnThrAspThrSerLysGluThrSerSerThrPro 277 ||||||:::||||||||||||||||||:::||||||||||||||||||||| ||| Db 775 AATCCCAGACCCAGTCTTCCACCTAATTCTGATACATCTAAAGAGACGTCTTTGACAGTG 834 Qy 278 AsnLysGluThrThrValLysSerLysGlu---ThrLeuAlaAsnLysGluThrSerSer 296 ||||||||||||||||||::::::|||||| ||| ||||||:::||||||::: Db 835 AATAAAGAGACAACAGTTGAAACTAAAGAAACTACTACAACAAATAAACAGACTTCAACT 894 Qy 297 LysAlaLysGluLysIleThrSerAlaLysGluThrArgSerAlaGluLysThrProAla 316 ||||||||| ||||||||||||||||||:::||| ||||||||| ||| Db 895 GATGGAAAAGAGAAGACTACTTCCGCTAAAGAGACACAAAGTATAGAGAAAACATCTGCT 954 Qy 317 LysAspPheValProThrThrLysAlaProValLysSerThrProLysAlaGluSerThr 336 |||||| ||||||:::||| ||| |||||||||||||||:::||| Db 955 AAAGATTTAGCACCCACATCTAAAGTGCTGGCTAAACCTACACCCAAAGCTGAAACTACA 1014 Qy 337 ThrLysSerProAlaProThrThrThrLysGluProThrProThrThrThrLysLysPro 356 |||||| |||||| |||||| ||||||||||||||||||||| |||:::||| Db 1015 ACCAAAGGCCCTGCTCTCACCACTCCCAAGGAGCCCACGCCCACCACTCCCAAGGAGCCT 1074 Qy 357 AlaProThrThrProLysLysPro---------------------AlaProThrThrPro 369 ||| ||||||||||||:::||| ||||||||||||||| Db 1075 GCATCTACCACACCCAAAGAGCCCACACCTACCACCATCAAGAGCGCGCCCACAACTCCA 1134 Qy 370 LysGluProValProThrThrThrLysGlyProProThrThrPro--------------- 384 ||||||||| ||||||||||||||| |||||||||||| Db 1135 AAAGAGCCCGCACCTACCACGACAAAGTCAGCTCCTACTACGCCCAAAGAGCCAGCGCCG 1194 Qy 385 ---------LysLysProGluProThrThrProLysAspProAlaProThrThrThrLys 401 |||:::||| |||||||||||||||:::||||||||||||||||||||| Db 1195 ACGACTACTAAAGAACCGGCACCCACCACGCCTAAAGAACCAGCCCCTACTACGACAAAG 1254 Qy 402 GluPro---------------------ThrProThrThrProLysLysProAlaProThr 414 |||||| |||||||||||||||:::|||||||||||| Db 1255 GAGCCTGCACCCACAACCACGAAGAGCGCACCCACAACACCAAAGGAGCCGGCCCCTACG 1314 Qy 415 ThrProLysGluProValProThrThrThr------------------------------ 424 ||||||||||||||| |||||||||||| Db 1315 ACTCCTAAAGAACCAGCCCCTACTACGACAAAGGAGCCTGCACCCACAACCACGAAGAGC 1374 Qy 425 ------------------------------------------------GluProAlaPro 428 :::||||||||| Db 1375 GCACCCACAACACCAAAGGAGCCGGCCCCTACGACTCCTAAGGAACCCAAACCGGCACCA 1434 Qy 429 AlaSerLeuGluThrProAlaProThrThrSerAspAlaPheThrThrThrThrThrMet 448 ::: ||||||||| ||||||||||||::: ||| ||||||||| Db 1435 ACCACTCCGGAAACACCTCCTCCAACCACTTCAGAGGTCTCTACTCCAACTACCACCAAG 1494 Qy 449 GluProProThrThrProLysAsnProAlaGluSerThrProLysPheProAlaGluPro 468 |||||| ||| |||:::||| ||||||||||||::: ||||||||| Db 1495 GAGCCTACCACTATCCACAAAAGCCCTGATGAATCAACTCCTGAGCTTTCTGCAGAACCC 1554 Qy 469 ThrProLysProLeuGluAsnSerProLysGluProValValProIleThrLysAlaPro 488 ||||||||| |||||||||||||||||||||||| |||||| |||||| ||| Db 1555 ACACCAAAAGCTCTTGAAAACAGTCCCAAGGAACCTGGTGTACCTACAACTAAGACGCCG 1614 Qy 489 GluValThrLysProGluMetThrThrThrAlaLysAspLysThrThrGluLysAspIle 508 |||||||||||||||||||||||||||||||||||||||||||||:::|||::: Db 1615 GCGGCGACTAAACCTGAAATGACTACAACAGCTAAAGACAAGACAACAGAAAGAGACTTA 1674 Qy 509 ------IleProGluIleThrThrAlaValProLysIleThrThrGlnGluThrAlaThr 526 |||||| ||||||||| ||||||::: |||:::|||||||||||| Db 1675 CGTACTACACCTGAAACTACAACTGCTGCACCTAAGATG---ACAAAAGAGACAGCAACT 1731 Qy 527 ProThrGluGluThrThrThrGluSerLysThrSerThrThrThrGlnValThrSerThr 546 ||||||:::|||||| |||:::|||||||||||||||||||||||| Db 1732 ACAACAGAAAAAACTACCGAATCCAAAATAACAGCTACAACCACACAAGTAACATCTACC 1791 Qy 547 ThrSerSerLysAsnThrPro------------------LysAlaThrThrLeuAlaPro 560 |||::: |||||| ||| ||||||||||||||| Db 1792 ACAACTCAAGATACCACACCATTCAAAATTACTACTCTTAAAACAACTACTCTTGCACCC 1851 Qy 561 LysValMetThrAlaThrGlnLysThrThrThrThrGluGluThrMetAsnLysProGlu 580 |||||| ||| |||:::|||||| |||||| ||| ||||||||||||||| Db 1852 AAAGTA---ACTACAACAAAAAAGACAATTACTACCACTGAGATTATGAACAAACCTGAA 1908 Qy 581 GluThrThrAlaValProLysAspThrAlaThrSerThrLysValSerThrProArgPro 600 ||| |||||| ||||||||| ||||||::::::||| :::||||||:::||| Db 1909 GAA---ACAGCTAAACCAAAAGACAGAGCTACTAATTCTAAAGCGACAACTCCTAAACCT 1965 Qy 601 ArgLysProThrLysAlaProLysLysProThrSerThrLysLysProAsnThrIlePro 620 :::||||||||||||||||||||||||||||||||||||||||||||| |||:::||| Db 1966 CAAAAGCCAACCAAAGCACCCAAAAAACCCACTTCTACCAAAAAGCCAAAAACAATGCCT 2025 Qy 621 LysArgLysLysProLysThrThrProThrProProLysMetThrThrSerThrMetPro 640 ::: :::|||||||||||||||||||||||| |||||| ||||||||||||||| Db 2026 AGAGTGAGAAAACCAAAGACGACACCAACTCCCCGCAAGATG---ACATCAACAATGCCA 2082 Qy 641 LysLeuHisProThrSerSerVal---GluAlaMetLeuGlnThrThrThrSerProAsn 659 :::|||:::||||||||| ::: |||||||||||||||||||||||| |||||| Db 2083 GAATTGAACCCTACCTCAAGAATAGCAGAAGCCATGCTCCAAACCACCACCAGACCTAAC 2142 Qy 660 GlnArgProAsnSerGluIleValGluValAsnPro---AsnGluAspThrAspAlaAla 678 ||| |||||||||::::::||||||||||||||| :::|||||| ||| Db 2143 CAAACTCCAAACTCCAAACTAGTTGAAGTAAATCCAAAGAGTGAAGATGCAGGTGGTGCT 2202 Qy 679 ---GlyLysLysProHisMetPheProArgProProValLeuThrProIlePheIlePro 697 |||::: ||||||||| |||||| ||| ||| ||| Db 2203 GAAGGAGAAACACCTCATATGCTTCTCAGGCCCCATGTGTTCATGCCTGAAGTTACTCCC 2262 Qy 698 GlyThrAspIleLeuValArgGlySerAsnGlnAspIleAlaIleAsnProMetLeuSer 717 ||| ||| ||| |||||| ||| |||||||||||||||||| Db 2263 GACATGGATTACTTACCGAGAGTACCCAATCAAGGCATTATCATCAATCCCATGCTTTCC 2322 Qy 718 AspGluThrAsnLeuCysAsnGlyLysProValAspGlyLeuThrThrLeuArgAsnGly 737 ||||||||||||:::||||||||||||||||||||||||||||||||||||||||||||| Db 2323 GATGAGACCAATATATGCAATGGTAAGCCAGTAGATGGACTGACTACTTTGCGCAATGGG 2382 Qy 738 ThrMetValAlaPheArgGlyHisTyrPheTrpMetLeuSerProSerAsnProProSer 757 |||:::||||||||||||||||||||||||||||||||||||||| :::||||||||| Db 2383 ACATTAGTTGCATTCCGAGGTCATTATTTCTGGATGCTAAGTCCATTCAGTCCACCATCT 2442 Qy 758 ProProArgLysIleThrGluValTrpGlyIleProSerProIleAspThrValPheThr 777 ||| |||:::|||||||||||||||||||||||||||||||||||||||||||||||| Db 2443 CCAGCTCGCAGAATTACTGAAGTTTGGGGTATTCCTTCCCCCATTGATACTGTTTTTACT 2502 Qy 778 ArgCysAsnCysGluGlyLysThrPhePhePheLysGlySerGlnTyrTrpArgPheThr 797 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Db 2503 AGGTGCAACTGTGAAGGAAAAACTTTCTTCTTTAAGGATTCTCAGTACTGGCGTTTTACC 2562 Qy 798 AsnAspIleLysAspAlaGlyTyrProLysGlnIleValLysGlyPheGlyGlyLeuAsn 817 |||||||||||||||||||||||||||||| ||| |||||||||||||||||| Db 2563 AATGATATAAAAGATGCAGGGTACCCCAAACCAATTTTCAAAGGATTTGGAGGACTAACT 2622 Qy 818 GlyArgIleValAlaAlaLeuSerIleAlaLysTyrLysAspArgProGluSerValTyr 837 |||:::|||||||||||||||||| ||||||||||||::: ||||||||||||||| Db 2623 GGACAAATAGTGGCAGCGCTTTCAACAGCTAAATATAAGAACTGGCCTGAATCTGTGTAT 2682 Qy 838 PhePheLysArgGlyGlySerValGlnGlnTyrThrTyrLysGlnGluProIleLysLys 857 |||||||||||||||||||||:::||||||||| |||||||||||||||::::::||| Db 2683 TTTTTCAAGAGAGGTGGCAGCATTCAGCAGTATATTTATAAACAGGAACCTGTACAGAAG 2742 Qy 858 CysThrGlyArgArgProAlaIleAsnTyrProValTyrGlyGluThrThrGlnValArg 877 ||| |||||||||||||||:::||||||||||||||||||||| |||||||||||| Db 2743 TGCCCTGGAAGAAGGCCTGCTCTAAATTATCCAGTGTATGGAGAAATGACACAGGTTAGG 2802 Qy 878 ArgArgArgPheGluArgAlaIleGlyProSerGlnThrHisThrIleArgIleHisTyr 897 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Db 2803 AGACGTCGCTTTGAACGTGCTATAGGACCTTCTCAAACACACACCATCAGAATTCAATAT 2862 Qy 898 SerProIleArgValSerTyrGlnAspLysGlyPheLeuHisAsnGluValLysMetSer 917 |||||| |||::::::||||||||||||||| ||||||||||||||||||:::||| Db 2863 TCACCTGCCAGACTGGCTTATCAAGACAAAGGTGTCCTTCATAATGAAGTTAAAGTGAGT 2922 Qy 918 SerGlnTrpArgGlyPheProAsnValValThrSerAlaIleAlaLeuProAsnIleArg 937 ||||||||| ||||||||||||||||||||||||:::||||||||||||||| Db 2923 ATACTGTGGAGAGGACTTCCAAATGTGGTTACCTCAGCTATATCACTGCCCAACATCAGA 2982 Qy 938 LysProAspGlyTyrAspTyrTyrAlaPheSerArgAsnGlnTyrTyrAsnIleAspVal 957 |||||||||||||||||||||||||||||||||::::::||||||||||||||||||||| Db 2983 AAACCTGACGGCTATGATTACTATGCCTTTTCTAAAGATCAATACTATAACATTGATGTG 3042 Qy 958 ProSerArgThrAlaArgValValThrThrArgPheGlyArgThrLeuSerAsnIleTrp 977 |||||||||||||||||| :::||||||||| |||:::||||||||| :::||| Db 3043 CCTAGTAGAACAGCAAGAGCAATTACTACTCGTTCTGGGCAGACCTTATCCAAAGTCTGG 3102 Qy 978 TyrAsnCysPro 981 |||||||||||| Db 3103 TACAACTGTCCT 3114
Read full office action

Prosecution Timeline

Jan 08, 2024
Application Filed
May 22, 2026
Non-Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12640251
METHODS OF TREATING DEMENTIA ASSOCIATED WITH ALZHEIMER'S DISEASE WITH PROTECTIVE PROTEIN/CATHEPSIN A (PPCA)
3y 9m to grant Granted May 26, 2026
Patent 12630805
Compositions and Methods of Treatment
3y 2m to grant Granted May 19, 2026
Patent 12612643
RNA-Guided Human Genome Engineering
5y 2m to grant Granted Apr 28, 2026
Patent 12612646
DNA VECTORS AND ELEMENTS FOR SUSTAINED GENE EXPRESSION IN EUKARYOTIC CELLS
2y 10m to grant Granted Apr 28, 2026
Patent 12454689
INTEGRATION OF MESA RECEPTORS AND PROMOTORS TO IMPLEMENT CUSTOMIZED CELLULAR FUNCTION
6y 1m to grant Granted Oct 28, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
38%
Grant Probability
91%
With Interview (+52.8%)
4y 0m (~1y 8m remaining)
Median Time to Grant
Low
PTA Risk
Based on 736 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month