Prosecution Insights
Last updated: May 29, 2026
Application No. 18/409,684

PAPN MUTANT, METHOD FOR SITE-DIRECTED MODIFICATION OF PAPN GENE AND USE THEREOF

Non-Final OA §103
Filed
Jan 10, 2024
Priority
Aug 11, 2023 — CN 202311010685.3
Examiner
DACE DENITO, ALEXANDRA GERALDINE
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Agsino Gensources Co. Ltd.
OA Round
4 (Non-Final)
56%
Grant Probability
Moderate
4-5
OA Rounds
1y 0m
Est. Remaining
93%
With Interview

Examiner Intelligence

Grants 56% of resolved cases
56%
Career Allowance Rate
26 granted / 46 resolved
-3.5% vs TC avg
Strong +36% interview lift
Without
With
+36.3%
Interview Lift
resolved cases with interview
Typical timeline
3y 5m
Avg Prosecution
37 currently pending
Career history
99
Total Applications
across all art units

Statute-Specific Performance

§101
2.4%
-37.6% vs TC avg
§103
63.6%
+23.6% vs TC avg
§102
4.8%
-35.2% vs TC avg
§112
10.0%
-30.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 46 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. Acknowledgment is made of applicant's claim for foreign priority under 35 U.S.C. 119(a)-(d) to CN202311010685.3 filed 08/11/2023. Application Status Amendments to claims filed 10/27/2025 are hereby acknowledged. Claims 11 and 22-24 are currently amended. Claims 1-10, and 12-21 have been cancelled. Claims 11 and 22-24 are under examination in this office action. Any objection or rejection not reiterated herein has been overcome by Applicant’s amendments and therefore is withdrawn. Information Disclosure Statement The information disclosure statement (IDS) submitted on 10/27/2025 was filed after the mailing date of the office action on 07/31/2025. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. Claim Objections Claim 11 is objected to because of the following informality: The term “system” is now missing after “(CRISPR)”. Claims 11 and 23-24 are objected to because of the following informalities: “a genetically edited protein of Cas9”; the term should be: “a genetically edited protein version of Cas9” or “a genetically edited protein Cas9”. Appropriate correction is required. The following rejections are maintained from previous office action dated 07/31/2025 and modified as necessitated by Amendments: Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or non-obviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 11 and 22 are rejected under 35 U.S.C. §103 as being unpatentable over Luo (Luo, L. et al. “Aminopeptidase N-null neonatal piglets are protected from transmissible gastroenteritis virus but not porcine epidemic diarrhea virus”. Scientific Reports, Vol. 9 (2019), p: 13186; previously cited), Mudgal (Mudgal, G. “Structural insights into coronavirus binding to host aminopeptidase N and interaction dynamics”. Universidad Autonoma de Madrid (2014)- academia.edu; previously cited), Prather (Prather, R.S. et al. US 2020/0236914_A1, published July 30, 2020, with priority date of April 26, 2019 for PCT filing; previously cited), Concordet (Concordet, J-P. et al. “CRISPOR: intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens.” Nucleic Acids Research, Vol. 46 (2018), pp: W242-W245; previously cited) and Inui (Inui, M. et al. Scientific Reports, Vol. 4 (2014), p: 5396; previously cited). Regarding claims 11 and 22, Luo teaches swine enteric diseases have caused significant economic loss and have been a major threat to the global swine industry (abstract, line 1). Aminopeptidase N (APN) is described as a putative receptor for entry of at least two of the viruses. Therefore, Luo teaches a method of making transgenic swine using CRISPR/Cas9 system for deleting part of APN (Aminopeptidase N) gene (see abstract and introduction section). Luo teaches that since APN has been suggested to be an endogenous receptor for viruses such as the Transmissible gastroenteritis virus (TGEV), knocking down APN gene should prevent infection by the virus (see page 2, lines 8-14). Luo teaches the production of APN knockout pigs using porcine fetal fibroblast cells and CRISPR/Cas9 double nicking nuclease and somatic cell nuclear transfer (see page 2, “[R]esults” section). Luo teaches introducing a CRISPR-Cas9 system into a porcine fibroblast cell using one targeting vector expressing Cas9n and one pair of sgRNA (see page 7, “Methods” section, “Plasmids” subsection). Luo also teaches that knocking APN in the fetal fibroblast for somatic cell nuclear transfer to make transgenic animals also affect/knock-down APN in the ileum in view of the distribution of TGEV antigen in the small intestine (see figure 3). Luo teaches that the study establishes pAPN (porcine Aminopeptidase N) is required for TGEV infection, and that pAPN may not be essential for porcine epidemic diarrhea virus (PEDV) infection (see page 5, “[D]iscussion” section). Luo also suggests that further work is needed and that “[F]uture work should be directed toward modifying only the critical binding site of APN with CoVs (coronaviruses) while maintaining other biological functions of APN”, since CD163-modified pigs, where only the exon responsible for PRRSV recognition is disrupted, are resistant to PRRSV (porcine reproductive and respiratory syndrome virus) and appear normal for other biological performance (page 5, “[D]iscussion section”, lines 6-11). Luo does not teach a specific targeting of a residue within pAPN as modification using the CRISPR/Cas9 system. Luo does not teach specifically three vectors for the expression of the CRISPR-Cas system. Luo does not teach SEQ ID NOs: 1-3. However, Mudgal teaches about the significance of residues of pAPN for binding to specific residues in the Receptor Binding Domain (RBD) of coronavirus (see “4.6. Crystal structure of the PRCV RBD bound to the pAPN ectodomain” , page 63, and “4.7.Critical motifs for coronavirus attachment to APN and infection” page 67, and see Figures 4.3 and 4.16). Regarding claims 11 and 22, Mudgal is drawn to the “Structural insights into coronavirus binding to host aminopeptide N and interaction dynamics” (title of Thesis). Mudgal teaches mutating positions in pAPN (page 72, lines 3-5) to test PRCV (porcine respiratory coronavirus) RBD binding. Mudgal teaches that the alpha helix 17 and residues between the alpha helix 17 and alpha helix 18 in pAPN are important for virus binding, especially residues F727, E731, K735, N736, W737, T738, and E739 (see below, and Figure 4.8, page 55). PNG media_image1.png 611 983 media_image1.png Greyscale Mudgal further teaches that residues at positions 727, 731, 736, 737, 764, 767, 768 and 771 are important for TGEV receptor binding (see Table 4.3, page 66). Therefore, Mudgal also teaches that position 727 in pAPN is important for CoV binding (see Figure 4.8 above and Table 4.3 below). PNG media_image2.png 681 734 media_image2.png Greyscale Mudgal also teach amino acid substitutions to alanine (Figure 4.16 and Table 4.4). In table 4.4 and Figure 4.16, all mutants are single mutation while maintaining all other amino acid residues found in the wild-type pAPN protein. Mudgal teaches amino acid position 727 as one that is essential. [Of note, in Table 4.3. position 727 is mentioned as G727, however in Figure 4.8, it is clear that the amino acid at position 727 is a Phenylalanine amino acid. Therefore, this is an error]. Mudgal also teaches mutating essential positions to alanine. Therefore, in view of Mudgal, one skilled in the art can produce one mutant with mutation at position 727 while maintaining other residues found in the wild type pAPN protein. Mudgal does not specifically teach mutating phenylalanine to alanine at position 727. Mudgal teaches motivation to target this specific residue. However, Prather teaches how to target specific residues in pANP. On page 13, right column, ¶ [0213]-[0214], Prather teaches the modification can be a substitution of a residue at position 738 or 792 to a different amino acid, such as alanine. Regarding claims 11 and 22, Prather teaches modifying chromosomal sequences of APN (also known in the art as ANPEP or CD13) to induce resistance to PRCV and TGEV (see abstract, ¶ [0002]). Prather teaches using a CRISPR system to modify pAPN to induce increase resistance to TGEV in cells and whole animal (see abstract, ¶ [0002]). Prather teaches the use of CRISPR system to modify and mutate pAPN ( ¶ [0039]-[0046], [0066]) in a germ cell (see ¶ [0372]-[0379]). Regarding claim 22, Prather also teaches SEQ ID NO: 135 (Figure 28) of wild type pAPN, which corresponds to SEQ ID NO:12 of wild type pAPN of claim 22. Prather teaches using guide RNAs (¶ [0096]) including guide RNAs for specific regions on the ANPEP sequence (¶ [0629]). Prather teaches using their SEQ ID NO: 132 to design CRISPR guide RNAs (¶ [0628]). Prather teaches instant disclosure’s SEQ ID NO: 12 (see Figure 28; SEQ ID NO:135). Prather also teaches designing guide RNAs using SEQ ID NO:132 (full length mRNA) (see ¶ [0629]-[0630], and Tables 19-20 and underlined and bolded sequences for gRNAs in figure 28). Prather’s SEQ ID NO: 132 includes both guide RNAs, SEQ ID NO:1 and SEQ ID NO:2 of claim 11. Prather also teaches that selection of target sites and design of crRNA/gRNA are well known in the art and provides a guide and website to do so (see ¶ [0370]). Prather teaches SEQ ID NO: 132 which corresponds to the wild type sequence and presents with 99.7% of local similarity to SEQ ID NO: 3. See alignment below (Prather’s US2020/0236914 A1); Qy (query) is SEQ ID NO: 3 of instant application; DB (database) is SEQ ID NO: 132 of Prather: SEQ ID NO 132 LENGTH: 29999 TYPE: DNA ORGANISM: Sus scrofa Query Match 99.5%; Score 995.2; Length 29999; Best Local Similarity 99.7%; Matches 997; Conservative 0; Mismatches 3; Indels 0; Gaps 0; Qy 1 CCTTTGAGCACAGTCTGGCCTTGTGCGAGGCCTTTAGCCTCTGGCCTCTTGCTCCTGTAG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21003 CCTTTGAGCACAGTCTGGCCTTGTGCGAGGCCTTTAGCCTCTGGCCTCTTGCTCCTGTAG 21062 Qy 61 CCATTAGCTCTTGCTACATCTGCCCACCCACATCAGAGGCTCCATGGGTCTCCAGATGAC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21063 CCATTAGCTCTTGCTACATCTGCCCACCCACATCAGAGGCTCCATGGGTCTCCAGATGAC 21122 Qy 121 TCAGGCATGAGTCTCTTCTTTGAAGCTATTTTTAGGGCTGCATCCTCGGCATGTGGAGGT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21123 TCAGGCATGAGTCTCTTCTTTGAAGCTATTTTTAGGGCTGCATCCTCGGCATGTGGAGGT 21182 Qy 181 TCCCAAGCTAGGGGTTGAATCGGAGCTGTAGCCGCCAGCCTACACCACAGCCACAGCAAC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21183 TCCCAAGCTAGGGGTTGAATCGGAGCTGTAGCCGCCAGCCTACACCACAGCCACAGCAAC 21242 Qy 241 ACGGGATCCGAGCCACATCTGCGACCTACACCACAGCTCACAGCAATGCCAGATCCTTAA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21243 ACGGGATCCGAGCCACATCTGCGACCTACACCACAGCTCACAGCAATGCCAGATCCTTAA 21302 Qy 301 CCCACTGAGTGGGGCCAGGGTTGAACCCATGTCCTCATGTTTCCCAGTCAGATTCGTTTC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21303 CCCACTGAGTGGGGCCAGGGTTGAACCCATGTCCTCATGTTTCCCAGTCAGATTCGTTTC 21362 Qy 361 TGCTGTGCCATGACGGGAACTCTGGAACTTCCTCTTTGAAGCTCTTTATGTTTTGTTCTT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21363 TGCTGTGCCATGACGGGAACTCTGGAACTTCCTCTTTGAAGCTCTTTATGTTTTGTTCTT 21422 Qy 421 GTTTTTTGTTTTTGTTTTTCTAGAAATACCTCAGGAAGCAAGTCGAACCCCTCGCCCAAC 480 |||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| Db 21423 GTTTTTTGTTTTTGTTTTTCTAGAAATACCTCAGGAAGCAGGTCGAACCCCTCTTCCAAC 21482 Qy 481 ATTTCGAAACTCTCACTAAAAACTGGACCGAGCGCCCAGAAAATCTGATGGACCAGTGAG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21483 ATTTCGAAACTCTCACTAAAAACTGGACCGAGCGCCCAGAAAATCTGATGGACCAGTGAG 21542 Qy 541 TATGAGCTCGCTTGGTCTGGAGATCATGGGTGGTGCAGGTAGCCTGACCTGGGGGCCCAT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21543 TATGAGCTCGCTTGGTCTGGAGATCATGGGTGGTGCAGGTAGCCTGACCTGGGGGCCCAT 21602 Qy 601 AGCAAGTCCAGCAGCATCCTCTCTGGAGCTCCCAACTCCTGGCCGGACCAGGGCCACAGT 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21603 AGCAAGTCCAGCAGCATCCTCTCTGGAGCTCCCAACTCCTGGCCGGACCAGGGCCACAGT 21662 Qy 661 CAGGGAGAGCGACCCCTCCCAACCCCACTCCCGGCCCCAGGAGTAGGGACTCTGCTCTGA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21663 CAGGGAGAGCGACCCCTCCCAACCCCACTCCCGGCCCCAGGAGTAGGGACTCTGCTCTGA 21722 Qy 721 GGCTCTGTGTGGCCTATGAACCATCTGGCCTCTTTGGGCAAAGGACCAAACTGAACCTCT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21723 GGCTCTGTGTGGCCTATGAACCATCTGGCCTCTTTGGGCAAAGGACCAAACTGAACCTCT 21782 Qy 781 GAGGGTCCCTCACCCGCATGGTGAGGTTCTAGGTGTTAAAGCTGGGGCTGGAGCCTGTGC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21783 GAGGGTCCCTCACCCGCATGGTGAGGTTCTAGGTGTTAAAGCTGGGGCTGGAGCCTGTGC 21842 Qy 841 CAGCCCTCCCCAGGCTGCCCAAGGGCAAGAAGCAAAGAAGGGAACCCAAAGGTGGCTGGT 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21843 CAGCCCTCCCCAGGCTGCCCAAGGGCAAGAAGCAAAGAAGGGAACCCAAAGGTGGCTGGT 21902 Qy 901 GGGCTATACCTGCAGAGTGCGGGTCTGCCTCCCTGTTGGGAGTTGTGTGTCAGCAGGGGA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21903 GGGCTATACCTGCAGAGTGCGGGTCTGCCTCCCTGTTGGGAGTTGTGTGTCAGCAGGGGA 21962 Qy 961 GTCTTGGTCAGCGTCAGGTCCAGGCGTGCTGACAGAGTGT 1000 |||||||||||||||||||||||||||||||||||||||| Db 21963 GTCTTGGTCAGCGTCAGGTCCAGGCGTGCTGACAGAGTGT 22002 Prather does not teach SEQ ID NO: 3 specifically. However, Prather teaches about donor DNA (see page 29, ¶ [0486]-[0488]). The donor DNA’s sequence set forth in SEQ ID NO: 3 is a 1,000 nucleotides -long modified fragment of Prather’s SEQ ID NO: 132, which encodes for a donor DNA. SEQ ID NO: 3 is the result of substitution of “TTC” codon, encoding Phenylalanine amino acid with “GCC” encoding an Alanine amino acid at position 727 of pAPN protein. SEQ ID NO: 3 also present with another 1 nucleotide modification in addition to the change corresponding to amino acid at position 727. This nucleotide change is a silent mutation maintaining a Glutamine residue at position 722. This small change creates an additional mean of selection, i.e. nucleic acid sequence change and/or additional restriction sites, between wild type pAPN encoding DNA and mutated pAPN at position 727. Prather claims ( ¶ [0036]) a nucleotide sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 132, wherein the nucleotide sequence comprises at least one substitution, insertion, or deletion relative to SEQ ID NO: 132. Prather also teaches that the donor polynucleotide can be DNA or RNA, single-stranded or double-stranded and can be introduced into a cell in linear or circular form (see [0487]). Prather also teaches that “For example, where the animal or offspring is a porcine animal or where the cell is a porcine cell, the animal, offspring, or cell will be resistant to infection by TGEV due to the modified chromosomal sequence in the gene encoding the ANPEP protein and…”. (see [0246]). Prather also teaches that the modification in chromosomal sequence in a gene encoding ANPEP protein is made so that ANPEP protein production or activity is reduced (see [0389], see claim 13). Examiner interprets this as a modified ANPEP gene producing a protein that still retains biological/physiological activity. Prather teaches that for the knockout strategy, up to thirty-four transfections were conducted with a variety of plasmid preparations (see [0623]). Examiner interprets this teaching as confirmation that preparing multiple vectors for introducing the Cas9 and sgRNA and donor DNA on separate constructs can be performed by a person of ordinary skills in the art. Prather does not teach guide RNAs corresponding to SEQ ID NOs: 1 and 2. Prather does not teach a donor DNA with SEQ ID NO: 3 specifically either. However, Concordet teaches how to make guide RNAs to target any sequence and how to modify a target sequence incorporating a restriction enzyme sequence in the guide RNA. Regarding SEQ ID NOs: 1, 2 and 3, Concordet teaches an intuitive guide for selection of CRISPR/Cas9 genome editing oligonucleotides (see title). Concordet discloses a method and a free access website (http://crispor.org) for automatic design of guide RNAs and how to include a restriction enzyme site for selection (see figure 1 and below): PNG media_image3.png 346 806 media_image3.png Greyscale Concordet does not teach an example specifically. However, Inui teaches a specific CRISPR/Cas9 system with guide RNA modified to remove a restriction site for selection. Inui teaches the use of CRISPR Cas system to precisely create a single point mutation, an amino acid substitution ( see title and abstract). Inui also teaches, additionally to introducing a point mutation for targeted amino acid substitution, a silent mutation introduced to remove a PvuII restriction site to facilitate the genotyping (see page 2, “[S]ubstitution using two gRNAs and hCas9D10A (double nicking)” section, lines 12-16). Inui teaches about adding additional silent mutation to facilitate genotyping. Inui, therefore, teaches that the removal, or inclusion of a specific restriction site is feasible. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have targeted precisely residues in pAPN responsible for the binding of TGEV as suggested by Luo, and tried and targeted for substitution the known residues as essential amino acids taught by Mudgal, and modified the functionality of the binding site in the resulting mutated pAPN, as performed by Prather. As taught by Luo, coronavirus infections are a major hurdle in the swine industry, and since pAPN is known as a receptor for viruses, there is a need in the art for precise amino acid modification to preserve pAPN functions in the cells while abrogating its ability to function as a receptor for viruses. One would have been motivated to produce a mutated pAPN that could not be used as a TGEV receptor for viral entry. One motivated in obtaining a mutant pAPN that is not a virus receptor, could have performed this substitution from a Phenylalanine to an Alanine amino acid at position 727, because this residue is one of a finite number of solutions identified as essential for viral entry and is taught by Mudgal. One motivated in finding an exact blockage to the point of entry of viruses causing economic hardship in the industry, would have tried and tested systematically, and mutated the points of contact to a coronavirus RBD in pAPN. One with ordinary skills in the art could have used the list shown in Mudgal on page 66, and Table 4.3 and tested/tried and modified each residues and those surrounding the residues listed in red in pAPN as direct hydrogen bonding engagements in RBD, among which F727 is present. One would have had a reasonable expectation of success in performing a substitution from Phenylalanine to alanine at position 727 and obtained a modification in virus binding activity because these two amino acids are different sterically and would have altered the structure of the binding site in pAPN. Alanine is sterically smaller and the prime choice for substitutions in Mudgal (see page 67, figure 4.16). One motivated in abrogating the binding of the virus to pAPN and prevent infection in the resulting transgenic animal, could have used the CRISPR/Cas9 system and performed the substitution using a modified donor DNA and guide RNAs as designed according to teachings from Concordet, and as taught by Prather and Inui, since those techniques are known in the art. Inui also teaches that there is a reasonable expectation of success using the design taught by Concordet. It would have been prima face obvious to one having ordinary skill in the art before the effective filing date, to have modified Luo, Mudgal and Prather, to include said feature (i.e. substitution of residue 727 for alanine) as disclosed using sequences taught by Prather and gRNA designed using Concordet and Inui . Applying the KSR standard of obviousness to Luo, Mudgal, Prather, Concordet and Inui, it is concluded that one of ordinary skill in the art would have recognized that the results of the combination were predictable. KSR, 127 S.Ct. at 1740, 82 USPQ2d at 1396. Claims 11 and 22-24 are rejected under 35 U.S.C. 103 as being unpatentable over Li ( Li, K. et al. US2023/0062272 A1, published March, 2, 2023), Prather (Prather, R.S. et al. US 2020/0236914_A1, published July 30, 2020, with priority date of April 26, 2019 for PCT filing; previously cited), Mudgal (Mudgal, G. “Structural insights into coronavirus binding to host aminopeptidase N and interaction dynamics”. Universidad Autonoma de Madrid (2014)- academia.edu; previously cited), and Concordet (Concordet, J-P. et al. “CRISPOR: intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens.” Nucleic Acids Research, Vol. 46 (2018), pp: W242-W245; previously cited). Regarding claims 11 and 22-24, Li teaches a method of modifying amino acids of site 736 and site 738 of pAPN gene (see title and abstract). Li teaches using CRISPR/Cas9 system to produce specific mutations in pAPN (see Abstract). Li teaches modifying a porcine ileal epithelial cell or a porcine fibroblast using a CRISPR/Cas9 system to obtain TGEV-infection resistance (see ¶ [0018]-[0022]). Li teaches specifically SEQ ID NO: 1 as a guide RNA. See alignments below: Alignment of instant application SEQ ID NO: 1 (qy=query) with Li’s SEQ ID NO: 1 (Db=database): RESULT 1 US-17-822-601-1 (NOTE: this sequence has 2 duplicates in the database searched. See complete list at the end of this report) Sequence 1, US/17822601 GENERAL INFORMATION APPLICANT: Institute of Animal Sciences of Chinese Academy of Agricultural Sciences (en) TITLE OF INVENTION: Composition for Simultaneously Modifying Amino Acids of Site 736 and Site 738 of pAPN Gene and Application tThereof (en) FILE REFERENCE: 57742-US CURRENT APPLICATION NUMBER: US/17/822,601 CURRENT FILING DATE: 2022-08-26 NUMBER OF SEQ ID NOS: 13 SEQ ID NO 1 LENGTH: 20 TYPE: DNA FEATURE: NAME/KEY: misc_feature LOCATION: 1..20 QUALIFIERS: note = pAPN-sgRNA-1 FEATURE: NAME/KEY: source LOCATION: 1..20 QUALIFIERS: mol_type = other DNA organism = synthetic construct Query Match 100.0%; Score 20; Length 20; Best Local Similarity 100.0%; Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CTAGAAATACCTCAGGAAGC 20 |||||||||||||||||||| Db 1 CTAGAAATACCTCAGGAAGC 20 Li also teaches a donor DNA that is double-stranded donor sequence ([0011]), and that is 98.4% identical to the donor DNA in instant application, and that has 99.0% local similarity with instant donor DNA SEQ ID NO: 3, according to specific modification. See ¶ [0063] and below (query Qy is instant’s app. SEQ ID NO: 3, aligned against SEQ ID NO: 3 of Li): Query Match 98.4%; Score 984; DB 1; Length 1000; Best Local Similarity 99.0%; Matches 990; Conservative 0; Mismatches 10; Indels 0; Gaps 0; Qy 1 CCTTTGAGCACAGTCTGGCCTTGTGCGAGGCCTTTAGCCTCTGGCCTCTTGCTCCTGTAG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 CCTTTGAGCACAGTCTGGCCTTGTGCGAGGCCTTTAGCCTCTGGCCTCTTGCTCCTGTAG 60 Qy 61 CCATTAGCTCTTGCTACATCTGCCCACCCACATCAGAGGCTCCATGGGTCTCCAGATGAC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 CCATTAGCTCTTGCTACATCTGCCCACCCACATCAGAGGCTCCATGGGTCTCCAGATGAC 120 Qy 121 TCAGGCATGAGTCTCTTCTTTGAAGCTATTTTTAGGGCTGCATCCTCGGCATGTGGAGGT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 TCAGGCATGAGTCTCTTCTTTGAAGCTATTTTTAGGGCTGCATCCTCGGCATGTGGAGGT 180 Qy 181 TCCCAAGCTAGGGGTTGAATCGGAGCTGTAGCCGCCAGCCTACACCACAGCCACAGCAAC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 TCCCAAGCTAGGGGTTGAATCGGAGCTGTAGCCGCCAGCCTACACCACAGCCACAGCAAC 240 Qy 241 ACGGGATCCGAGCCACATCTGCGACCTACACCACAGCTCACAGCAATGCCAGATCCTTAA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 ACGGGATCCGAGCCACATCTGCGACCTACACCACAGCTCACAGCAATGCCAGATCCTTAA 300 Qy 301 CCCACTGAGTGGGGCCAGGGTTGAACCCATGTCCTCATGTTTCCCAGTCAGATTCGTTTC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 CCCACTGAGTGGGGCCAGGGTTGAACCCATGTCCTCATGTTTCCCAGTCAGATTCGTTTC 360 Qy 361 TGCTGTGCCATGACGGGAACTCTGGAACTTCCTCTTTGAAGCTCTTTATGTTTTGTTCTT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 TGCTGTGCCATGACGGGAACTCTGGAACTTCCTCTTTGAAGCTCTTTATGTTTTGTTCTT 420 Qy 421 GTTTTTTGTTTTTGTTTTTCTAGAAATACCTCAGGAAGCAAGTCGAACCCCTCGCCCAAC 480 ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Db 421 GTTTTTTGTTTTTGTTTTTCTAGAAATACCTCAGGAAGCAAGTCGAACCCCTCTTCCAAC 480 Qy 481 ATTTCGAAACTCTCACTAAAAACTGGACCGAGCGCCCAGAAAATCTGATGGACCAGTGAG 540 |||||||||||||||||||| ||| ||||||||||||||| | ||||||||||||| Db 481 ATTTCGAAACTCTCACTAAAGCTTGGGTCGAGCGCCCAGAAAACTTAATGGACCAGTGAG 540 Qy 541 TATGAGCTCGCTTGGTCTGGAGATCATGGGTGGTGCAGGTAGCCTGACCTGGGGGCCCAT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 TATGAGCTCGCTTGGTCTGGAGATCATGGGTGGTGCAGGTAGCCTGACCTGGGGGCCCAT 600 Qy 601 AGCAAGTCCAGCAGCATCCTCTCTGGAGCTCCCAACTCCTGGCCGGACCAGGGCCACAGT 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 AGCAAGTCCAGCAGCATCCTCTCTGGAGCTCCCAACTCCTGGCCGGACCAGGGCCACAGT 660 Qy 661 CAGGGAGAGCGACCCCTCCCAACCCCACTCCCGGCCCCAGGAGTAGGGACTCTGCTCTGA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 CAGGGAGAGCGACCCCTCCCAACCCCACTCCCGGCCCCAGGAGTAGGGACTCTGCTCTGA 720 Qy 721 GGCTCTGTGTGGCCTATGAACCATCTGGCCTCTTTGGGCAAAGGACCAAACTGAACCTCT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 GGCTCTGTGTGGCCTATGAACCATCTGGCCTCTTTGGGCAAAGGACCAAACTGAACCTCT 780 Qy 781 GAGGGTCCCTCACCCGCATGGTGAGGTTCTAGGTGTTAAAGCTGGGGCTGGAGCCTGTGC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 GAGGGTCCCTCACCCGCATGGTGAGGTTCTAGGTGTTAAAGCTGGGGCTGGAGCCTGTGC 840 Qy 841 CAGCCCTCCCCAGGCTGCCCAAGGGCAAGAAGCAAAGAAGGGAACCCAAAGGTGGCTGGT 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 CAGCCCTCCCCAGGCTGCCCAAGGGCAAGAAGCAAAGAAGGGAACCCAAAGGTGGCTGGT 900 Qy 901 GGGCTATACCTGCAGAGTGCGGGTCTGCCTCCCTGTTGGGAGTTGTGTGTCAGCAGGGGA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 GGGCTATACCTGCAGAGTGCGGGTCTGCCTCCCTGTTGGGAGTTGTGTGTCAGCAGGGGA 960 Qy 961 GTCTTGGTCAGCGTCAGGTCCAGGCGTGCTGACAGAGTGT 1000 |||||||||||||||||||||||||||||||||||||||| Db 961 GTCTTGGTCAGCGTCAGGTCCAGGCGTGCTGACAGAGTGT 1000 Regarding claim 23, Li teaches using two different vectors, a target cleavage vector 1 and a cleavage vector 2, each expressing the cleavage protein and a guide RNA (see ¶ [0041]-[0043] and [0064]). Li also teaches a composition to modify porcine ileal epithelial cell using 5 µg of first vector comprising sgRNA-1, 5 µg of second vector comprising sgRNA-2 and 5 µg of pAPN-dsODN (donor DNA) for transfection (see ¶ [0078]-[0079]). Regarding claim 24, Li teaches a method wherein the vector for expressing the genetically edited protein Cas9 and pAPN-sgRNA-1 is obtained by connecting annealed double stranded DNA fragments from single stranded DNAs set forth in SEQ ID NO: 4 and SEQ ID NO: 5 into a genetically edited backbone vector. Instant application SEQ ID NO: 4 (Query Qy) is identical to Li’s SEQ ID NO: 4 (database Db): Query Match 100.0%; Score 25; DB 1; Length 25; Best Local Similarity 100.0%; Matches 25; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CACCGCTAGAAATACCTCAGGAAGC 25 ||||||||||||||||||||||||| Db 1 CACCGCTAGAAATACCTCAGGAAGC 25 Instant application SEQ ID NO: 5 (Query Qy) is identical to Li’s SEQ ID NO: 5 (Database Db): Query Match 100.0%; Score 25; DB 1; Length 25; Best Local Similarity 100.0%; Matches 25; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AAACGCTTCCTGAGGTATTTCTAGC 25 ||||||||||||||||||||||||| Db 1 AAACGCTTCCTGAGGTATTTCTAGC 25 In claim 24, the term “alternatively” is interpreted here as “optionally”, therefore the limitation in lines 5-8 are not required by the claim. While Li provides all the steps necessary for mutating pAPN gene using CRISPR/Cas9 system to introduce two mutations in pAPN, Li does not specifically teach mutating a single residue in pAPN. Li does not specifically teach SEQ ID NO: 12 or SEQ ID NO: 2 either. As Li, Prather teaches how to target specific residues in pANP. On page 13, right column, ¶ [0213]-[0214], Prather teaches the modification can be a single substitution of a residue at position 738 or 792 to a different amino acid, such as alanine. Regarding claims 11 and 22, Prather teaches modifying chromosomal sequences of APN (also known in the art as ANPEP or CD13) to induce resistance to PRCV and TGEV (see abstract, ¶ [0002]). Prather teaches using a CRISPR system to modify pAPN to induce increase resistance to TGEV in cells and whole animal (see abstract, ¶ [0002]). Prather teaches the use of CRISPR system to modify and mutate pAPN ( ¶ [0039]-[0046], [0066]) in a germ cell (see ¶ [0372]-[0379]). Regarding claim 22, Prather also teaches SEQ ID NO: 135 (Figure 28) of wild type pAPN, which corresponds to SEQ ID NO:12 of wild type pAPN of claim 22. Prather teaches using guide RNAs (¶ [0096]) including guide RNAs for specific regions on the ANPEP sequence (¶ [0629]). Prather teaches using their SEQ ID NO: 132 to design CRISPR guide RNAs (¶ [0628]). Prather teaches instant disclosure’s SEQ ID NO: 12 (see Figure 28; SEQ ID NO:135). Prather also teaches designing guide RNAs using SEQ ID NO:132 (full length mRNA) (see ¶ [0629]-[0630], and Tables 19-20 and underlined and bolded sequences for gRNAs in figure 28). Prather’s SEQ ID NO: 132 includes both guide RNAs, SEQ ID NO:1 and SEQ ID NO:2 of claim 11. Prather also teaches that selection of target sites and design of crRNA/gRNA are well known in the art and provides a guide and website to do so (see ¶ [0370]). Prather teaches SEQ ID NO: 132 which corresponds to the wild type sequence and presents with 99.7% of local similarity to SEQ ID NO: 3. See alignment below (Prather’s US2020/0236914 A1); Qy (query) is SEQ ID NO: 3 of instant application; DB (database) is SEQ ID NO: 132 of Prather: SEQ ID NO 132 LENGTH: 29999 TYPE: DNA ORGANISM: Sus scrofa Query Match 99.5%; Score 995.2; Length 29999; Best Local Similarity 99.7%; Matches 997; Conservative 0; Mismatches 3; Indels 0; Gaps 0; Qy 1 CCTTTGAGCACAGTCTGGCCTTGTGCGAGGCCTTTAGCCTCTGGCCTCTTGCTCCTGTAG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21003 CCTTTGAGCACAGTCTGGCCTTGTGCGAGGCCTTTAGCCTCTGGCCTCTTGCTCCTGTAG 21062 Qy 61 CCATTAGCTCTTGCTACATCTGCCCACCCACATCAGAGGCTCCATGGGTCTCCAGATGAC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21063 CCATTAGCTCTTGCTACATCTGCCCACCCACATCAGAGGCTCCATGGGTCTCCAGATGAC 21122 Qy 121 TCAGGCATGAGTCTCTTCTTTGAAGCTATTTTTAGGGCTGCATCCTCGGCATGTGGAGGT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21123 TCAGGCATGAGTCTCTTCTTTGAAGCTATTTTTAGGGCTGCATCCTCGGCATGTGGAGGT 21182 Qy 181 TCCCAAGCTAGGGGTTGAATCGGAGCTGTAGCCGCCAGCCTACACCACAGCCACAGCAAC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21183 TCCCAAGCTAGGGGTTGAATCGGAGCTGTAGCCGCCAGCCTACACCACAGCCACAGCAAC 21242 Qy 241 ACGGGATCCGAGCCACATCTGCGACCTACACCACAGCTCACAGCAATGCCAGATCCTTAA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21243 ACGGGATCCGAGCCACATCTGCGACCTACACCACAGCTCACAGCAATGCCAGATCCTTAA 21302 Qy 301 CCCACTGAGTGGGGCCAGGGTTGAACCCATGTCCTCATGTTTCCCAGTCAGATTCGTTTC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21303 CCCACTGAGTGGGGCCAGGGTTGAACCCATGTCCTCATGTTTCCCAGTCAGATTCGTTTC 21362 Qy 361 TGCTGTGCCATGACGGGAACTCTGGAACTTCCTCTTTGAAGCTCTTTATGTTTTGTTCTT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21363 TGCTGTGCCATGACGGGAACTCTGGAACTTCCTCTTTGAAGCTCTTTATGTTTTGTTCTT 21422 Qy 421 GTTTTTTGTTTTTGTTTTTCTAGAAATACCTCAGGAAGCAAGTCGAACCCCTCGCCCAAC 480 |||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| Db 21423 GTTTTTTGTTTTTGTTTTTCTAGAAATACCTCAGGAAGCAGGTCGAACCCCTCTTCCAAC 21482 Qy 481 ATTTCGAAACTCTCACTAAAAACTGGACCGAGCGCCCAGAAAATCTGATGGACCAGTGAG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21483 ATTTCGAAACTCTCACTAAAAACTGGACCGAGCGCCCAGAAAATCTGATGGACCAGTGAG 21542 Qy 541 TATGAGCTCGCTTGGTCTGGAGATCATGGGTGGTGCAGGTAGCCTGACCTGGGGGCCCAT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21543 TATGAGCTCGCTTGGTCTGGAGATCATGGGTGGTGCAGGTAGCCTGACCTGGGGGCCCAT 21602 Qy 601 AGCAAGTCCAGCAGCATCCTCTCTGGAGCTCCCAACTCCTGGCCGGACCAGGGCCACAGT 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21603 AGCAAGTCCAGCAGCATCCTCTCTGGAGCTCCCAACTCCTGGCCGGACCAGGGCCACAGT 21662 Qy 661 CAGGGAGAGCGACCCCTCCCAACCCCACTCCCGGCCCCAGGAGTAGGGACTCTGCTCTGA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21663 CAGGGAGAGCGACCCCTCCCAACCCCACTCCCGGCCCCAGGAGTAGGGACTCTGCTCTGA 21722 Qy 721 GGCTCTGTGTGGCCTATGAACCATCTGGCCTCTTTGGGCAAAGGACCAAACTGAACCTCT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21723 GGCTCTGTGTGGCCTATGAACCATCTGGCCTCTTTGGGCAAAGGACCAAACTGAACCTCT 21782 Qy 781 GAGGGTCCCTCACCCGCATGGTGAGGTTCTAGGTGTTAAAGCTGGGGCTGGAGCCTGTGC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21783 GAGGGTCCCTCACCCGCATGGTGAGGTTCTAGGTGTTAAAGCTGGGGCTGGAGCCTGTGC 21842 Qy 841 CAGCCCTCCCCAGGCTGCCCAAGGGCAAGAAGCAAAGAAGGGAACCCAAAGGTGGCTGGT 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21843 CAGCCCTCCCCAGGCTGCCCAAGGGCAAGAAGCAAAGAAGGGAACCCAAAGGTGGCTGGT 21902 Qy 901 GGGCTATACCTGCAGAGTGCGGGTCTGCCTCCCTGTTGGGAGTTGTGTGTCAGCAGGGGA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 21903 GGGCTATACCTGCAGAGTGCGGGTCTGCCTCCCTGTTGGGAGTTGTGTGTCAGCAGGGGA 21962 Qy 961 GTCTTGGTCAGCGTCAGGTCCAGGCGTGCTGACAGAGTGT 1000 |||||||||||||||||||||||||||||||||||||||| Db 21963 GTCTTGGTCAGCGTCAGGTCCAGGCGTGCTGACAGAGTGT 22002 Prather does not teach SEQ ID NO: 3 specifically. However, Prather teaches about donor DNA (see page 29, ¶ [0486]-[0488]). The donor DNA’s sequence set forth in SEQ ID NO: 3 is a 1,000 nucleotides -long modified fragment of Prather’s SEQ ID NO: 132, which encodes for a donor DNA. SEQ ID NO: 3 is the result of substitution of “TTC” codon, encoding Phenylalanine amino acid with “GCC” encoding an Alanine amino acid at position 727 of pAPN protein. SEQ ID NO: 3 also present with another 1 nucleotide modification in addition to the change corresponding to amino acid at position 727. This nucleotide change is a silent mutation maintaining a Glutamine residue at position 722. This small change creates an additional mean of selection, i.e. nucleic acid sequence change and/or additional restriction sites, between wild type pAPN encoding DNA and mutated pAPN at position 727. Prather claims ( ¶ [0036]) a nucleotide sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 132, wherein the nucleotide sequence comprises at least one substitution, insertion, or deletion relative to SEQ ID NO: 132. Prather also teaches that the donor polynucleotide can be DNA or RNA, single-stranded or double-stranded and can be introduced into a cell in linear or circular form (see [0487]). Prather also teaches that “For example, where the animal or offspring is a porcine animal or where the cell is a porcine cell, the animal, offspring, or cell will be resistant to infection by TGEV due to the modified chromosomal sequence in the gene encoding the ANPEP protein and…”. (see [0246]). Prather also teaches that the modification in chromosomal sequence in a gene encoding ANPEP protein is made so that ANPEP protein production or activity is reduced (see [0389], see claim 13). Examiner interprets this as a modified ANPEP gene producing a protein that still retains biological/physiological activity. Prather teaches that for the knockout strategy, up to thirty-four transfections were conducted with a variety of plasmid preparations (see [0623]). Examiner interprets this teaching as confirmation that preparing multiple vectors for introducing the Cas9 and sgRNA and donor DNA on separate constructs can be performed by a person of ordinary skills in the art. Regarding claims 11 and 22, Mudgal is drawn to the “Structural insights into coronavirus binding to host aminopeptide N and interaction dynamics” (title of Thesis). Mudgal teaches mutating positions in pAPN (page 72, lines 3-5) to test PRCV (porcine respiratory coronavirus) RBD binding. Mudgal teaches that the alpha helix 17 and residues between the alpha helix 17 and alpha helix 18 in pAPN are important for virus binding, especially residues F727, E731, K735, N736, W737, T738, and E739 (see below, and Figure 4.8, page 55). PNG media_image1.png 611 983 media_image1.png Greyscale Mudgal further teaches that residues at positions 727, 731, 736, 737, 764, 767, 768 and 771 are important for TGEV receptor binding (see Table 4.3, page 66). Therefore, Mudgal also teaches that position 727 in pAPN is important for CoV binding (see Figure 4.8 above and Table 4.3 below). [Of note, in Table 4.3. position 727 is mentioned as G727, however in Figure 4.8, it is clear that the amino acid at position 727 is a Phenylalanine amino acid. Therefore, this is a substitution error] PNG media_image2.png 681 734 media_image2.png Greyscale Mudgal also teach amino acid substitutions to alanine (Figure 4.16 and Table 4.4). In table 4.4 and Figure 4.16, all mutants are single mutation while maintaining all other amino acid residues found in the wild-type pAPN protein. Therefore, Mudgal teaches that one skilled in the art can produce one mutant with mutation at position 727 while maintaining other residues found in the wild type pAPN protein. Mudgal does not specifically teach mutating phenylalanine to alanine at position 727. Mudgal teaches motivation to target this specific residue. Li, Prather and Mudgal do not teach modifying amino acid 727 in pAPN and SEQ ID NO: 2, SEQ ID NO: 6 or SEQ ID NO: 7. However, Li teaches the use of CRISPOR website to design guide RNAs and donor DNA sequences (page 6, ¶ [0076]). Concordet teaches how to make guide RNAs to target any sequence using CRISPOR and how to modify a target sequence incorporating a restriction enzyme sequence in the guide RNA (see title and abstract). Regarding SEQ ID NOs: 1, 2 and 3, Concordet teaches an intuitive guide for selection of CRISPR/Cas9 genome editing oligonucleotides (see title). Concordet discloses a method and a free access website (http://crispor.org) for automatic design of guide RNAs and how to include a restriction enzyme site for selection (see figure 1 and below): PNG media_image3.png 346 806 media_image3.png Greyscale Therefore, it would have been obvious to one of ordinary skills in the art, before the effective filing date, to have substituted the two amino acid substitutions taught by Li, for a single amino acid substitution taught by Prather and used an amino acid taught as essential by Mudgal. It would have been obvious to substitute to an alanine at position 727 in pAPN as taught by residues that are contacted by RBD residues Y528/304 in Table 4.3 as essential residues by Mudgal. Mudgal also teaches that alanine can replace the residue to be substituted as taught by Figure 4.16 showing alanine as a preferred residue for substitution. One motivated in using a CRISPR/Cas9 system for exact mutation at this position to alter the binding of TGEV RBD and prevent infection by the virus could have performed this substitution with a reasonable expectation of success, since the tools for designing guide RNAs and incorporation of restriction site for selection of modified clones are taught by Concordet, and have been used by Li. One with ordinary skills in the art could have performed the substitution and arrived at the claimed invention. Response to Arguments Applicant's arguments filed 10/27/2025 have been fully considered but they are not persuasive. Applicant states on page 6 of “Remarks” that “Neither Luo + Mudgal + Prather, nor Li + Mudgal + Prather could provide one of ordinary skill in the art a reasonable motivation for the technical solution detailed in the present application, i.e., the substitution of phenylalanine at position 727 in pAPN with alanine (F727 A).” In response to applicant’s argument that there is no teaching, suggestion, or motivation to combine the references, the examiner recognizes that obviousness may be established by combining or modifying the teachings of the prior art to produce the claimed invention where there is some teaching, suggestion, or motivation to do so found either in the references themselves or in the knowledge generally available to one of ordinary skill in the art. See In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988), In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992), and KSR International Co. v. Teleflex, Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007). In this case, Mudgal (see Figure 4.8) clearly teaches that residues involved in CoV binding are in green and blue in the figure, which include claimed position 727. Mudgal also teaches in Table 4.3 residues that provide attachment between RBD of PRCV and pAPN and amino acid in position 727 is also listed right next to E731.[of note: In Figure 4.8, it is obvious that the wild type residue at position 727 is Phenylalanine]. It would be obvious based on Mudgal to attempt to modify residue 727 because this prior art teaches that position is important for CoV binding. Applicant states on page 6 : “Mudgal neither teaches nor suggests to one of ordinary skill in the art the specific F727 A mutation (indeed, Applicant notes that Mudgal itself exhibits inconsistencies, e.g.,"G727" in Table 4.3 versus "F727" in Figure 4.8, a difference attributed by the Office to a "substitution error," Action at 10) and that Luo focuses primarily on APN knockout rather than precise point mutations.” In response to applicant's arguments against the references individually, one cannot show non-obviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). Applicant also states on page 7 : “Applicant maintains that the prior art does not disclose or teach or suggest to one of ordinary skill in the art that the specific technical effect resulting from "mutating phenylalanine at position 727 of the pAPN protein to alanine" will result in "a protein that is both resistant to TGEV infection and retains the physiological activity of the pAPN protein." ” and “Mudgal merely provided a "candidate list" suggesting F727 might warrant investigation, but Mudgal neither predicted nor confirmed that mutating this particular site as recited in the pending claims and could provide any basis for one of ordinary skill in the art to conclude that this speculative mutation would provide "antiinfection" effects while preserving the basic function(s) of the resulting protein.” In response to applicant's argument a recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. If the prior art structure is capable of performing the intended use, then it meets the claim. Also in this case, the combination of references renders the position 727, i.e. the structure, obvious to try in a systematic mutational analysis of a domain/region that is taught by the prior art. Using routine optimization and the teachings of prior art, one with ordinary skills in the art could have obtained this specific mutation. Applicant also argues on page 8 that “Applicant notes that although Li explicitly targets the simultaneous modification of amino acids at positions 736 and 738, Li does not teach or suggest to one of ordinary skill in the art to undertake a single mutation at position 727. One of ordinary skill in the art would understand that the core of Li's technical solution lies in the simultaneous mutations at the 736/738 sites. Although Li may have achieved some anti-TGEV effects, Applicant maintains that Li does not provide any teaching or suggestion to one of ordinary skill in the art that the disclosed dual-site mutation approach will result in the same physiological function of pAPN as the single-site F727 mutation recited in the pending claims. In fact, Applicant suggests that one of ordinary skill in the art would appreciate that modifying two critical sites is more likely to disrupt normal protein function than the single mutation as recited in the pending claims. Thus, Applicant maintains that Li disclosed a different mutation strategy (dual-site vs. single-site) and different targets (736/738 vs. 727). The inventors of the present application discovered that a single point mutation at a site (F727) isolated from the active center achieves outstanding results, representing an unexpected simplification and improvement over Li's dual-site mutation.” In response to applicant's arguments against the references individually (i.e., Li), one cannot show non-obviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). In response to applicant's argument that a single point mutation achieves outstanding results, representing an unexpected simplification and improvement over Li’s dual-site mutation”, applicant is reminded that the rejection is based on a combination of references including Li. This combination is rendering obvious the instant claimed structure. The fact that the inventor has recognized another advantage which would flow naturally from following the suggestion of the prior art cannot be the basis for patentability when the differences would otherwise be obvious. See Ex parte Obiaya, 227 USPQ 58, 60 (Bd. Pat. App. & Inter. 1985). In summary, the technique using CRISPR/Cas9 system for inducing single mutations is known in the art and was discovered by others in the art. Li teaches the use of mutagenesis to produce ileal epithelial cell modification or porcine fibroblast modification is known in the art and the references applied also demonstrate this fact. The position at amino acid 727 is also known in the art. It is included in Mudgal provided list of potentially important attachments sites for RBD involved in coronavirus infection. Li and Prather teach gene-edited pigs with precisely modified amino acids in pAPN by somatic cell nuclear transfer. Guide RNAs design and sequences are rendered obvious once a mutation is selected using the CRISPOR algorithm, as used by Li and taught by Concordet. Therefore, the claimed invention is deemed to be obvious over the cited prior art references. The improvement is not one concerning a step in production of animals using an unknown method. The gene is not a novel gene; the organism is not a new organism or new model system. The present application relies on previously published articles and relies upon the adaptation of a known method to known residues of amino acid sequence, using guide RNA sequences that can be deduced using a known algorithm. Therefore, the rejections are maintained. Conclusion No claim is allowed. THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEXANDRA G DACE DENITO whose telephone number is (703)756-4752. The examiner can normally be reached Monday-Friday, 8:30-5:00EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached on 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /A.D./Examiner, Art Unit 1636 /NANCY J LEITH/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Show 3 earlier events
Dec 26, 2024
Final Rejection mailed — §103
Feb 26, 2025
Response after Non-Final Action
Apr 22, 2025
Request for Continued Examination
Apr 25, 2025
Response after Non-Final Action
Jul 31, 2025
Non-Final Rejection mailed — §103
Oct 27, 2025
Response Filed
Feb 09, 2026
Final Rejection mailed — §103
Apr 09, 2026
Response after Non-Final Action

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12570996
Circular RNA For Translation In Eukaryotic Cells
1y 12m to grant Granted Mar 10, 2026
Patent 12529048
DOUBLE KNOCK-OUT CHO CELL LINE METHOD OF ITS GENERATION AND PRODUCING THERAPEUTIC PROTEINS THEREFROM
5y 0m to grant Granted Jan 20, 2026
Patent 12516376
OPTIMIZING BAG3 GENE THERAPY
5y 1m to grant Granted Jan 06, 2026
Patent 12509701
Circular RNA For Translation In Eukaryotic Cells
2y 0m to grant Granted Dec 30, 2025
Patent 12509686
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
1y 2m to grant Granted Dec 30, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

4-5
Expected OA Rounds
56%
Grant Probability
93%
With Interview (+36.3%)
3y 5m (~1y 0m remaining)
Median Time to Grant
High
PTA Risk
Based on 46 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month