Prosecution Insights
Last updated: July 17, 2026
Application No. 18/415,814

METHOD OF DETECTING SARS-COV IN A SAMPLE

Non-Final OA §102§103§112§DP
Filed
Jan 18, 2024
Examiner
ZOU, NIANXIANG
Art Unit
1671
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Imam Abdulrahman Bin Faisal University
OA Round
1 (Non-Final)
64%
Grant Probability
Moderate
1-2
OA Rounds
2m
Est. Remaining
89%
With Interview

Examiner Intelligence

Grants 64% of resolved cases
64%
Career Allowance Rate
490 granted / 766 resolved
+4.0% vs TC avg
Strong +25% interview lift
Without
With
+24.8%
Interview Lift
resolved cases with interview
Typical timeline
2y 8m
Avg Prosecution
36 currently pending
Career history
807
Total Applications
across all art units

Statute-Specific Performance

§101
1.2%
-38.8% vs TC avg
§103
56.1%
+16.1% vs TC avg
§102
8.0%
-32.0% vs TC avg
§112
4.9%
-35.1% vs TC avg
Black line = Tech Center average estimate • Based on career data from 766 resolved cases

Office Action

§102 §103 §112 §DP
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Acknowledgement is hereby made of receipt and entry of the communication filed on May 15, 2026. Claims 1-20 are pending. Claims 2 and 20 are withdrawn. Claims 1 and 3-19 are currently examined. Election/Restrictions Applicant's election with traverse of Group I (Claims 1-19), directed to a method of detecting SARS-CoV-2 in a sample comprising contacting the sample with a primer set and reagents for RT-LAMP, the primer set being selected from eight different sets (Set-1 to Set-8), in the reply filed on May 15, 2026, is acknowledged. For the species election requirement, Applicant elects Set-1 (N-ID5). Applicant argues that the Office action has not met its burden as to MPEP 806.05(h) since the Office action provides neither an example of a materially different process, nor an example of the process with a materially different product. Applicant’s argument is not persuasive. The product of Invention II, i.e., a kit comprising RT-reagents and a generic primer set for SARS-CoV-2 detection, encompasses primer sets that are not specified in Invention I, and thus, can be used in a RT-LAMP assay targeting a different SARS-CoV-2 genome region from those specified in Invention I. MPEP 806.05(h) states that the burden is on the examiner to provide an example, but the example need not be documented. For the reasons above, the Restriction is deemed to be proper, and is made Final. Accordingly, claim 20 is withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Invention. Claim 2 is withdrawn as being drawn to a non-elected species. Specification – Sequence Compliance This application contains sequence disclosures that are encompassed by the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.821(a)(1) and (a)(2). However, this application fails to comply with the requirements of 37 CFR 1.821 through 1.825 for the reason(s) as follows: The specification does not contain sequence identifiers (SEQ ID NO:) in all locations where sequences are disclosed, see at least FIG. 6C. To correct this, the sequences in figures can be referred to in either the figure or the Brief Description of Drawings. If the prior filed Sequence Listing does not contain updated sequences, Applicant is also required to submit a replacement Sequence Listing that includes all updated sequences. Full compliance with the sequence rules is required in response to this Office Action. A complete response to this office action should include both compliance with the sequence rules and a response to the Office Action set forth below. Failure to fully comply with both these requirements in the time period set forth in this Office Action will be held non-responsive. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. Claims 1 and 3-19 are rejected under 35 U.S.C. 112(b) as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor regards as the invention. These claims are directed to a method of detecting SARS-CoV-2 in a sample by a RT-LAMP using a primer set selected from the group consisting of N-ID5 (Set-1), E-ID1 (Set-2), RdRp-ID37 (Set-3), S-ID17 (Set-4), S-ID24 (Set-5), N-ID15 (Set-6), and N-ID15n1L (Set-7). The specification describes these primer sets in Table 2, showing that the primer set of N-ID5 (Set-1) corresponds to SEQ ID NOs: 1-6, as primers F3, B3, FIP, BIP, LF and LB, respectively. See below for primers N-ID5 (Set-1) and E-ID1 (Set-2). PNG media_image1.png 656 1128 media_image1.png Greyscale The specification further describes the primer sets in text. E.g., the specification teaches that, in an embodiment, for set N-ID5, the primer is SEQ ID No. 1 and comprises at least 10 nucleotide residues and not more than 500 nucleotide residues, preferably not more than 400 nucleotide residues, preferably not more than 300 nucleotide residues, preferably not more than 250 nucleotide residues, more preferably not more than 200 nucleotide residues, still more preferably not more than 100 nucleotide residues, still more preferably not more than 50 nucleotide residues, and still more preferably not more than 30 nucleotide residues, and contains a sequence that is at least 90%, preferably at least 92%, preferably at least 95%, and more preferably at least 97% identical to SEQ ID No. 1; etc. See pages 29-30. These teachings cause confusion, because based on these teachings, it appears that the primers in the specified sets can be variable from the specified sequences (e.g., SEQ ID NOs: 1-6 for set N-ID5 (Set-1)). Accordingly, since the specification provides confusing and/or conflicting descriptions for the primer sequences comprised in the primer sets recited in the claims, the metes and bounds of the claims are not clear. E.g., it is not clear if the primers of the claimed sets of primers are exactly those presented in Table 2, or if they may also be variable as presented in the description of the specification. Applicant must clarify. Additionally, accordingly to MPEP 2173.05(s), claims should be self-contained and clearly define the invention without relying on external references, with only exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawn or table into the claim. Here, claim 1 is indefinite because it refers to primer sets listed in Table 2 of the specification, without clearly reciting their structural features in the claims. The primers and their sequences defined by sequence identifiers in Table 2 can be readily incorporated into the claim. Therefore, merely referring to the names of the primer sets without reciting their structural characteristics renders the claim indefinite and constitutes an improper incorporation by reference. To expedite examination, the claims are narrowly interpreted as requiring the primer sets disclosed in Table 2 of the specification with primers consisting of the corresponding sequences. It is noted any interpretation of the claims set forth above does not relieve Applicant of the responsibility of responding to this rejection. If the actual interpretation of the claims is different than that posited by the Examiner, additional rejections and art may be readily applied in a subsequent final Office action. Claim Rejections - 35 USC § 102/103 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale or otherwise available to the public before the effective filing date of the claimed invention. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1 and 4-19 are rejected under 35 U.S.C. 102/103 as being unpatentable over CN 113684320 (Published on Nov. 23, 2021) or Luo et al. (Chemical Engineering Science 251(2022)117430). These claims are directed to a method of detecting SARS-CoV-2 in a sample, comprising: contacting the sample with a primer set and one or more reverse transcription loop-mediated isothermal amplification (RT-LAMP) reagents to form a reaction mixture, wherein the RT-LAMP reagents comprise calcein, incubating the reaction mixture at a temperature and for a time sufficient to amplify a target sequence of the SARS-CoV-2 nucleic acid sequence in the sample; assaying the sample with an assay to detect the amplified target sequence of the SARS-CoV-2 nucleic acid sequence; and detecting a presence of the amplified target sequence of the SARS-CoV-2 nucleic acid sequence, thereby detecting SARS-CoV-2 in the sample, wherein the primer set is selected from the group consisting of: N-ID5 (Set-1), E-ID1 (Set-2), RdRp-ID37 (Set-3), S-ID17 (Set-4), S-ID24 (Set-5), N-ID15 (Set-6), and N-ID15n1L (Set-7). Interpretation of the claims is described in the 112(b) rejection above. CN 113684320 discloses an invention relating to primer sets for amplification and detection of SARS-CoV-2 nucleic acids and method of using them. The primer sets are designed based on the viral N gene for RT-LAMP assays. The invention also relates to a kit for viral nucleic acid detection. See Abstract. Table 1 of CN 113684320 shows the 6 primer sets (PS1-PS6) of the invention. The sequences of primers in PS2 are shown below: PNG media_image2.png 318 1116 media_image2.png Greyscale The 6 primers of set PS2 are identical to the corresponding primers in the claimed set of N-ID5 (Set-1). Table 2 of CN 113684320 shows the amplification reaction system used in the invention. See below: PNG media_image3.png 570 1124 media_image3.png Greyscale Table 2 of CN 113684320 indicates that Calcein is included in the reaction system. Luo, a publication from the inventors of CN 113684320, teaches a study on optimization of loop-mediated isothermal amplification (LAMP) assay for robust visualization in SARS-CoV-2 and emerging variants diagnosis. Luo teaches that Loop-mediated isothermal amplification (LAMP) is widely used in detection of pathogenic microorganisms including SARS-CoV-2. The authors design serials of primers and select an optimal set for LAMP-based on SARS-CoV-2 N gene for a robust and visual assay in SARS-CoV-2 diagnosis. The limit of detectable template reaches 10 copies of N gene per 25 ul reaction at isothermal 58℃ within 40 min. The primers for LAMP assay locate at 12 to 213 nt of N gene, a highly conservative region, which serves as a compatible test in emerging SARS-CoV-2 variants. Comparison to a commercial qPCR assay, this LAMP assay exerts the high viability in diagnosis of 41 clinical samples. The study optimizes an advantageous LAMP assay for colorimetric detection of SARS-CoV-2 and emerging variants, which is hopeful to be a promising test in COVID-19 surveillance. See Abstract. The Graphical abstract for the study of Luo is shown below: PNG media_image4.png 638 988 media_image4.png Greyscale The same as in CN 113684320, Luo teaches 6 sets of LAMP primers, including the set of PS2 which comprises the same primers of the instantly claimed primer set N-ID5 (Set-1). See Table 1. Accordingly, CN 113684320 and Luo each teaches a LAMP assay that uses a primer set, PS2, that includes the same primers as the instantly claimed primer set N-ID5 (Set-1), as well as reaction system comprising LAMP reagents comprising calcein. CN 113684320 and Luo are silent on if the LAMP of the invention is “RT-LAMP”. Since the genome of SARS-CoV-2 is RNA, one of skill in the art would have readily envisaged that a reverse transcription (RT) process must be performed to produce templates for the LAMP assays (e.g., cDNA, as indicated in both references). Additionally, the contacting, incubating, assaying, and detecting steps, as instantly claimed, must be performed by any LAMP assays, one of skill in the art would have readily envisaged that the assay of CN 113684320 and Luo would inherently contain the contacting, incubating, assaying, and detecting steps, as instantly claimed. In case of arguments that CN 113684320 and Luo do not teach every element of the claimed invention, one of skill in the art would have found it obvious to perform the steps of reverse transcription, contacting, incubating, assaying, and detecting, recited in the claims to carry out the entire process of detecting SARS-CoV-2 genome in a sample by a LAMP assay, i.e., an RT-LAMP assay. The recited steps are expected to be necessary for the detection of SARS-CoV-2 nucleic acids in a sample by a LAMP assy. Regarding claim 5, CN 113684320 and Luo are silent on extracting nucleic acid from the sample. However, one of skill in the art would have found it obvious to do so if an extraction process would benefit the detection of the viral nucleic acid. Regarding claims 6-8 and 12, Table 4 of CN 113684320 indicates that the reaction results are measured by OD650, suggesting that the assay is colorimetric RT-LAMP assay. Luo explicitly teaches that the assay is colorimetric. See Abstract. One of skill in the art would have found it obvious to mix and incubate reagents needed for the colorimetric detection of assay results. Regarding claims 9-11 and 13-18, since CN 113684320 and Luo teach an RT-LAMP assay system that is indistinguishable from that as claimed, one of skill in the art would have readily expected that the RT-LAMP assay system of CN 113684320 and Luo would produce the same detection efficacy as specified in the instant claims. Regarding claim 19, one of skill in the art would have found it obvious to treat the subject whose sample tests positive for SARS-CoV-2. Therefore, CN 113684320 and Luo each individually anticipates or makes obvious claims 1 and 4-19. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1 and 4-19 are rejected under 35 U.S.C. 103 as being unpatentable over Hoffmann et al. (US 2022/0162686 A1, Pub. Date: May 26, 2022) and/or Diego et al. (Diagnostics 2021, 11, 438). Hoffmann discloses an invention related to a membrane-based, in-gel loop-mediated isothermal amplification (LAMP) system, kit and method for detection of a target microorganism in a sample suspected of containing the microorganism. The system may include a compact, portable device that integrates heat incubation and fluorescence illumination, and also a cloud-based smartphone image analysis application for quantitative results interpretation. If target DNA/RNA are present in the sample, fluorescent amplicons are produced as a result of LAMP reaction. The target microorganisms are detected by visually detecting the presence or absence of the amplicons. The method may be employed for rapid and inexpensive point-of-use (POU) absolute quantification of SARS-CoV-2 in environmental water or wastewater samples with high sensitivity. See Abstract. Hoffmann teaches that for detection of the SARS-CoV-2 genome, any of the 11 RT-LAMP primer sets shown in Table 4 may be used. For the 11 sets of RT-LAMP primers in Table 4 targeting various regions in the SARS-CoV-2 genome, the relative performance may be compared using in-tube amplification of extracted SARS-CoV-2 RNA. Based on such comparison, primer set 3, 6, 10, and 11 of Table 4 may be shown to have the lowest LOD (limit of detection) at 93 copies per 20-μL reaction with no false positives observed in triplicates of NTCs. For these four primer sets, the amplification curves may be examined to compare their amplification efficiency. Based on the rise time, the order of amplification efficiency is observed to be primer set 10>11>3>6. The most efficient primer sets were 10 and 11. See [0087]. Of the 11 sets of RT-LAMP primers, the set 2 targets the SARS-CoV-2 N gene region, including the F3, B3, FIP, BIP, LF and LB primers, with sequences set forth in SEQ ID NOs: 13-18 respectively, as shown in Table 4 of Hoffmann. Here, 5 of the 6 primers in the set 2 disclosed in Table 4 of Hoffmann, i.e., F3 (SEQ 13), B3 (SEQ 14), FIP (SEQ ID NO: 15), BIP (SEQ 16) and LF (SEQ 17), are respectively identical to the corresponding primers in the set N-ID5 (Set-1) disclosed in Table 2 of the instant application. The only difference between the set 2 of Hoffmann and the set N-ID5 (set-1) of the instant application is the primer LB, which contains TAACACCAATAGCAG TCCAGATGA (SEQ 18) in Hoffmann and TCCAATTAACACCAATAGCAGTCCA (SEQ 6) in the instant application. Hoffmann teaches that the measurement of LAMP products relies on end-point analysis and requires post-amplification processing, leading to possible cross-contamination or detection of non-specific LAMP amplicons. Some of these methods include: resolving amplified products on agarose gel electrophoresis' turbidity analysis of positive reactions due to the accumulation of magnesium pyrophosphate (Mg2P2O7), detection of dsDNA under UV-light in presence of an intercalating dyes like SYBR Green I or EvaGreen and addition of metal ion indicators like, calcein/Mn2 and hydroxynapthol blue dye (HNB). See [0051]. Diego teaches a study on development of RT-LAMP assays for detection of SARS-CoV-2. Table 1 of Diego discloses 8 sets of primers, of which the primer set N5 (targeting the viral N gene) include 5 primers, F3, B3, FIP, BIP and LF, that are identical to the corresponding primers in the instant set N-ID5 (Set-1). The only difference between the set N5 of Diego and the set N-ID5 (set-1) of the instant application is the primer LB, which contains ATTAACACCAATAGCAGTCCAGATG in Diego and TCCAATTAACACCAATAGCAGTCCA (SEQ 6) in the instant application. These two primers are overlapping (see below), indicating that Diego uses the same viral sequence region in the design of the primer LB. An alignment between the related LB primer sequences of Hoffmann, Diego and that of the N-ID5 set of the instant application is shown below: ATTAACACCAATAGCAGTCCAGATG (Set N5, Diego) TAACACCAATAGCAGTCCAGATGA (SEQ 18, Hoffmann) TCCAATTAACACCAATAGCAGTCCA (SEQ 6, Instant) The alignment shows that the three primers are overlapping, indicating that Hoffmann and Diego use the same viral sequence region as the instant application in the design of the primer LB. Accordingly, both Hoffmann and Diego teach RT-LAMP assays for detection of SARS-CoV-2 genome nucleic acids, including assays that apply the same 5 primers, F3, B3, FIP, BIP and LF, as those of the N-ID5 (Set-1) primer set, while the LB primers of Hoffmann and Diego overlap with the LB primer of the claimed N-ID5 (Set-1) primer set. It would have been prima facie obvious for one of ordinary skill in the art before the effective filing date of the current invention to combine the teachings of Hoffmann and Diego to arrive at the invention as claimed through routine experimental optimization. Since design of primers for RT-LAMP assays is routine, the claimed LB primer of the B-ID5 (set-1) primer set is considered as equivalent to the counterpart of the primer sets of Hoffmann and Diego, and can be obtained through routine experimental optimization, unless there is evidence that the claimed LB primer (SEQ ID NO: 6) is critical. The additional limitations of claims 5-19 are taught or made obvious in Hoffmann and Diego in the same way as discussed above in the 102/103 rejection over CN 113684320 or Luo. Claim 3 is rejected under 35 U.S.C. 103 as being unpatentable over CN 113684320 (Published on Nov. 23, 2021), Luo et al. (Chemical Engineering Science 251(2022)117430), Hoffmann et al. (US 2022/0162686 A1, Pub. Date: May 26, 2022) and/or Diego et al. (Diagnostics 2021, 11, 438), as applied in the rejections above, in view of Zhang et al. (Biotechniques. 2020 Sep;69(3):178-185). Relevance of CN 113684320, Luo, Hoffmann and Diego is set forth supra. Table 3 of CN 113684320 shows the amplification reaction systems used in the invention, including reagents, such as Bst polymerase and Mg. However, CN 113684320, Luo, Hoffmann and Diego are silent on inclusion of guanidine hydrochloride in LAMP assays. Zhang teaches that guanidine chloride enhances colorimetric loop-mediated isothermal amplification speed and sensitivity. See Abstract. It would have been prima facie obvious for one of ordinary skill in the art before the effective filing date of the current invention to introduce guanidine chloride taught in Zhang into the RT-LAMP assays of CN 113684320, Luo, Hoffmann and Diego to test if guanidine chloride enhances the RT-LAMP assays the same way as taught in Zhang. Double Patenting Rejection The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the claims at issue are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); and In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on a nonstatutory double patenting ground provided the reference application or patent either is shown to be commonly owned with this application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP §§ 706.02(l)(1) - 706.02(l)(3) for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/forms/. The filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to http://www.uspto.gov/patents/process/file/efs/guidance/eTD-info-I.jsp. Claims 1-19 are provisionally rejected on the ground of nonstatutory obviousness-type double patenting as being unpatentable over claims 1-19 of US Application 18489441 in view of the prior art references cited in the art rejections above. Although the conflicting claims are not identical, they are not patentably distinct from each other. Both sets of claims encompass RT-LAMP assays using same sets of primers. See the instant Table 2 and the reference application Table 1. The differences between the two sets of claims include: (1) the reference claims specify steps of “contacting the sample with a primer and one or more reverse transcription polymerase chain reaction (RT-PCR) reagents to form a reaction mixture”, reverse transcribing the SARS-CoV-2 nucleic acid in the sample into cDNA and amplifying the cDNA by incubating the reaction mixture, while the instant claims specify corresponding steps of “contacting the sample with a primer set and one or more reverse transcription loop-mediated isothermal amplification (RT-LAMP) reagents to form a reaction mixture” and “incubating the reaction mixture at a temperature and for a time sufficient to amplify a target sequence of the SARS-CoV-2 nucleic acid sequence in the sample” without specifying reverse transcribing the SARS-CoV-2 nucleic acid into cDNA; and (2) the instant claims specify calcein in the RT-LAMP reagents which is not specified in the reference claims. As indicated in the art rejection above, RT-LAMP refers to a LAMP assay including a reverse transcription reaction to make cDNA from RNA molecules before the LAMP reaction to take place. Moreover, CN 113684320, Luo, Hoffmann, Diego and Zhang together teach that various colorimetric or fluorescent reagents are known to be used in RT-LAMP reactions, including calcein specified in the instant claims. Therefore, the instant claims 1-19 are obvious over claims 1-19 of US Application 18489441, and vice versa. Prior Art References Not Used in the Rejections The following is a list of relevant prior art references that are relevant to the claimed invention not used in current rejections: 1) CN114657282, 2) CN111088406, 3) CN111088406, and 4) US Application 17508751. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to NIANXIANG (NICK) ZOU whose telephone number is (571)272-2850. The examiner can normally be reached on Monday - Friday, 8:30 am - 5:00 pm, EST. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, MICHAEL ALLEN, on (571) 270-3497, can be reached. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /NIANXIANG ZOU/ Primary Examiner, Art Unit 1671
Read full office action

Prosecution Timeline

Jan 18, 2024
Application Filed
Jun 17, 2026
Non-Final Rejection mailed — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12673096
VACCINES AGAINST VIRAL PATHOGENS
3y 8m to grant Granted Jul 07, 2026
Patent 12662710
METHOD FOR DETECTING SINGLE-STRANDED RNA VIRUS
3y 10m to grant Granted Jun 23, 2026
Patent 12636357
Vaccine Composition for Preventing Tuberculosis Comprising Chorismate Mutase
3y 3m to grant Granted May 26, 2026
Patent 12618067
TARGETED DELIVERY OF AN INHIBITOR OF MIR-21 TO MACROPHAGES FOR THE TREATMENT OF PULMONARY FIBROSIS
3y 7m to grant Granted May 05, 2026
Patent 12601018
DETECTION OF SARS-COV-2 USING RNA MULTI-ARM JUNCTION LOGIC GATES
3y 7m to grant Granted Apr 14, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
64%
Grant Probability
89%
With Interview (+24.8%)
2y 8m (~2m remaining)
Median Time to Grant
Low
PTA Risk
Based on 766 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month