The present application is being examined under the pre-AIA first to invent provisions.
DETAILED ACTION
The first recited tracrRNA, SEQ ID NO: 15, has been examined herein. Applicant has amended claim 32 to recite SEQ ID NO: 42 instead of 15. However, applicant cannot switch inventions mid-prosecution. Instant SEQ ID NO: 15 has been searched and examined.
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 120 as follows:
The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994)
The disclosure of the prior-filed applications, Application No. 61799647, 61838148, 61838178, and 61921007, fail to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application. The applications do not disclose a limitation wherein the tracrRNA is required to comprise one or more deoxyribonucleotides.
Should applicant disagree, applicants are encouraged to point out with particularity by page and line number where such support might exist for each of the documents.
Therefore, the claims are accorded an effective filing date of 3/14/14, the filing date of PCT/US2014/029304.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of pre-AIA 35 U.S.C. 103(a) which forms the basis for all obviousness rejections set forth in this Office action:
(a) A patent may not be obtained though the invention is not identically disclosed or described as set forth in section 102, if the differences between the subject matter sought to be patented and the prior art are such that the subject matter as a whole would have been obvious at the time the invention was made to a person having ordinary skill in the art to which said subject matter pertains. Patentability shall not be negatived by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under pre-AIA 35 U.S.C. 103(a) are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims under pre-AIA 35 U.S.C. 103(a), the examiner presumes that the subject matter of the various claims was commonly owned at the time any inventions covered therein were made absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and invention dates of each claim that was not commonly owned at the time a later invention was made in order for the examiner to consider the applicability of pre-AIA 35 U.S.C. 103(c) and potential pre-AIA 35 U.S.C. 102(e), (f) or (g) prior art under pre-AIA 35 U.S.C. 103(a).
Claims 31, 32, and 37-47 are rejected under pre-AIA 35 U.S.C. 103(a) as being unpatentable over Zhang et al. (WO 2014/093712 A1), in view of Heron et al. (US 2016/0010147), Karvelis et al. (RNA Biology, 10:5, 841–851, May 2013), Sternberg et al. (RNA (2012), 18:661–672), and Wu (US 9,738,908 B2), and Zhang (US 8,697,359 B1).
Zhang et al. (supported by 61/836,127, filed 6/17/13) teach that the mature crRNA:tracrRNA complex directs Cas9 to the DNA targeting consisting of the protospacer and the corresponding PAM via heteroduplex formation between the spacer region of the crRNA and the protospacer DNA. Finally, Cas9 mediates cleavage of target DNA upstream of PAM to create a DSB within the protospacer (Figure 2A) [00153]. Therefore, it was known to combine a Cas9 nuclease, tracrRNA, and crRNA into a composition for a method of inducing a double stranded break of target DNA; and to incorporate chemical modifications into the crRNA or tracrRNA.
Zhang et al. teach incorporation of pseudoruridine and 2’-O-methyl modifications into tracr, guide sequences, or crRNA [0029]. Zhang et al. teach that the modification can be a 2’-deoxy analog [0029]. Given that Zhang et al. teach incorporation of 2’-deoxy analogs, it would have been obvious to incorporate a deoxyribonucleotide into the crRNA and/or tracrRNA (instant claims 31, 40, and 41).
For example, Sternberg et al. teach incorporation of a deoxyribonucleotide substitution into a crRNA (see Figure 2) (instant claim 41).
Additionally, Heron et al. teach that spacer sequences of RNA or DNA can comprise locked nucleic acids or 5-methylcytidines. It would have been obvious to incorporate these modifications as a matter of design choice into the crRNA and/or tracrRNA because the modifications are being incorporated into each for the same intended purpose of stabilizing or increasing stability.
Zhang et al. teach optimized truncation of the tracrRNA at various positions including the 3’ or 5’ end. This is considered to be a routinely optimized element.
For example, Karvelis et al. teach that the tracrRNA is approximately 65 nt in length (page 843) and teach that they used in vitro complex assembly to establish the tracrRNA minimal length for formation of the catalytically competent effector complex. We found that the tracrRNA can be shortened at the 3'-end and maintain activity, provided that at least 15 nt are maintained beyond the crRNA-complementary sequence. Further 3'-trimming of tracrRNA compromises DNA cleavage activity, suggesting that the tracrRNA fragment close to the duplex junction may be critical for interaction with the Cas9 protein. tracrRNAs of 53, 48 and 43 nt yielded effector complexes with compromised DNA cleavage activity (page 848).
Zhang et al. teach compositions comprising nucleic acids encoding the tracrRNA, vectors comprising the nucleic acid, and host cells comprising the tracrRNA (instant claims 37-39). Zhang et al. teach nucleic acids encoding S. pyogenes Cas9 and the incorporation of Cas9 [00101](instant claim 45) sequences that have at least 90% identity to instant SEQ ID NO: 18 [00185]-[00187] (instant claim 46).
Zhang et al. teach: [00102] In some embodiments, the CRISPR enzyme is part of a fusion protein comprising one or more heterologous protein domains (e.g. about or more than about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more domains in addition to the CRISPR enzyme) (instant claim 47).
Zhang et al. teach that full complementarity is not required between the crRNA and the target and therefore the crRNA comprises complementary and non-complementary portions. Placement and the sequence of the non-complementary region is considered to be a matter of design choice (instant claim 42). Additionally, instant SEQ ID NO: 5 was a known sequence to separate the guide and tracr sequences, as taught by Zhang (US 8,697,359 B1) (see SEQ ID NO: 13, column 52) (instant claim 44).
Zhang et al. teaches crRNA sequences that are complementary to 17-25 nucleotides in the target (US 8,697,359 B1) (instant claim 43).
It would have been obvious for the tracrRNA to be identical to instant SEQ ID NO: 15 because it was a known tracrRNA sequence, as evidenced by Wu (instant claim 32).
Wu teaches that suitable CRISPR guide sequence is also encoded on the all-in-one vectors. Target sequence is inserted into the all-in-one vector adjacent to the chimeric tracrRNA-crRNA gRNA scaffold. This scaffold is a single engineered nucleotide sequence that functionally replaces individual crRNA and tracrRNA molecules that are present in the native bacterial CRISPR systems (instant claim 40). In some aspects, the scaffold can have the nucleotide sequence: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGT CGGTGCTTTTTTT (SEQ ID NO: 42)(column 31).
Response to Arguments
Applicant argues that Sternberg and Heron with Zhang (712) does not teach or suggest the claimed tracrRNA comprising one or more deoxyribonucleotides. Contrary to applicant’s assertion, Zhang et al. alone is considered to render instant claim 31 obvious because Zhang et al. teaches incorporation of various modifications, including a 2’-deoxy analog, into tracrRNA [0029]. 2’-deoxy analogs render obvious incorporation of a deoxyribonucleotide because 2’-deoxy analogs possess the same defining structural feature of deoxyribonucleotides, the lack of a hydroxyl (-OH) group at the 2' position of the pentose sugar. 2’-deoxy analogs are utilized routinely to mimic natural deoxyribonucleotides by having the same defining structure.
Applicant argues that Sternberg utilized a DNA modification in a crRNA (not a tracrRNA), which rendered the crRNA uncleavable, to demonstrate the importance of the interaction of the non- DNA modified crRNA with Csy4. Nothing in Sternberg teaches or suggests that a person of skill in the art should or could modify a tracrRNA to include a DNA modification.
Sternberg was not relied upon for teaching incorporation of DNA modifications into a tracrRNA. Zhang et al. (712) teach incorporation of the same types of modifications into tracr, guide sequences, or crRNA [0029], evidencing that it was known to incorporate the same types of modifications into each of these structures.
Applicant argues that Heron does not relate to tracrRNA, or to a CRISPR-Cas system at all, nor does Heron teach modifying RNA to incorporate DNA bases. Heron was not relied upon for teaching tracrRNA with one or more deoxyribonucleotides. The instant rejection is a rejection under 35 USC 103, not 102, and therefore it is the combination of references that render the claims obvious. Heron was relied upon strictly for teachings regarding modification of oligonucleotides (spacers) with locked nucleic acids or 5-methylcytidines. It would have been obvious to incorporate these modifications as a matter of design choice into the crRNA and/or tracrRNA because the modifications are being incorporated into each of the nucleic acids for the same intended purpose of stabilizing or increasing stability.
It is noted that Sternberg and Heron et al. were cited as additional evidence of incorporation of DNA modifications into nucleic acids for increased stability. Instant claim 31 is obvious in view of Zhang (712) alone, who offers motivation to incorporate 2’-deoxy analogs into tracrRNA or crRNAs, which have the same defining chemistry as deoxyribonucleotides. Applicant has not demonstrated any unexpected result for incorporation of a single deoxyribonucleotide into a tracrRNA, which is obvious in view of Zhang et al. alone.
Zhang et al.(359) was strictly relied upon for teaching crRNA sequences that are complementary to 17-25 nucleotides in the target and for teaching instant SEQ ID NO: 5. All other Zhang teachings of the rejection are specific to Zhang (712).
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Amy R Hudson whose telephone number is (571)272-0755. The examiner can normally be reached on M-F 8:00am-6:00pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached on 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AMY ROSE HUDSON/Primary Examiner, Art Unit 1636