Prosecution Insights
Last updated: September 24, 2026
Application No. 18/418,420

DNA BARCODE FOR RECOGNIZING ORIGINAL PLACE OF FLOCCULARIA LUTEOVIRENS

Non-Final OA §101§112
Filed
Jan 22, 2024
Priority
Nov 19, 2021 — CN 202111401642.9 +1 more
Examiner
HAMA, JOANNE
Art Unit
1681
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Xizang Vocational Technical College
OA Round
1 (Non-Final)
26%
Grant Probability
At Risk
1-2
OA Rounds
1y 0m
Est. Remaining
64%
With Interview

Examiner Intelligence

Grants only 26% of cases
26%
Career Allowance Rate
67 granted / 262 resolved
-34.4% vs TC avg
Strong +38% interview lift
Without
With
+38.2%
Interview Lift
resolved cases with interview
Typical timeline
3y 8m
Avg Prosecution
45 currently pending
Career history
328
Total Applications
across all art units

Statute-Specific Performance

§101
7.2%
-32.8% vs TC avg
§103
39.2%
-0.8% vs TC avg
§102
14.6%
-25.4% vs TC avg
§112
23.9%
-16.1% vs TC avg
Black line = Tech Center average estimate • Based on career data from 262 resolved cases

Office Action

§101 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION The claim set filed 1/22/2024 is acknowledged Claims 1-11 will be examined on the merits herein. Specification The use of the term Ezup and ABI, which is a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore, the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. It should be noted that the cited occurrences of improper use are only exemplary and Applicant should review the entire specification to correct any other improper use of trademarks. The specification refers to primer groups and primers in an inconsistent manner. Table 1 par.71 refers to specific primers and lists forward and reverse primers such as SEQ ID NO: 1 and 2 and labels them as “1”. A person having ordinary skill in the art would consider this a primer set or group. In table 2, par.120 the top row, 2nd column, recites “Primer 1 amplified fragment”, a single primer cannot amplify a fragment of genomic DNA. This should be labeled as primer set 1 or primer group 1. Consistent labeling of primer sets should be used throughout the specification. Appropriate correction is required. Drawings The drawings are objected to because they disclose nucleic acid sequences without providing the required SEQ ID Nos in figures 1-4. See the below details about nucleotide sequence disclosures. Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: Specific deficiency Nucleotide and/or amino acid sequences appearing in the drawings are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings. Required response – Applicant must provide: Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers; AND/OR A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 1 and 3-8 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claims 1 is indefinite because it refers to “a nucleotide sequence of the DNA barcode comprises one or more of” This can be interpreted to mean that a single nucleotide sequence could have any number of the listed SEQ ID Nos fused together. A nucleotide sequence could also be interpreted to mean any part of any of the nucleotide sequences including parts which would be impossible to produce with the primers described in the specifications and claims 2 and 3. This rejection can be overcome by replacing the above recitation with “the nucleotide sequence or sequences of the DNA barcode comprise one or more of” Claims 3 is indefinite because it used exemplary language. The claim uses the term “such as”, it is unclear if these are limitations. Preferred embodiments should be detailed in the specification, not the claims. This rejection can be overcome by deleting “such as”. Claims 4 is indefinite because it recites “repeating times” in step S3. It is unclear what this means or how it is to be interpreted. The specification does not define this nor can clear direction be determined from searching the art. . Claims 5-8 are rejected as they depend on claim 4 and do not resolve the issue. Claim 4 fails to particularly point out a step for achieving the result of recognizing the original place of Floccularia luteovirens as recited in the preamble. Step S3 ends with detecting the amplification product and judging, however, once an amplification product is detected a person having ordinary skill in the art would need to know what judging is and how to determine the original place of Floccularia luteovirens. Steps for determining the original place of Floccularia luteovirens are recited in claim 5 but are not recited in claim 4. Combining claim 5 into claim 4 can overcome this rejection Claim 8 is indefinite because it recites “PCR annealing during the decrease from 62°C to 55°C”, it is unclear what this is intended to instruct a person having ordinary skill in the art to do. If the applicant meant to refer to a touch down PCR or step-down PCR the applicant should amend the claim language accordingly and use art recognized terms. In the interest of compact prosecution, the examiner will interpret this to be a touch down PCR wherein the first 10 steps comprise and annealing temperature that gradual decreases from 62°C in the first cycle to 55°C in the 10th cycle. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claim 1 is rejected under 35 U.S.C. 101 because the claimed invention is directed to a natural product. Claim 1 is not directed to patent eligible subject matter. Based upon an analysis with respect to the claim as a whole, the aforementioned claim do not recite something significantly different than a judicial exception. The rationale for this determination is explained below: The aforementioned claims are directed toward a one or more sequences comprising sequences such as SEQ ID NO: 4 or 5 as well as others, no additional sequence is added to the limitation of the claim thus these sequences are naturally occurring sequences from Floccularia luteovirens genome. These claims are a composition of matter (Step 1: YES). Accordingly, the instant claims encompass compositions comprising naturally occurring DNA sequences are thereby deemed to be a judicial exception because they are a product of nature. See MPEP 2106.04(c): “In Myriad, the Supreme Court made clear that not all changes in characteristics will rise to the level of a marked difference, e.g., the incidental changes resulting from isolation of a gene sequence are not enough to make the isolated gene markedly different. Myriad, 569 U.S. at 580, 106 USPQ2d at 1974-75. … The Supreme Court concluded that these isolated but otherwise unchanged genes were not eligible, because they were not different enough from what exists in nature to avoid improperly tying up the future use and study of the naturally occurring BRCA genes. See, e.g., Myriad, 569 U.S. at 585, 106 USPQ2d at 1977 ("Myriad's patents would, if valid, give it the exclusive right to isolate an individual’s BRCA1 and BRCA2 genes … But isolation is necessary to conduct genetic testing") and 569 U.S. at 593, 106 USPQ2d at 1980 (describing how would-be infringers could not avoid the scope of Myriad’s claims). In sum, the claimed genes were different, but not markedly different, from their naturally occurring counterparts (the BRCA genes), and thus were product of nature exceptions.” Applicants’ specification sets forth that a DNA barcode is “conserved and stable genetic DNA sequences in a genome” and the DNA is produced by PCR from genomic DNA of Floccularia luteovirens par.73-74, and the sequences recited in claim 1 have the M13 fluorescent primer removed par.81. As such the sequences of SEQ ID NO: 4 and others in claim 1 would be identical to those of the naturally occurring genomic DNA as they lack the M13 primer 5’ overhang that is used to label the DNA barcode. Therefore, it appears that, like in Myriad, the DNA sequences are different due to isolation but not markedly different and therefore the claim recites a product of nature exception. (Step 2A, Prong 1: YES) The Supreme Court in Diamond v. Chakrabarty, 447 U.S. 303, 206 USPQ 193 (1980), held a claim to a genetically engineered bacterium eligible, because the claimed bacterium was not a “product of nature” exception. (Emphasis added). As the Court explained, the modified bacterium was patentable because the patent claim was not to a “hitherto unknown natural phenomenon,” but instead had “markedly different characteristics from any found in nature,” due to the additional plasmids and resultant capacity for degrading oil. 447 U.S. at 309-10, 206 USPQ at 197. Subsequent judicial decisions have made clear that the Supreme Court’s decision in Chakrabarty is “central” to the eligibility inquiry with respect to nature-based products. See, e.g., Association for Molecular Pathology v. Myriad Genetics, Inc., 569 U.S. _, 133 S. Ct. 2107, 2116, 106 USPQ2d 1972, 1979 (2013). For example, the Federal Circuit has indicated that “discoveries that possess ‘markedly different characteristics from any found in nature,’ … are eligible for patent protection.” In re Roslin Institute (Edinburgh), 750 F.3d 1333, 1336, 110 USPQ2d 1668, 1671 (Fed. Cir. 2014) (quoting Chakrabarty, 447 U.S. at 310, 206 USPQ2d at 197). In Roslin, the claimed invention was a live-born clone of a pre-existing, non-embryonic, donor mammal selected from cattle, sheep, pigs, and goats. An embodiment of the claimed invention was the famous Dolly the Sheep, which the court stated was “the first mammal ever cloned from an adult somatic cell.” Despite acknowledging that the method used to create the claimed clones “constituted a breakthrough in scientific discovery”, the court relied on Chakrabarty in holding the claims ineligible because “Dolly herself is an exact genetic replica of another sheep and does not possess ‘markedly different characteristics from any [farm animals] found in nature.’” Roslin, 750 F.3d at 1337, 110 USPQ2d at 1671. This judicial exception is not integrated into a practical application because the claim does not recite any additional elements beyond the naturally occurring DNA sequences that might integrate the judicial exception into a practical application (Step 2A, Prong 2: NO). The claim(s) does/do not include additional elements that are sufficient to amount to significantly more than the judicial exception because the claim does not recite any additional elements beyond the naturally occurring DNA sequences that might amount to significantly more (Step 2B: NO). As the sequences listed in claim 1 remains identical to the naturally occurring genomic sequences of Floccularia luteovirens, the instantly claimed DNA barcode is deemed to be a naturally occurring judicial exception. The applicant can overcome this rejection by cancelling claim 1 or placing a limitation on claim 1 in which any sequence claimed is fused to a heterologous sequence such that it is non naturally occurring, this would confer a markedly different characteristic on the genomic DNA. Claim 9 and 10 are rejected under 35 U.S.C. § 101, the claimed invention is directed to non-statutory subject matter. The claim does not fall within at least one of the four categories of patent eligible subject matter because the claim appears to be directed toward a process/method, however the preamble does not recite a method and the rest of the claim does not provide steps or structures to the method. See MPEP § 2104 III, the applicant must amend the claims to fall within one of the four statutory categories, a process, machine, manufacture, or composition of matter. This rejection can be overcome by cancelling claims 9 and 10. Allowable Subject Matter The primer sequences of claim 2 are allowable as they contain M13 5’ overhangs that impart markedly different characteristics on them from genomic sequences. The primers are interpreted to be allowable as groups which must contain a pair containing a forward and reverse primer at minimum, wherein the forward primer comprises the M13 complementary sequence which is what makes it markedly different than a natural product judicial exception. Accordingly claims 2 and 11 are allowed. A method comprising the steps of claim 4 and claim 5 combined would be allowable subject matter if the above objections and rejections are overcome, and as such claims dependent on this method would be allowable subject matter. Closest Prior Art CN 105969862 A published 9/28/2016 (machine translation provided in file wrapper) hereinafter 862, teaches the closest prior art. 862 teaches extracting genome DNA of three floccularia luteovirens populations among which the geographic interval is more than 300km, and designing 12 pairs of primers from the genomic DNA. The 12 pairs of primers are listed on p.2-3. A STIC search for the primers of the instant application did not match these primers. Therefore 862 does not teach the specific primers of the instant application nor does it suggest them. Within the STIC search no primers were exact matches from the prior art and the closest primers were directed toward different organisms. Sample matches are recited below. SEQ ID NO: 1 aligned to Sequence 125021, US/12247464A Publication No. US20090123928A1 GENOMIC LANDSCPES OF HUMAN BREAST AND COLORECTAL CANCERS Query Match 78.4%; Score 29.8; Length 38; Best Local Similarity 93.9%; Matches 31; Conservative 0; Mismatches 2; Indels 0; Gaps 0; Qy 2 GTAAAACGACGGCCAGTCTTCCCACAGGCGCCT 34 |||||||||||||||||||||||||||| | || Db 1 GTAAAACGACGGCCAGTCTTCCCACAGGAGACT 33 SEQ ID NO: 2 aligned to WO2004048511-A2 SEQ ID NO: 295639 The invention relates to a bioinformatically detectable novel viral gene. Query Match 92.0%; Score 18.4; Length 32; Best Local Similarity 95.0%; Matches 19; Conservative 0; Mismatches 1; Indels 0; Gaps 0; Qy 1 AACTGAGACGGAGCAATGCA 20 ||||||||| |||||||||| Db 24 AACTGAGACAGAGCAATGCA 5 Therefore, it would not have been obvious for a person having ordinary skill in the art prior to the effective filing date to design the exact primers of the instant application and apply them to identification of the geographic location of Floccularia luteovirens. Conclusion Claims 1 and 3-10 are not allowed. Claims 2 and 11 are allowed. Inquiry Information Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUDOLPH E. SLOUP Jr. IV Ph.D. whose telephone number is (571)272-7899. The examiner can normally be reached Monday to Friday, 9am to 4pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Joanne Hama can be reached at (571) 272-2911. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /RUDOLPH E. SLOUP Jr. IV Ph.D./ Examiner, Art Unit 1645 /JOANNE HAMA/Supervisory Patent Examiner, Art Unit 1647
Read full office action

Prosecution Timeline

Jan 22, 2024
Application Filed
Jul 01, 2026
Non-Final Rejection mailed — §101, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12692322
KRAS SPECIFIC ANTIBODIES AND USES THEREOF
5y 3m to grant Granted Jul 28, 2026
Patent 12648929
COMPOSITIONS AND METHODS FOR PREVENTING AND/OR TREATING FILARIAL DISEASE
5y 3m to grant Granted Jun 09, 2026
Patent 12595300
ANTI-HUMAN P40 PROTEIN DOMAIN ANTIBODY AND USE THEREOF
4y 2m to grant Granted Apr 07, 2026
Patent 12559553
IL-31 MODULATORS FOR TREATING FXR-INDUCED PRURITUS
3y 8m to grant Granted Feb 24, 2026
Patent 12553897
USE OF CIRCULATING INTERLEUKIN-18 FOR PROGNOSTICATING AND TREATING RECURRENCE IN EARLY STAGE NON-SMALL CELL LUNG CANCER
3y 8m to grant Granted Feb 17, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
26%
Grant Probability
64%
With Interview (+38.2%)
3y 8m (~1y 0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 262 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month