Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on August 8, 2025, has been entered.
Election/Restrictions
Applicant’s election without traverse of Group I (Claims 1-28 and 31-32; drawn to methods of inducing an inflating memory CD8+ T cell response/treating cancer) in the reply filed on November 4, 2024, is acknowledged.
Applicant further elected the following species:
a. Esophageal cancer for the alternative species of cancer
b. Multiple doses for the alternative species of dosing
In light of the Applicant’s elected species, claim 26 is withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim.
Rejoinder
The species election requirement for the species of cancer has been reconsidered in view of the prior art. Prostate cancer is rejoined.
DETAILED ACTION
The amended claims filed on August 8, 2025, have been acknowledged. Claims 29-30 were cancelled. Claims 1-5, 7, 10-14, 16, 22, and 28 were amended. Claims 33-34 are new. In light of the Applicant’s elected species, claim 26 is withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Claims 1-25, 27-28, and 31-34 are pending and examined on the merits.
Priority
Applicant’s claim for the priority of a prior-filed application under 35 U.S.C. 119(a)-(d) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date as follows:
The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994).
The disclosure of the prior-filed applications, Application No. GB19149848, filed October 16, 2019, and Application No. GB20094207, filed June 19, 2020, fail to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application. These foreign priority applications do not provide information related to SEQ ID NOs: 13-15, 18-19, and 33-34. However, Application No. PCT/GB2020/052620, filed on October 16, 2020, did provide the above information.
Therefore, claims 1-18, 22-28, and 31-34 receive foreign priority from foreign priority application GB19149848, filed October 16, 2019, while claims 19-21 receive foreign priority from application No. PCT/GB2020/052620, filed on October 16, 2020.
Information Disclosure Statement
The information disclosure statements (IDS) filed on August 11, 2025, and October 21, 2025, have been considered.
Claim Objections
Applicant is advised that should claim 3 be found allowable, claim 14 will be objected to under 37 CFR 1.75 as being a substantial duplicate thereof. When two claims in an application are duplicates or else are so close in content that they both cover the same thing, despite a slight difference in wording, it is proper after allowing one claim to object to the other as being a substantial duplicate of the allowed claim. See MPEP § 608.01(m).
New Claim Rejections - 35 USC § 112a
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 28 and 33 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claim 28 recites the following claim language, A method of treating cancer in a human subject with cancer, comprising: administering … an adenoviral vector comprising a nucleotide sequence encoding a polypeptide comprising a single cancer-specific CD8+ T cell epitope, … wherein the pharmaceutical composition induces an inflating memory CD8+ T cell response, wherein the inflating memory CD8+ T cell response comprises production of CD8+/CX3CRI1+/KLRG- 1+ T cells; wherein the method inhibits tumor growth to a greater extent compared to administration of a corresponding adenoviral vector comprising a nucleotide sequence encoding a full length protein containing the same single cancer-specific CD8+ T cell epitope; and wherein (1) the single cancer-specific CD8+ T cell epitope is not a viral immunogen, and (2) wherein the single cancer-specific CD8+ T cell epitope is not an NY- ESO-1 epitope. The specification discloses no such adenoviral vectors that induce such an inflating memory T cell response as the two cancer-specific CD8+ T cell epitopes disclosed in the specification that do have the required inflating memory T cell functional response are excluded from this method: AH1 (a viral immunogen derived from the murine leukemia virus envelope glycoprotein gp70 (Example 1 of specification)) and NY-ESO-1 (explicitly excluded in the claim). Similarly, claim 33 excludes the AH1 and NY-ESO-1 epitopes and, thus, does not provide an appropriate written description for the method of claim 33.
Under the written description guidelines (see MPEP 2163) the Examiner is directed to determine whether one skilled in the art would recognize that the Applicant was in possession of the claimed invention as a whole at the time of filing. The following considerations are critical to this determination.
To satisfy the written description requirement, a patent specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention. See, e.g., Moba, B.V. v. Diamond Automation, Inc., 325 F.3d 1306, 1319, 66 USPQ2d 1429, 1438 (Fed. Cir. 2003); Vas-Cath, Inc. v. Mahurkar, 935 F.2d at 1563, 19 USPQ2d at 1116.
An original claim may lack written description support when (1) the claim defines the invention in functional language specifying a desired result but the disclosure fails to sufficiently identify how the function is performed or the result is achieved or (2) a broad genus claim is presented but the disclosure only describes a narrow species with no evidence that the genus is contemplated. See Ariad Pharms., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1349-50 (Fed. Cir. 2010) (en banc). The written description requirement is not necessarily met when the claim language appears in ipsis verbis in the specification. "Even if a claim is supported by the specification, the language of the specification, to the extent possible, must describe the claimed invention so that one skilled in the art can recognize what is claimed. The appearance of mere indistinct words in a specification or a claim, even an original claim, does not necessarily satisfy that requirement." Enzo Biochem, Inc. v. Gen-Probe, Inc., 323 F.3d 956, 968, 63 USPQ2d 1609, 1616 (Fed. Cir. 2002).
Accordingly, to satisfy the written description requirement, the specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention. Vas-Cath, Inc. v. Mahurkar, 935 F.2d 1555, 1562-63, 19 USPQ2d 1111 (Fed. Cir. 1991). See also MPEP 2163.
Actual Reduction to Practice
Applicant does provide evidence that adenoviral vectors encoding single cancer-specific CD8+ T cell epitopes AH1 and NY-ESO-1 produce the required T cell response and inhibits tumor growth to a greater extent than the full length gene in BALB/c mice and transgenic HHD mice, respectively (Examples and Figures 1-7 for AH1 and 8-9 for NY-ESO-1). However, these are the only two epitopes that were shown to have these properties when administered to mice and both are excluded from claims 28 and 33, as discussed above.
Therefore, the Applicant has not provided any examples of epitopes that fall within the limitations of claims 28 and 33.
STATE OF THE ART & QUANTITY OF EXPERIMENTATION
Although Klyushnenkova et al. (J Immunother 35: 390-399. 2012) and Palmowski et al. (J Immunol 168: 4391-4398. 2002) teach administering viral vectors to induce a CD8 T cell response and Klyushnenkova teaches that vectors encoding PSA (65-73), a prostate specific epitope, showed greater tumor inhibition than CMV viruses encoding the full length PSA protein, neither teach the specific CD8+ T-cell inflating memory response required by claims 28 and 33.
Klyushnenkova teaches a method of inducing an inflating memory CD8+ T cell response comprising administering a recombinant mCMV viral vector encoding a CD8 T cell epitope (PSA65-73; a cancer specific CD8+ T cell epitope) to a subject before challenging it with a tumor (i.e. prophylactic administration to minimize development of cancer). Their results show that immunization with mCMV based vectors encoding a single PSA-specific CD8 T-cell epitope (PSA65–73) induced PSA-specific CD8 T-cell responses, which increased in time after immunization (termed “memory inflation”) and reduced tumor growth (page 391, column 1, paragraph 2 and column 2, paragraph 2 and Figure 4). Klyushnenkova teaches that CMV viruses encoding PSA (65-73; a 27 nucleotide sequence), a prostate specific antigen (i.e. not a viral immunogen), showed greater tumor inhibition than CMV viruses encoding the full length PSA protein (i.e. a subject not administered the pharmaceutical composition) (Figure 4).
Palmowski teaches a method of inducing a CD8+ T cell response comprising administering a vaccinia viral vector encoding the NY-ESO-1157-165¬ cancer epitope to a A2/Kb transgenic mouse. Their results show that immunization with vaccinia based vectors encoding a single NY-ESO-1157-165¬ cancer epitope induced an antigen-specific cytotoxic T lymphocyte [CTL] response including inducing CD8 T cell levels (page 4393, column 2, paragraph 3 and Figure 3).
Therefore, although the vectors encoding single CD8 T-cell specific epitopes that could induce a CD8 T cell response and inhibited tumor growth better than the full length protein were known in the art, one of skill in the art would neither expect nor predict which epitopes would generate the required functional inflating memory T cell response when administered to human subjects with tumors.
Applicant has claimed a method comprising a genus of vectors encoding CD8+ T cell specific epitopes that generate a specific functional inflating memory T cell response, yet the specification has not disclosed such vectors that are encompassed by claims 28 and 33, has not set forth in terms of distinguishing identifying characteristics as evidenced by other descriptions of the invention that are sufficiently detailed to show that Applicant was in possession of the claimed method comprising a genus of vectors. Furthermore, the state of the art does not identify any vectors that generate the required functional response encompassed by the claimed genus of vectors of claims 28 and 33. Therefore, the methods of claims 28 and 33 would require undue experimentation, and one of skill in the art would neither expect nor predict the claimed functional inflating memory response from any cancer-specific CD8+ T cell epitope.
CONCLUSION
Therefore, the Examiner concludes that there is insufficient written description of the instantly claimed methods of claims 28 and 33. Specifically, there is limited description of the structure-function relationship between the claimed genus of vectors and their ability to generate the required function inflating memory T cell response, and the Examiner further concludes a skilled artisan would find the specification inadequately describes the claimed genus of vectors.
Withdrawn Claim Rejections - 35 USC § 112b
The prior rejection of claim 2 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention is withdrawn in light of Applicant’s amendments to claim 2 to remove the language “inflating memory T cell response persists in a cell of the subject for at least 28 days”.
New Claim Rejections - 35 USC § 112b
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 15-16 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. This rejection is a new rejection substantially similar to a previous rejection. Any aspect of Applicant’s traversal that is relevant to the rejection as newly written is addressed below.
The specification teaches that the designation (-) indicates low expression or no expression of the marker. As such, there are two different possible meanings for -, no expression or low expression. Therefore, the designation – as used in claim 16 is indefinite. It is not clear what the “-(low)” of claim 16 is supposed to mean and whether it is limiting. It is not clear whether one is supposed to read it is identifying that expression is supposed to be low and not absent.
Furthermore, even if it was supposed to be understood as identifying low expression of the markers, it is not clear what would define low expression. The term “low” in claim 16 is a relative term which renders the claim indefinite. The term “low” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. It is unclear what level of expression of the markers would fall within low expression.
Response to Arguments
Applicant's arguments filed August 8, 2025, are acknowledged.
Applicant argues that the amendments to claim 16 overcome the rejection of record (page 9, paragraph 2).
Applicant's arguments have been fully considered but they are not persuasive.
As detailed above, Applicant’s amendments to claim 16 do not overcome the rejection of record and results in additional; uncertainty.
New Claim Rejections - 35 USC § 112d
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 23 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 23 is dependent on claim 1 which recites that the single epitope is not a viral immunogen. Therefore, the limitations of claim 23 are already found in claim 1 and claim 23 does not further limit claim 1.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Withdrawn Claim Rejections - 35 USC § 103
The prior rejection of claim 28 under 35 U.S.C. 103 as being unpatentable over Klyushnenkova et al. (J Immunother 35: 390-399. 2012) and further in view of Bolinger et al. (J Immuno 190: 4162-4174. 2013), and Bolinger et al. (Cell Reports 13: 1578-1588. 2015), as evidenced by Neefjes et al. (Nature Reviews. 11: 823-836. 2011) is withdrawn in light of Applicant’s amendments to claim 28 to recite the limitation “wherein the inflating memory CD8+ T cell response comprises production of CD8+/CX3CR1 +/KLRG-1 + T cells”.
The prior rejection of claims 1-8, 22-23, 27-28, and 32 under 35 U.S.C. 103 as being unpatentable over Klyushnenkova et al. (J Immunother 35: 390-399. 2012) and further in view of Bolinger et al. (J Immuno 190: 4162-4174. 2013), Bolinger et al. (Cell Reports 13: 1578-1588. 2015), and Sorenson et al. (Eur. J. Immunol 39: 2725–2736. 2009), as evidenced by Neefjes et al. (Nature Reviews. 11: 823-836. 2011) is withdrawn in light of Applicant’s amendments to claim 1 to recite the limitation “wherein the inflating memory CD8+ T cell response comprises production of CD8+/CX3CR1 +/KLRG-1 + T cells”.
The prior rejection of claim 28 under 35 U.S.C. 103 as being unpatentable over Palmowski et al. (J Immunol 168: 4391-4398. 2002) and further in view of Jager et al. (PNAS 39: 14453-14458. 2006), Weiser et al. (Journal of Immunotherapy 24: 151-161. 2001), and Geiben-Lynn et al. (Clinical and Vaccine Immunology: 691–696. 2008), as evidenced by Neefjes et al. (Nature Reviews. 11: 823-836. 2011), Bolinger et al. (J Immuno 190: 4162-4174. 2013), The Jackson Laboratory (HHD mouse strain details), and Bolinger et al. (Cell Reports 13: 1578-1588. 2015) is withdrawn in light of Applicant’s amendments to claim 28 to recite the limitation “wherein the single cancer-specific CD8+ T cell epitope is not an NY-ESO-1 epitope.”
New Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
New Claim Rejections - 35 USC § 103
Claims 1-18, 22-23, 27, 32, and 34 are rejected under 35 U.S.C. 103 as being unpatentable over Palmowski et al. (J Immunol 168: 4391-4398. 2002) and further in view of Jager et al. (PNAS 39: 14453-14458. 2006), Weiser et al. (Journal of Immunotherapy 24: 151-161. 2001), Klyushnenkova et al. (J Immunother 35: 390-399. 2012), Geiben-Lynn et al. (Clinical and Vaccine Immunology: 691–696. 2008), and Sorensen et al. (Eur. J. Immunol. 39: 2725–2736. 2009) as evidenced by Bolinger et al. (Cell Reports 13: 1578-1588. 2015) and Jackson Laboratories (NSG-HLA-A2/HHD). This is a new rejection made in response to Applicant’s amendments to claim 1 that is substantially similar to a previous rejection. Any aspect of Applicant’s traversal that is relevant to the rejection as newly written is addressed below.
Regarding claims 1, Palmowski teaches a method of inducing a CD8+ T cell response comprising administering a vaccinia viral vector encoding the NY-ESO-1157-165- cancer epitope to a A2/Kb transgenic mouse. Their results show that immunization with vaccinia based vectors encoding a single NY-ESO-1157-165- cancer epitope (9 amino acids long and 27 nucleotides long) induced an antigen-specific cytotoxic T lymphocyte [CTL] response including inducing CD8 T cell levels (page 4393, column 2, paragraph 3 and Figure 3). Palmowski teaches that recombinant vaccines encoding tumor-derived peptides are currently being designed for use against cancer (abstract).
Palmowski does not teach wherein the vector is administered to a subject with a tumor.
However, Jager teaches that they administered vaccinia viruses expressing the full length NY-ESO-1 in cancer patients (abstract). CD8 T cell responses were observed in 19 of 23 evaluable patients and were directed against the p157–170 region (page 14455, column 1, paragraph 4). Jager teaches that they treated patients with tumor bearing cancers, including lung metastases (Table 1).
Weiser teaches that lung cancer cells (H-1355) were transduced with an adenovirus expressing full length NY-ESO-1. Although high levels of NY-ESO-1 were expressed following transduction, cancer cell death did not occur likely due to deficient antigen processing which is commonly observed in lung cancer (page 156, column 1, paragraph 1 and Table 2).
Klyushnenkova teaches a method of inducing an inflating memory CD8+ T cell response comprising administering a recombinant mCMV viral vector encoding a CD8 T cell epitope (PSA65-73; a cancer specific CD8+ T cell epitope) to a subject before challenging it with a tumor. Their results show that immunization with mCMV based vectors encoding a single PSA-specific CD8 T-cell epitope (PSA65–73) induced PSA-specific CD8 T-cell responses, which increased in time after immunization (termed “memory inflation”) (page 391, column 1, paragraph 2 and column 2, paragraph 2 and Figure 4). Klyushnenkova teaches that CMV viruses encoding PSA (65-73), a prostate specific antigen, showed greater tumor inhibition than CMV viruses encoding the full length PSA protein (Figure 4).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined the vector of Palmowski with the method of treating cancer of Jager to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to substitute with a reasonable expectation of success because Jager teaches vaccinia viruses expressing NY-ESO-1 can be used to treat cancer in patients and Weiser teaches that although high levels of NY-ESO-1 were expressed following transduction with an adenovirus expressing full length NY-ESO-1, cancer cell death did not occur likely due to deficient antigen processing which is commonly observed in lung cancer. Furthermore, Klyushnenkova teaches that CMV viruses encoding PSA (65-73), a prostate specific antigen, showed greater tumor inhibition than CMV viruses encoding the full length PSA protein. As such, it would have been obvious that one of ordinary skill in the art would have used a viral vector encoding the NY-ESO-1157-165 peptide as Jager successfully reduced to practice using vectors expressing NY-ESO-1 to treat cancer, Weiser taught that the full length protein failed likely due to a common deficiency in antigen processing in lung cancer cells, and Klyushnenkova teaches that encoding a single epitope compared to the full length protein improved tumor growth inhibiton. Therefore, using the NY-ESO-1157-165- epitope expressing vector would get around this issue. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
Palmowski does not teach wherein the viral vector is an adenovirus.
Weiser teaches that lung cancer cells (H-1355) were transduced with an adenovirus expressing full length NY-ESO-1. Although high levels of NY-ESO-1 were expressed following transduction, cancer cell death did not occur likely due to deficient antigen processing which is commonly observed in lung cancer (page 156, column 1, paragraph 1 and Table 2).
Geiben-Lynn teaches that mice vaccinated with vaccinia viruses (replication competent or replication incompetent) led to early animal death (replication competent) or short term expression (~48 hours for immunocompetent and immunocompromised mice; replication incompetent) while the adenovirus vaccine (recombinant adenovirus 5 with E1 and E3 deleted maintained for ~10 days in immunocompetent mice and at least 100 days in immunocompromised mice (page 691, column 2, paragraph 3 and page 692, column 2, paragraph and Figures 1-3).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted the vaccinia viral vector backbone of Palmowski with the adenoviral vector backbone of Weiser to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to substitute with a reasonable expectation of success because Geiben-Lynn teaches that mice vaccinated with vaccinia viruses (replication competent or replication incompetent) led to early animal death (replication competent) or short term expression (~48 hours for immunocompetent and immunocompromised mice; replication incompetent) while the adenovirus vaccine maintained for ~10 days in immunocompetent mice and at least 100 days in immunocompromised mice. As such, the adenovirus backbone would have been an obvious substitute for expressing the epitope. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
Palmowski, Weiser, and Geiben-Lynne silent as to which promoter is used in their vectors. However, Sorensen teaches an adenoviral vector lacking E1 and E3
With a CMV promoter was used to express a tumor-associated immunodominant epitope for vaccination purposes against tumors (abstract and page 2733, column 2, paragraph 2 and Figure 7).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have used a CMV promoter. One of ordinary skill in the art would have a reason to use a CMV promoter with a reasonable expectation of success because Sorensen has successfully reduced to practice that CMV reporters can be used to express tumor-associated immunodominant epitopes and NY-ESO-1157-165 is a known tumor-associated immunodominant epitope. Furthermore, CMV promoters are known to be constitutively active ensuring continued expression of the epitope over time and have been used extensively within the field. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
As an initial matter regarding the required inflating memory T cell response, the claim language is interpreted to require that CD8+/CX3CR1+/KLRG-1+ cells are produced and that the memory T cell response persists for 28 days but not that CD8+/CX3CR1+/KLRG-1+ cells persist for 28 days.
Regarding whether the vector of the combined teachings of Palmowski, Jager, Weiser, Klyushnenkova, Geiben-Lynn, and Sorenson causes the required inflating memory T cell response, Palmowski teaches the vector encodes NY-ESO-1157-165, Geiben-Lynn teaches that the adenoviral vector is a recombinant adenovirus 5 with E1 and E3 deleted, Palmowski teaches that the vaccination can occur in HHD mice (Jackson Laboratory evidence that HHD mice are immunodeficient mice (page 1), and Sorenson teaches that a CMV promoter can be used to express the epitope. Examples 8-9 of the instant specification discloses that they immunized HHD mice with AdHu5-NY-ESO-1(157-165) (an adenovirus 5 with E1 and E3 deleted). Following immunization, ~97% of CD8 T cells were CD44+ CD62L- 21 days post-immunization (Figure 8B). ~100% were CX3CR1+ and ~65% were KLRG-1+ at day 40 (Figures 8C and D). As such, there were at least 65% of cells that were CD8+/CX3CR1+/KLRG-1+ at day 40. As the combined method of Palmowski, Jager, Weiser, Klyushnenkova, Geiben-Lynn, and Sorenson is the same as the example of the instant specification, it naturally flows that their combined method would also have the same property.
Regarding the epitope bypassing normal antigen processing requirements, the instant specification discloses that by using a vector of the present invention, which encodes a single epitope of interest, the antigen processing requirements are bypassed thereby resulting in an inflating memory response (page 12, lines 1-16 and Example 8). As the method of the Palmowski, Jager, Weiser, Klyushnenkova, Geiben-Lynn, and Sorenson is the same as the claimed method, it naturally flows that epitope of the combined teachings would also not be processed by APC cells of the subject.
Regarding the human subject of claim 1, although Palmowski performs their experiments in mice and not humans, it is well understood that mice serve as a translational model for treating humans and it would be obvious to take the next step of performing the method in humans. Furthermore, it is worth noting that Applicant’s own examples are performed in mice and not humans.
Regarding claim 2, as stated supra, Palmowski teaches the vector encodes NY-ESO-1157-165, Geiben-Lynn teaches that the adenoviral vector is a recombinant adenovirus 5 with E1 and E3 deleted, Palmowski teaches that the vaccination can occur in HHD mice (Jackson Laboratory evidence that HHD mice are immunodeficient mice (page 1), and Sorenson teaches that a CMV promoter can be used to express the epitope.. Examples 8-9 of the instant specification discloses that they immunized HHD mice with AdHu5-NY-ESO-1(157-165) (an adenovirus 5 with E1 and E3 deleted) and saw that the epitope vector performed better than the vector encoding the full length protein (i.e. a subject not administered the pharmaceutical composition). As the combined method of Palmowski, Jager, Weiser, Klyushnenkova, Geiben-Lynn, and Sorenson is the same as the example of the instant specification, it naturally flows that their combined method would also have the same property.
Regarding claims 3 and 14, although Palmowski teaches that they primed the mice with DNA encoding NY-ESO-1157-165 before boosting with the vaccinia virus encoding NY-ESO-1157-165 as part of their method, Jager teaches that as part of their method of treating patients with tumors by administering recombinant vaccinia-NY-ESO-1, they found that administering the recombinant vaccinia-NY-ESO-1 alone induced a CD8 T cell response and was found to be safe (Abstract, Figures 1-2, Table 1, and page 14453, column 2, paragraph 4-page 14455, column 2, paragraph 2). As part of the Jager method, the first vaccination dose would be administered to patients who had not previously been administered a polypeptide comprising the epitope. Therefore, it would have been obvious that one could use the method of Jager for administering the vector to a human subject as they have shown that their method was safe and led to CD8 response.
Regarding claim 5, Jager teaches that multiple patients with tumors observed regression of inhibition of tumor growth (page 14456, column 1, paragraph 1, column 2, paragraph 4). Furthermore, Palmowski teaches the vector encodes NY-ESO-1157-165, Geiben-Lynn teaches that the adenoviral vector is a recombinant adenovirus 5 with E1 and E3 deleted, Palmowski teaches that the vaccination can occur in HHD mice (Jackson Laboratory evidence that HHD mice are immunodeficient mice (page 1), and Sorenson teaches that a CMV promoter can be used to express the epitope. Examples 8-9 of the instant specification discloses that they immunized HHD mice with AdHu5-NY-ESO-1(157-165) (an adenovirus 5 with E1 and E3 deleted) and saw that the epitope vector inhibited tumor growth. As the combined method of of Palmowski, Jager, Weiser, Klyushnenkova, and Geiben-Lynn is the same as the example of the instant specification, it naturally flows that their combined method would also have the same property. Therefore, the combined method of Palmowski, Jager, Weiser, Klyushnenkova, Geiben-Lynn, and Sorenson would inhibit tumor growth.
Regarding claim 6, Weiser teaches that NY-ESO-1 is aberrantly expressed in a wide variety of primary tumors and cancer lines (i.e. overexpressed) (page 152, column 1, paragraph 1).
Regarding claims 7 and 22, as stated supra, Palmowski teaches the vector encodes NY-ESO-1157-165, Geiben-Lynn teaches that the adenoviral vector is a recombinant adenovirus 5 with E1 and E3 deleted, Palmowski teaches that the vaccination can occur in HHD mice (Jackson Laboratory evidence that HHD mice are immunodeficient mice (page 1), and Sorenson teaches that a CMV promoter can be used to express the epitope. Examples 8-9 of the instant specification discloses that they immunized HHD mice with AdHu5-NY-ESO-1(157-165) (an adenovirus 5 with E1 and E3 deleted) and saw that the epitope vector performed better than the vector encoding the full length protein (i.e. a subject not administered the pharmaceutical composition). As the combined method of Palmowski, Jager, Weiser, Klyushnenkova, Geiben-Lynn, and Sorenson is the same as the example of the instant specification, it naturally flows that their combined method would also have the same property.
Regarding claims 8-9, New York esophageal squamous cell carcinoma 1 (NY-ESO-1) is a known to be expressed in a variety of cancers including esophageal cancer and would be recognized as an obvious potential target cancer for the combined method of Palmowski, Jager, Weiser, Klyushnenkova, and Geiben-Lynn.
Regarding claim 10, Palmowksi teaches a polyvirus boosting protocol wherein a mixture of 108 mel3-SFV, 106 NY-ESO-1 vaccinia, and 106 tyrosinase vaccinia in a total volume of 300. As stated supra, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted the vaccinia viral vector backbone of the tyrosinase vector of Palmowski with the adenoviral vector backbone of Geiben-Lynn to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to substitute with a reasonable expectation of success because Geiben-Lynn teaches that mice vaccinated with vaccinia viruses (replication competent or replication incompetent) led to early animal death (replication competent) or short term expression (~48 hours for immunocompetent and immunocompromised mice; replication incompetent) while the adenovirus vaccine maintained for ~10 days in immunocompetent mice and at least 100 days in immunocompromised mice. As such, the adenovirus backbone would have been an obvious substitute for expressing the epitope. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
As stated supra, the combined teachings of Palmowski, Jager, Weiser, Klyushnenkova, and Geiben-Lynn motivate using a adenoviral vector encoding the NY-ESO-1157-165 for administration to a human with a tumor. Regarding the tyrosinase in the polyvirus composition, Palmowski is using the full length protein of tyrosinase
However, Klyushnenkova teaches that animals receiving mCMV/PSA65–73 (single epitope) demonstrated a substantial level of PSA-specific CD8 T cells, whereas animals receiving mCMV/PSA Full Length did not generate an increased CTL [cytotoxic T lymphocyte] response to PSA (page 397, column 2, paragraph 2).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted the full length tyrosinase of Palmowski with a single CD8 epitope of tyrosinase, as identified by Kylushnenkova, to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to substitute with a reasonable expectation of success because Klyushnenkova teaches that animals receiving mCMV/PSA65–73 (single epitope) demonstrated a substantial level of PSA-specific CD8 T cells, whereas animals receiving mCMV/PSA Full Length did not generate an increased CTL [cytotoxic T lymphocyte] response to PSA. As such, it would have been obvious to use a single epitope encoded in the viral vector rather than the full length gene to generate a better CD8 response. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
Regarding which single tyrosinase epitope can be used, Palmowski teaches that they found expansion of NY-ESO-1157-165 and tyrosinase379-377 (a CD8 specific epitope) in their vaccinated mice (page 4395, column 2, paragraph 2). Therefore, as Palmowski found that NY-ESO-1157-165 and tyrosinase379-377 underwent expansion, it would have been obvious to use tyrosinase379-377 as the single epitope.
Regarding claims 11-13 and 15-16, as stated supra, Palmowski teaches the vector encodes NY-ESO-1157-165, Geiben-Lynn teaches that the adenoviral vector is a recombinant adenovirus 5 with E1 and E3 deleted, Palmowski teaches that the vaccination can occur in HHD mice (Jackson Laboratory evidence that HHD mice are immunodeficient mice (page 1), and Sorenson teaches that a CMV promoter can be used to express the epitope. Example 8 and corresponding Figure 8 of the instant specification disclose that they immunized HHD mice with AdHu5-NY-ESO-1(157-165) (an adenovirus 5 with E1 and E3 deleted). Following immunization, ~97% of CD8 T cells were CD44+ CD62L- 21 days post-immunization (Figure 8B). ~100% were CX3CR1+ and ~65% were KLRG-1+ at day 40 (Figures 8C and D). As such, there were at least 65% of cells that were CD8+/CX3CR1+/KLRG-1+ at day 40 (Claims 10-11). As shown in Figure 8A, these cell phenotypes at day 40 were only representative of ~12% of CD8+ T cells. As such, ~7% of CD8+ cells were CD8+/CX3CR1+/KLRG-1+ at day 40 (Claims 12-13). Figures 8F and 8G show that these CD8+ cells have low Lag3 and Tim3 expression at day 40 (considered to fall within the limitations of low expression as identified by the 112b rejection) (Claim 14). Bolinger (2015) evidences that CD44+/CD62Llo/CD27lo/CD127lo- phenotypes represent a stable memory T cell pool following adenovirus vaccination (page 1580, column 2, paragraphs 3-4). As Example 8 discloses memory CD8 T cell responses following adenovirus vaccination, it naturally flows that the cells of example 8 would also exhibit the same marker profile, producing CD8+/CX3CR1+/KLRG-1+/CD44+/CD62L-/CD27-(low)/CD127-(low) cells (as noted in the 112b rejection above, the definition of –(low) (e.g. CD27-(low)) is unclear, the low expression of Bolinger (2015) is considered to fall within the low limitation of claim 16). As the combined method of Palmowski, Jager, Weiser, Klyushnenkova, Geiben-Lynn, and Sorenson is the same as the example of the instant specification, it naturally flows that their combined method would also have the same properties.
Regarding claims 17-18, Geiben-Lynn teaches that they used a recombinant adenovirus human serotype 5 with E1 and E3 deleted (page 691, column 2, paragraph 3).
Regarding claim 23, Weiser teaches that NY-ESO-1 is a cancer epitope (i.e. not a viral epitope) (abstract).
Regarding claim 27, Jager teaches that patients were vaccinated at least 4 times (Figure 1).
Regarding claim 32, although Jager does not identify what route of administration they used, it was well understood that at least one of the identified administration routes would have been used to vaccinate Jager’s patients. Furthermore, Geiben-Lynn demonstrates that subcutaneous, intraperitoneal, intranasal, and intramuscular administrations of adenoviral vectors would have been predictably obvious routes of administration.
Regarding claim 34, as stated supra, Sorenson provides motivation for using a CMV promoter (heterologous to the adenoviral backbone) to express the epitope.
Response to Arguments
Applicant's arguments filed August 8, 2025, are acknowledged.
First, Applicant argues that the combined teachings of the previously recited rejection does not teach each and every element of claim 1. Applicant argues that the combined teachings do not teach a method that induces an inflating memory CD8+ T cell response in a human subject that persists for at least 28 days after administration (page 14, paragraphs 1-5)
Applicant's arguments have been fully considered but they are not persuasive.
Regarding whether the vector of the combined teachings of Palmowski, Jager, Weiser, Klyushnenkova, Geiben-Lynn, and Sorenson causes the required inflating memory T cell response, Palmowski teaches the vector encodes NY-ESO-1157-165, Geiben-Lynn teaches that the adenoviral vector is a recombinant adenovirus 5 with E1 and E3 deleted, Palmowski teaches that the vaccination can occur in HHD mice (Jackson Laboratory evidence that HHD mice are immunodeficient mice (page 1), and Sorenson teaches that a CMV promoter can be used to express the epitope. Examples 8-9 of the instant specification discloses that they immunized HHD mice with AdHu5-NY-ESO-1(157-165) (an adenovirus 5 with E1 and E3 deleted). Following immunization, ~97% of CD8 T cells were CD44+ CD62L- 21 days post-immunization (Figure 8B). ~100% were CX3CR1+ and ~65% were KLRG-1+ at day 40 (Figures 8C and D). As such, there were at least 65% of cells that were CD8+/CX3CR1+/KLRG-1+ at day 40.
As the combined method of Palmowski, Jager, Weiser, Klyushnenkova, Geiben-Lynn, and Sorenson is the same as the example of the instant specification, it naturally flows that their combined method would also have the same property.
Therefore, Applicant’s arguments are unpersuasive.
Second, Applicant argues that the combined teachings would have no reasonable expectation that the adenoviral vector of claim 1 would be successful to induce an inflating memory T cell response that persists for 28 days in a human subject with a tumor. Applicant argues that Palmowski teaches away from using adenoviral vectors as Palmowski teaches that preexisting memory CTL responses to adenovirus may compromise the induction of CTL responses specific to the cancer epitope and that one should use alternative vectors such as alphaviruses to overcome these limitations with adenoviruses. Furthermore, Jager discloses that recombinant vaccinia and recombinant fowlpox viruses encoding NY-ESO-1 mice were well tolerated. Applicant argues that Geiben-Lynn uses athymic mice and these are not relevant when considering the design choice for a method that induces an inflating memory T cell response in a human subject with cancer. Applicant argues that one would not select the adenovirus as it had the most rapid decline of antigen expression in the most relevant (setting mice with a thymus) when considering design choice and would choose the DNA vector that demonstrated the least rapid decline in the most relevant mice (page 15, paragraph 1-page 18, paragraph 1).
Applicant's arguments have been fully considered but they are not persuasive.
As an initial matter, it is worth noting that Palmowski discusses not encoding epitopes expressed by recurrent viruses as part of a larger polyvalent construct encoding multiple epitopes but does not discuss the potential for genes from the viral vector itself to compromise the induction of CTL responses specific to the cancer epitope nor does Palmowski specifically discuss using other viruses instead of adenoviruses, only that their SFV virus may be useful for prime-boost protocols. Additionally, Palmowski does not use the term adenovirus at all in the study. Therefore, Palmowski does not teach away from using adenoviruses, as suggested by the Applicant.
As shown in Figures 1-4 of Geiben-Lynn, adenoviruses had the greatest increase in expression and prolonged expression for each of the 4 administration methods compared to the other viruses/DNA. As noted above, recombinant vaccinia viruses have a risk of killing the subject when replication competent or in athymic immunocompromised subjects whereas the other viruses/DNA did not have this effect. Furthermore, vaccinia viruses exhibit a rapid decline in expression around days 3-9 in immunocompetent mice while adenoviruses maintain higher expression for a prolonged period of time while also achieving high expression that is not seen in DNA vectors. Furthermore, adenoviruses show increased expression in all administration routes while vaccinia viruses and DNA vectors do not. Therefore, it would have been obvious that adenoviruses were the preferred choice as they did not have the same limitations of the other options (killing the subject, rapid decline in expression, minimal expression depending on administration route. As Weiser discussed above, NY-ESO-1 is expressed in many types of tumors and it would be more beneficial to have a vector that can be used by any of the identified administration routes than one that is limited to specific administration routes that may not be as efficient in treating the tumor.
Furthermore, regarding Applicant’s arguments about athymic mice not being relevant, it is worth noting that claim 1 is broad as to the human subject as any human with a tumor is included within the broadest reasonable interpretation of the claims. As there are athymic humans and every person is susceptible to cancer, athymic mice would also represent a relevant model for translation to humans and not just immunocompetent mice, as argued by the Applicant. Furthermore, Palmowski specifically discusses performing some of their experiments in transgenic HHD mice which are immunocompromised. Therefore, the athymic mice are also relevant to the teachings of Palmowski. Additionally, it is worth noting that Applicant uses transgenic HHD (i.e. immunocompromised mice) mice in their examples using NY-ESO-1157-165- encoding adenoviruses to induce an inflating memory T cell response and not humans or immunocompetent mice.
Therefore, there was sufficient motivation for modifying Palmowski to teach the method of claim 1, as recited in the rejection above based on the combined teachings of Palmowski, Jager, Weiser, Klyushnenkova, Geiben-Lynn, and Sorenson.
Third, Applicant argues that Weiser teaches that full length protein may have failed to a common deficiency in antigen processing in lung cancer cells and would not have expected that expressing a single epitope would have a better chance of inducing an inflating immune response (page 16, paragraph 1).
Applicant's arguments have been fully considered but they are not persuasive.
As stated in the newly recited rejection, Klyushnenkova teaches a method of inducing an inflating memory CD8+ T cell response comprising administering a recombinant mCMV viral vector encoding a CD8 T cell epitope (PSA65-73; a cancer specific CD8+ T cell epitope) to a subject before challenging it with a tumor. Their results show that immunization with mCMV based vectors encoding a single PSA-specific CD8 T-cell epitope (PSA65–73) induced PSA-specific CD8 T-cell responses, which increased in time after immunization (termed “memory inflation”) (page 391, column 1, paragraph 2 and column 2, paragraph 2 and Figure 4). Klyushnenkova teaches that CMV viruses encoding PSA (65-73), a prostate specific antigen, showed greater tumor inhibition than CMV viruses encoding the full length PSA protein (Figure 4). Therefore, it would have been obvious to use a single epitope as required by the claims.
Claims 1 and 19 are rejected under 35 U.S.C. 103 as being unpatentable over Palmowski et al. (J Immunol 168: 4391-4398. 2002) and further in view of Jager et al. (PNAS 39: 14453-14458. 2006), Weiser et al. (Journal of Immunotherapy 24: 151-161. 2001), Klyushnenkova et al. (J Immunother 35: 390-399. 2012), Geiben-Lynn et al. (Clinical and Vaccine Immunology: 691–696. 2008), and Sorensen et al. (Eur. J. Immunol. 39: 2725–2736. 2009), as applied to claim 1 above, and further in view of World Intellectual Property Organization Patent Application No. 2019034887 (Dorrell). This is a new rejection substantially similar to a previous rejection. Applicant’s traversal has been addressed above.
The teachings of Palmowski, Jager, Weiser, Kylushnenkova, Geiben-Lynn, and Sorenson are as discussed above.
The combined teachings of Palmowski, Jager, Weiser, Kylushnenkova, Geiben-Lynn, and Sorenson do not teach the adenoviral sequence, nor wherein the vector encodes a sequence 5’ of the epitope with 90% sequence identity to SEQ ID NO: 15 nor a sequence 3’ of the epitope with 90% sequence identity to SEQ ID NO: 33.
However, Dorrell teaches a ChAdOx2 sequence (which is a type of the human adenovirus serotype 5 vector) wherein SEQ ID NO: 67 is 5’ of the immunogen cassette and SEQ ID NO: 68 is 3’ of the immunogen cassette (page 57, lines 15-18 and page 1, lines 1-35). As both vectors are adenovirus AdHu5 vectors and used for vaccination purposes, it would have been obvious that the adenovirus of the combined teachings of Palmowski, Jager, Weiser, and Geiben-Lynn could have SEQ ID NOs 67 (99.3% similar to SEQ ID NO: 15; as this sequence is over 2000 bps in length, the similarity results are not shown) and 68 (96.4% similar to SEQ ID NO: 33).
1 TGAGCGGCCGCTCGAGCATGCATCTAGAGGGCCCTATTCTATAGTGTCACCTAAATGCTA 60
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13943 TAAGCGGCCGCTCGAGCATGCATCTAGAGGGCCCTATTCTATAGTGTCACCTAAATGCTA 14002
61 GAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCT 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14003 GAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCT 14062
121 CCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATG 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14063 CCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATG 14122
181 AGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGC 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14123 AGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGC 14182
241 AGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCT 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14183 AGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCT 14242
301 CTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCGAGGGGGGATCGAT-CCGTCGAG 359
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
14243 CTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCGAGGGGGGATCGATCCCGTCGAG 14302
360 ATATCTAGACCCAGCTTTCTTGTACAAAGTGGT 392
|||||||||||||||||||||||||||||||||
14303 ATATCTAGACCCAGCTTTCTTGTACAAAGTGGT 14335
Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. Furthermore, the successful cloning and sequencing of a DNA encoding a known virus is obvious, and thus unpatentable, if (1) there was some suggestion or motivation in the prior art to clone the DNA, and (2) there was a “reasonable expectation of success,” based on "detailed enabling methodology" in the prior art. Ex parte Kubin, 83 U.S.P.Q.2d (BNA) 1410 (B.P.A.I. 2007), aff'd, 561 F.3d 1351 (Fed. Cir. 2009).
Claims 1 and 19-20 are rejected under 35 U.S.C. 103 as being unpatentable over Palmowski et al. (J Immunol 168: 4391-4398. 2002) and further in view of Jager et al. (PNAS 39: 14453-14458. 2006), Weiser et al. (Journal of Immunotherapy 24: 151-161. 2001), Klyushnenkova et al. (J Immunother 35: 390-399. 2012), Geiben-Lynn et al. (Clinical and Vaccine Immunology: 691–696. 2008), Sorensen et al. (Eur. J. Immunol. 39: 2725–2736. 2009), and World Intellectual Property Organization Patent No. 2019034887 (Dorrell), as applied to claims 1 and 19 above, and further in view of United States Patent No. 9981033 (Mebatsion), as evidenced by Genbank (Human adenovirus 5, complete genome). This is a new rejection substantially similar to a previous rejection. Applicant’s traversal has been addressed above.
The teachings of Palmowski, Jager, Weiser, Kylushnenkova, Geiben-Lynn, Sorenson, and Dorrell are as discussed above. Genbank evidences that SEQ ID NO: 14 has ~99% sequence identity to the wild type adenovirus 5 genotype excluding the E3 gene. As Weiser teaches that their adenovirus is an adenovirus 5 with E1 and E3 deleted, it will have a sequence that is also ~99% similar to that of SEQ ID NO: 14 (as SEQ ID NO: 14 is over 30,000 bps in length, the sequence comparison is not shown).
The combined teachings of Palmowski, Jager, Weiser, Kylushnenkova, Geiben-Lynn, Sorenson, and Dorrell do not teach wherein the vector encodes a sequence 5’ of the upstream sequence with 90% sequence identity to SEQ ID NO: 13.
However, Mebatsion teaches a recombinant adenovirus 5 viral vector encoding antigens against porcine reproductive and respiratory syndrome virus comprising SEQ ID NO: 30 which has 100% sequence identity to SEQ ID NO: 13 of the instant application (Claims 1-3 and 5).
1 CATCATCAATAATATACCTTATTTTGGATTGAAGCCAATATGATAATGAGGGGGTGGAGT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 CATCATCAATAATATACCTTATTTTGGATTGAAGCCAATATGATAATGAGGGGGTGGAGT 60
61 TTGTGACGTGGCGCGGGGCGTGGGAACGGGGCGGGTGACGTAGTAGTGTGGCGGAAGTGT 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
61 TTGTGACGTGGCGCGGGGCGTGGGAACGGGGCGGGTGACGTAGTAGTGTGGCGGAAGTGT 120
121 GATGTTGCAAGTGTGGCGGAACACATGTAAGCGACGGATGTGGCAAAAGTGACGTTTTTG 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
121 GATGTTGCAAGTGTGGCGGAACACATGTAAGCGACGGATGTGGCAAAAGTGACGTTTTTG 180
181 GTGTGCGCCGGTGTACACAGGAAGTGACAATTTTCGCGCGGTTTTAGGCGGATGTTGTAG 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
181 GTGTGCGCCGGTGTACACAGGAAGTGACAATTTTCGCGCGGTTTTAGGCGGATGTTGTAG 240
241 TAAATTTGGGCGTAACCGAGTAAGATTTGGCCATTTTCGCGGGAAAACTGAATAAGAGGA 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
241 TAAATTTGGGCGTAACCGAGTAAGATTTGGCCATTTTCGCGGGAAAACTGAATAAGAGGA 300
301 AGTGAAATCTGAATAATTTTGTGTTACTCATAGCGCGTAATATTTGTCTAGGGCCGCGGG 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
301 AGTGAAATCTGAATAATTTTGTGTTACTCATAGCGCGTAATATTTGTCTAGGGCCGCGGG 360
361 GACTTTGACCGTTTACGTGGAGACTCGCCCAGGTGTTTTTCTCAGGTGTTTTCCGCGTTC 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
361 GACTTTGACCGTTTACGTGGAGACTCGCCCAGGTGTTTTTCTCAGGTGTTTTCCGCGTTC 420
421 CGGGTCAAAGTTGGCGTTTTATTATTATAGTCAGTCGAAGCTTGGATCCGGTACCTCTAG 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
421 CGGGTCAAAGTTGGCGTTTTATTATTATAGTCAGTCGAAGCTTGGATCCGGTACCTCTAG 480
481 AATTCTCGAGCGGCCGCTAGCGACATCGATC 511
|||||||||||||||||||||||||||||||
481 AATTCTCGAGCGGCCGCTAGCGACATCGATC 511
As both vectors are adenovirus 5 viral vectors used for vaccinations with an antigen as a transgene, it would have been obvious that the adenovirus of the combined teachings of Palmowski, Jager, Weiser, Geiben-Lynn, and Dorrell could have SEQ ID NO 30 (100% similar to SEQ ID NO: 13). Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. Furthermore, the successful cloning and sequencing of a DNA encoding a known virus is obvious, and thus unpatentable, if (1) there was some suggestion or motivation in the prior art to clone the DNA, and (2) there was a “reasonable expectation of success,” based on "detailed enabling methodology" in the prior art. Ex parte Kubin, 83 U.S.P.Q.2d (BNA) 1410 (B.P.A.I. 2007), aff'd, 561 F.3d 1351 (Fed. Cir. 2009).
Claims 1 and 19-21 are rejected under 35 U.S.C. 103 as being unpatentable over Palmowski et al. (J Immunol 168: 4391-4398. 2002) and further in view of Jager et al. (PNAS 39: 14453-14458. 2006), Weiser et al. (Journal of Immunotherapy 24: 151-161. 2001), Klyushnenkova et al. (J Immunother 35: 390-399. 2012), Geiben-Lynn et al. (Clinical and Vaccine Immunology: 691–696. 2008), Sorensen et al. (Eur. J. Immunol. 39: 2725–2736. 2009), World Intellectual Property Organization Patent No. 2019034887 (Dorrell), and United States Patent No. 9981033 (Mebatsion), as applied to claims 1 and 19-20 above, and further in view of Zhang et al. (Bioinformatics 33: i234–i242. 2017) and United States Patent No. 9796973 (Akada). This is a new rejection substantially similar to a previous rejection. Applicant’s traversal has been addressed above.
The teachings of Palmowski, Jager, Weiser, Kylushnenkova, Geiben-Lynn, Sorenson, Dorrell, and Mebatsion are as discussed above.
Sorenson is silent as to the sequence of the CMV promoter.
However, Dorrell teaches SEQ ID NO: 67 comprises a sequence 100% similar to SEQ ID NO: 18 of the instant application (as the sequence is over 2500 bp in length, the similarity is not shown). It would have been obvious that the CMV promoter could have this sequence as it was known within the art for a CMV promoter. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. Furthermore, the successful cloning and sequencing of a DNA encoding a known virus is obvious, and thus unpatentable, if (1) there was some suggestion or motivation in the prior art to clone the DNA, and (2) there was a “reasonable expectation of success,” based on "detailed enabling methodology" in the prior art. Ex parte Kubin, 83 U.S.P.Q.2d (BNA) 1410 (B.P.A.I. 2007), aff'd, 561 F.3d 1351 (Fed. Cir. 2009).
The combined teachings of Palmowski, Jager, Weiser, Kylushnenkova, Geiben-Lynn, Sorenson, Dorrell, and Mebatsion do not teach wherein the vector encodes a translation initiation sequence 100% identical to SEQ ID NO: 19 nor a BGH polyadenylation sequence 100% identical to SEQ ID NO: 34.
However, Zhang teaches that the Kozak sequence (i.e. the optimal initiation start site sequence) comprises gccgccRccAUGG. In the Kozak sequence, a lower case indicates a commonly occurred base, a upper case denotes a highly conserved base, and the sequence in a bracket is of uncertain significance (page 238, column 2, paragraph 4). As the transcription initiation sequence of SEQ ID NO: 19 is predominantly the Kozak sequence (in bold):
1 CCCGCCGCCACC 12
|||||||||
1 ---GCCGCCACCATG 15
It would have been obvious to one of ordinary skill in the art that SEQ ID NO: 19 would be a possibility as the only the CCC preceding the Kozak sequence are immaterial to the transcription starting sequence required (i.e, the Kozak sequence) but would have been obvious to include so as to avoid hairpin formation with the CC rich Kozak.
Regarding the BGH polyadenylation signal, Akada teaches SEQ ID NO: 9 is a BGH polyadenylation terminator sequence that was commonly known in the field for stabilizing messenger RNAs and has 100% sequence identity to SEQ ID NO: 34 of the instant application.
1 CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCC 60
61 TGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
61 TGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTC 120
121 TGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATT 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
121 TGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATT 180
181 GGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGG 225
|||||||||||||||||||||||||||||||||||||||||||||
181 GGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGG 225
As both sequences were commonly known in the art for translation initiation and polyadenylation, it would have been obvious that the adenovirus of the combined teachings of Palmowski, Jager, Weiser, Geiben-Lynn, Dorrell, and Mebatsion could have SEQ ID NOs: 19 and 34 of the instant application in thir adenovirus. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. Furthermore, the successful cloning and sequencing of a DNA encoding a known virus is obvious, and thus unpatentable, if (1) there was some suggestion or motivation in the prior art to clone the DNA, and (2) there was a “reasonable expectation of success,” based on "detailed enabling methodology" in the prior art. Ex parte Kubin, 83 U.S.P.Q.2d (BNA) 1410 (B.P.A.I. 2007), aff'd, 561 F.3d 1351 (Fed. Cir. 2009).
Claims 1, 24-25, and 31 are rejected under 35 U.S.C. 103 as being unpatentable over Palmowski et al. (J Immunol 168: 4391-4398. 2002) and further in view of Jager et al. (PNAS 39: 14453-14458. 2006), Weiser et al. (Journal of Immunotherapy 24: 151-161. 2001), Klyushnenkova et al. (J Immunother 35: 390-399. 2012), Geiben-Lynn et al. (Clinical and Vaccine Immunology: 691–696. 2008), and Sorensen et al. (Eur. J. Immunol. 39: 2725–2736. 2009), as applied to claim 1 above, and further in view of Chowdhury et al. (Journal of Internal Medicine 283: 110–120. 2018). This is a new rejection substantially similar to a previous rejection. Applicant’s traversal has been addressed above.
The teachings of Palmowski, Jager, Weiser, Kylushnenkova, Geiben-Lynn, and Sorenson are as discussed above.
The combined teachings of Palmowski, Jager, Weiser, Kylushnenkova, Geiben-Lynn, and Sorenson do not teach wherein the vector is administered with a checkpoint inhibitor.
However, Chowdhury teaches that cancer vaccines present antigens to the immune system to generate an antitumour immune response. As the role of PD-1 blockade is to kick-start the natural immune response, the combination of cancer vaccines with PD-1 blockade might be a reasonable approach for the treatment of less immunogenic tumours. Ott et al. have recently reported a personalized neoantigen vaccine-based treatment for melanoma; they have also shown that recurrent melanoma patients could be cured by PD-1 blockade (page 115, column 1, paragraph 4).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined the method of inducing memory T cells in a subject with a tumor of the combined teachings of Palmowski, Jager, Weiser, Kylushnenkova, Geiben-Lynn, and Sorenson with administering the vector in combination with a checkpoint inhibitor, as identified by Chowdhury to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to combine with a reasonable expectation of success because Chowdhury teaches that cancer vaccines present antigens to the immune system to generate an antitumour immune response. As the role of PD-1 blockade is to kick-start the natural immune response, the combination of cancer vaccines with PD-1 blockade might be a reasonable approach for the treatment of less immunogenic tumours. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEENAN A BATES whose telephone number is (571)270-0727. The examiner can normally be reached M-F 7:30-5:00.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Doug Schultz can be reached on (571) 272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEENAN A BATES/Examiner, Art Unit 1631
/JAMES D SCHULTZ/Supervisory Patent Examiner, Art Unit 1631