DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. The instant Application is a Continuation-in-Part of Application 17/528,851 which claims domestic benefit from U.S. provisional application 63/146914 filed on February 8, 2021.
The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994).
The disclosure of the prior-filed application, Applications No. 63/146914 and 17/528,851, fails to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application. Claim 3 of the instant application recites a capsid protein which is encoded by a nucleotide sequence as denoted by SEQ ID NO: 7. Recitations of the instantly claimed SEQ ID NO: 7 are not found in the parent application 17/528,851 and, although the provisional application recites an exemplary sequence which encodes Q beta capsid proteins (See Pg. 4 of the specification, application 63/146914) which comprises the instantly claimed SEQ ID NO: 7, there is no disclosed rationale for choosing the species of SEQ ID NO: 7. Accordingly, claim 3 is not entitled to the benefit of the prior application.
Claims 1-2 and 4-7 are assigned a priority date of February 8, 2021. Claim 3 is assigned the priority date of the instant filing, January 1, 2024.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on January 30, 2024 is in compliance with the provisions of 37 CFR 1.97 and is being considered by the examiner.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 1-5 and 7 are rejected under 35 U.S.C. 103 as being unpatentable over Williams (2016/0194613 A1) in view of Witherell and Uhlenbeck (1989, Specific RNA binding by Q. beta. coat protein. Biochem., 28(1), 71-76, hereafter “Witherell”) and Abbott et al. (2020, Development of CRISPR as an antiviral strategy to combat SARS-CoV-2 and influenza. Cell, 181(4), 865-876, hereafter “Abbott”) as evidenced by Konermann et al. (2018, Transcriptome engineering with RNA-targeting type VI-D CRISPR effectors. Cell, 173(3), 665-676), hereafter “Konermann”).
With regard to claim 1, Williams teaches a virus-like particle (VLP) encapsulating RNA which is formed by coat proteins, i.e., capsid proteins, of a bacteriophage and one or more RNA polynucleotides where the coat proteins encapsulate the one or more RNAs within the virus particle (Para. [0010], [0042]). Williams teaches that the RNA within the VLP can be from mRNA (Para. [0011]) and that the one or more RNAs comprise a nucleotide sequence which has a high affinity for the capsid proteins which enables packaging of the RNA into the VLP (Para. [0010], [0014], [0046]), which Williams refers to as a “recognition tag” (Paras [0059]-[0060]), i.e. a capsid protein binding tag. Williams teaches that VLPs containing RNAs can be used for delivery of RNA for therapeutics including targeting of infectious diseases. (Para. [0085]) including targeting of RNA of an infectious pathogen (claim 11), and that VLPs can be using in RNA-based gene therapy (Para. [0030]). Williams teaches an embodiment of VLPs using capsid proteins of Q beta (Paras. [0012], [0064]) and that capsid protein binding tags are known in the art, citing Witherell as teaching Q beta capsid protein binding tags. Williams further teaches that the Q beta capsid protein has an amino acid sequence of SEQ ID NO: 4 which comprises the amino acid sequence of SEQ ID NO: 15 (See Para. [0065] and SEQ ID NO: 15 .rnpbm file, result 29, duplicate 10). Therefore, it appears that the instantly disclosed Q beta capsid protein RNA binding motif is present in the amino acid sequence of Q beta capsid protein as taught by Williams.
PNG
media_image1.png
176
764
media_image1.png
Greyscale
Beyond citing Witherell for known Q beta capsid protein binding tags, Williams is silent as to the specific sequence of capsid protein binding tag.
Witherell teaches a variant of Q beta capsid binding tags, fragment 2 having the sequence GGGAATCACATCAGTAACTGAGTGACTTC (See Fig. 7) which has high binding affinity (See Table II). The sequence as taught by Witherell is 100 identical to instantly claimed SEQ ID NO: 1.
Therefore, it would have been obvious to one having ordinary skill in art before the effective filing date of the claimed invention, to choose the Q beta capsid protein binding tag as taught by Witherell in the VLP comprising Q beta coat proteins which encapsulates an RNA comprising a capsid protein binding tag with a reasonable expectation of success. A skilled artisan would have been motivated to choose the capsid protein binding tag as taught by Witherell as Witherell teaches that capsid protein binding tag has high affinity for the Q beta capsid protein. One having ordinary skill in the art would have had a reasonable expectation of success as Williams teaches that capsid protein binding tags are known in the art and cites Witherell as examples.
While the combination of Williams and Witherell teach VLPs encapsulating RNA which can be used to treat infectious diseases, Williams and Witherell are silent as to VLPs comprising an mRNA encoding a Cas13 protein and an RNA comprising a targeting sequence reverse and complementary to a targeting site and a Cas13 protein recognition sequence.
Abbott teaches a CRISPR-Cas13 system (i.e., PAC-MAN) which can recognize and degrade RNA from SARS-CoV-2 and influenza A virus (Abstract). Abbott teaches use of a PAC-MAN system comprising use of Cas13d and crRNAs designed to target specific RNA for degradation (Pg. 866, left col., 1st para.) as well as identification of specific “spacer sequences” which are able to target coronaviruses for use in crRNAs, which is considered to read on a targeting sequence complementary to a targeted site (Pg. 867, left col., 1st para.). Abbott teaches identification of pan-coronavirus crRNAs which are able to target all known human coronavirus sequences as well as provide coverage against other animal coronaviruses (Pg. 871, right col., 1st and 2nd paras.; Figure 5). Abbott further contemplates that PAC-MAN components (i.e., Cas13d and crRNAs) in RNA form could be therapeutically delivered in vivo via lipid nanoparticles (Pg. 873, right col., 1st para.). Although Abbott is silent as to the presence of a Cas13 protein recognition sequence in the crRNA, Abbott cites Konermann as describing the CRISPR-Cas13d system (Pg. 866, left col.) and Konermann evidences that the CRISPR-Cas13d system (e.g., CasRx) used by Abbott comprises a guide RNA (Pg. 674, left col., 2nd para.) which is considered to reasonably read on a Cas13 protein recognition sequence.
Therefore it would have been obvious to one having ordinary skill in the art, before the effective filing date of the claimed invention, to combine Abbott’s PAC-MAN system comprising a Cas13 protein and a crRNA comprising a Cas13 protein recognition sequence and a targeting sequence for a disease such as SARS-CoV-2 with the VLP as taught by the combination of Williams and Witherell which can be used to encapsulate mRNA for the treatment of infectious diseases with a reasonable expectation of success. A skilled artisan, at the time of the invention, would have been well aware of the COVID-19 pandemic caused by SARS-CoV-2 and the magnitude of global research surrounding development of vaccines and treatments for COVID-19/SARS-CoV-2, and would have been motivated to combine Abbott’s use of the PAC-MAN system for inhibition of SARS-CoV-2 with the VLP delivery mechanism of Williams and Witherell, especially given Abbott’s teaching that an in vivo delivery mechanism was a barrier to use of the PAC-MAN system and the suggested use of encapsulation in lipid nanoparticles. A skilled artisan would have had a reasonable expectation of success as Abbott suggests that RNA-based PAC-MAN system components could be encapsulated for therapeutic delivery and Williams and Witherell teach that VLPs can be used to deliver therapeutic RNA for treatment of infectious diseases.
With regard to claim 2, Williams teaches that the coat proteins can be from enterobacteria bacteriophage Q beta (Paras. [0012], [0064]), which is considered to reasonably read on capsid proteins derived from Escherichia virus Qbeta.
With regard to claim 3, Williams teaches a nucleotide sequence which encodes a Q beta capsid protein SEQ ID NO: 3 which is 100% identical to instantly claimed SEQ ID NO: 1 (See Para. [0064] and SEQ ID NO: 7 .rnpbm file, result 1, duplicate 1)
PNG
media_image2.png
636
788
media_image2.png
Greyscale
With regard to claim 4, Abbott teaches that crRNA-N18f was determined to target 99.6% of SARS-CoV-2 genomes. Abbott’s crRNA-N18F shares 100% sequence identity with instantly claimed SEQ ID NO: 5 (See Fig. 5 and crRNA-23 in Table S2). Accordingly, it would have been obvious to choose the crRNA-N18F of Abbott to target the vast majority of SARS-CoV-2.
With regard to claim 5, as stated supra, Abbott teaches use of the PAC-MAN system to target SARS-CoV-2 which is a nucleotide sequence derived from an RNA virus.
With regard to claim 7, Abbott teaches that inhibition of SARS-CoV-2 was more sensitive to crRNA concentration than Cas13d expression and that maintenance of a high level of crRNA concentration, i.e., the second RNA molecule, is important for effective SARS-CoV-2 targeting (Pg. 868, left and right cols. at bottom and Pg. 870, left col., 1st sentence). Williams teaches an exemplary embodiment where each VLP encapsulates approximately 3 RNA molecules (Para. [0077]). Therefore, a skilled artisan would have understood based on the teachings of Abbott that the number of moles of the first RNA molecule encoding the Cas13 protein should be less than or equal to the number of moles of the second RNA molecule encoding the crRNA when packaged into the VLP in order for the VLP to have optimal therapeutic effect.
Claims 1-3 and 5-6 are rejected under 35 U.S.C. 103 as being unpatentable over Williams (2016/0194613 A1) in view of Witherell and Uhlenbeck (1989, Specific RNA binding by Q. beta. coat protein. Biochem., 28(1), 71-76, hereafter “Witherell”) and Bawage et al. (WO2019/204210 A1, hereafter “Bawage”).
With regard to claim 1, Williams teaches a virus-like particle (VLP) encapsulating RNA which is formed by coat proteins, i.e., capsid proteins, of a bacteriophage and one or more RNA polynucleotides where the coat proteins encapsulate the one or more RNAs within the virus particle (Para. [0010], [0042]). Williams teaches that the RNA within the VLP can be from mRNA (Para. [0011]) and that the one or more RNAs comprise a nucleotide sequence which has a high affinity for the capsid proteins which enables packaging of the RNA into the VLP (Para. [0010], [0014], [0046]), which Williams refers to as a “recognition tag” (Paras [0059]-[0060]), i.e. a capsid protein binding tag. Williams teaches that VLPs containing RNAs can be used for delivery of RNA for therapeutics including targeting of infectious diseases. (Para. [0085]) including targeting of RNA of an infectious pathogen (claim 11), and that VLPs can be using in RNA-based gene therapy (Para. [0030]). Williams teaches an embodiment of VLPs using capsid proteins of Q beta (Paras. [0012], [0064]) and that capsid protein binding tags are known in the art, citing Witherell as teaching Q beta capsid protein binding tags. Williams further teaches that the Q beta capsid protein has an amino acid sequence of SEQ ID NO: 4 which comprises the amino acid sequence of SEQ ID NO: 15 (See Para. [0065] and SEQ ID NO: 15 .rnpbm file, result 29, duplicate 10). Therefore, it appears that the instantly disclosed Q beta capsid protein RNA binding motif is present in the amino acid sequence of Q beta capsid protein as taught by Williams.
PNG
media_image1.png
176
764
media_image1.png
Greyscale
Beyond citing Witherell for known Q beta capsid protein binding tags, Williams is silent as to the specific sequence of capsid protein binding tag.
Witherell teaches a variant of Q beta capsid binding tags, fragment 2 having the sequence GGGAATCACATCAGTAACTGAGTGACTTC (See Fig. 7) which has high binding affinity (See Table II). The sequence as taught by Witherell is 100% identical to instantly claimed SEQ ID NO: 1.
Therefore, it would have been obvious to one having ordinary skill in art before the effective filing date of the claimed invention, to choose the Q beta capsid protein binding tag as taught by Witherell in the VLP comprising Q beta coat proteins which encapsulates an RNA comprising a capsid protein binding tag with a reasonable expectation of success. A skilled artisan would have been motivated to choose the capsid protein binding tag as taught by Witherell as Witherell teaches that capsid protein binding tag has high affinity for the Q beta capsid protein. One having ordinary skill in the art would have had a reasonable expectation of success as Williams teaches that capsid protein binding tags are known in the art and cites Witherell as examples.
While the combination of Williams and Witherell teach VLPs encapsulating RNA which can be used to treat infectious diseases, Williams and Witherell are silent as to VLPs comprising an mRNA encoding a Cas13 protein and an RNA comprising a targeting sequence reverse and complementary to a targeting site and a Cas13 protein recognition sequence.
Bawage teaches a composition for inactivation of RNA viruses which comprises a nucleic acid sequence, which can be an mRNA, encoding an RNA guided endonuclease and at least one guide RNA complementary to a target nucleic acid sequence in an RNA viral genome (Pg. 2, last para. and Pg. 10, 2nd para.) Bawage teaches that the RNA-guided endonuclease can be a Cas13 which complexes with guide RNA via a crRNA and that target specificity is determined by a spacer sequence (Pg. 11, 2nd para.). Bawage teaches that the CRISPR/Cas/gRNA system can be used to target any virus (Pg. 18, last para) including RNA viruses such as influenza, respiratory syncytial virus (RSV) (Pg. 3, 2nd para. and Pg. 19, 2nd para.), and coronaviruses (Pg. 20, 2nd full para.) and is effective for targeting and destruction or suppression of the virus in vitro or in vivo (Pg. 9, last para.). Bawage further teaches that the composition can be encapsulated in a liposome for administration (Pg. 22, 2nd para.). Bawage teaches an exemplary embodiment comprising a Cas13a and crRNAs/trRNAs corresponding to influenza virus A and that the crRNAs comprise conserved direct repeats that are specifically recognized by the Cas13a (Example 1). This is considered to reasonably read on a nucleotide sequence comprising a targeting sequence and a Cas13 protein recognition sequence.
Therefore it would have been obvious to one having ordinary skill in the art, before the effective filing date of the claimed invention, to use the CRISPR/Cas/gRNA system comprising a Cas13a protein and a crRNA comprising a Cas13 protein recognition sequence and a targeting sequence for viral diseases such as influenza virus A and RSV (See Examples 1 and 8) as taught by Bawage in the VLP as taught by the combination of Williams and Witherell which can be used to encapsulate mRNA for the treatment of infectious diseases with a reasonable expectation of success. A skilled artisan, would have been motivated to use a the Cas13a-crRNA system as taught by Bawage in the VLP as taught by Williams and Witherell in order to treat viral infectious diseases such as influenza and RSV. One having ordinary skill in the art and would have had a reasonable expectation of success as Williams and Witherell teach that VLPs can be used to encapsulate RNA in order to treat infectious diseases and Bawage teaches that the composition comprising a CRISPR/Cas/gRNA system can be encapsulated in a liposome for therapeutic delivery and used to effectively treat viral respiratory diseases.
With regard to claim 2, Williams teaches that the coat proteins can be from enterobacteria bacteriophage Q beta (Paras. [0012], [0064]), which is considered to reasonably read on capsid proteins derived from Escherichia virus Qbeta.
With regard to claim 3, Williams teaches a nucleotide sequence which encodes a Q beta capsid protein SEQ ID NO: 3 which is 100% identical to instantly claimed SEQ ID NO: 1 (See Para. [0064] and SEQ ID NO: 7 .rnpbm file, result 1, duplicate 1)
PNG
media_image2.png
636
788
media_image2.png
Greyscale
With regard to claim 5, as stated supra, Bawage teaches use of the CRISPR-Cas13 system to target infectious diseases including influenza A and human respiratory syncytial virus (Abstract, see also Table S1), which are considered to reasonably read on a targeted site which is a nucleotide derived from and RNA virus.
With regard to claim 6, as stated supra, Bawage teaches an exemplary embodiment (See Example 1) where the Cas13a crRNA comprises a Cas13 protein recognition sequence which is 100% identical to SEQ ID NO: 6 (Table 1, also see search results SEQ ID NO: 6, .rng file, results 42-45).
PNG
media_image3.png
156
796
media_image3.png
Greyscale
Claim 4 is rejected under 35 U.S.C. 103 as being unpatentable over Williams, Witherell, and Bawage as applied to claim 1 above, and further in view of Pramer (WO 2021/152181, with priority to 1/30/2020).
With regard to claim 4, as detailed above Williams and Witherell teach use of VLPs for encapsulation of therapeutic RNAs which can be used to treat infectious diseases. Bawage teaches a composition for inactivation of RNA viruses which comprises an mRNA encoding an RNA guided endonuclease, which can be a Cas13, and at least one guide RNA which can include a Cas13 protein recognition sequence and a targeting sequence complementary to a target nucleic acid sequence in an RNA viral genome. Bawage teaches that the composition can be encapsulated in a liposome for administration.. Additionally, Bawage teaches that the CRISPR/CAS/guide RNA composition can Bawage teaches that the CRISPR/Cas/gRNA system can be used to target any virus (Pg. 18, last para.) including coronaviruses (Pg. 20, 2nd full para.) and highlights the need for novel method of targeting viral infections based on recent viral outbreaks and threats of future influenza pandemics (Pg. 1, last para.).
Bawage is silent as to use of targeting sequences comprising a nucleotide sequence of SEQ ID NO: 4, both of which appear to be specific to SARS-CoV-2.
Pramer teaches a protein-RNA complex comprising a Cas13 protein and guide RNA which can be used to treat SARS-CoV-2 infection in patients by destruction of virus RNA (Pg. 1, last para.). Pramer teaches the Cas13 protein can be a Cas13a (Pg. 4, 6th para.). Pramer teaches exemplary suitable target sequences which can be used to target SARS-CoV-2 (Pg. 5, last para.) which should also comprise a “direct repeat sequence” which interacts with the Cas13 protein (Pg. 6, lines 18-20), which is considered to reasonably read on a RNA molecule comprising a targeting sequence complementary to a targeted site and which comprises a Cas13 protein recognition sequence. Pramer teaches an exemplary targeting sequence SEQ ID NO: 94 which shares 100% sequence identity to instantly claimed SEQ ID NO: 4 (See Pg. 16 and SEQ ID NO: 4 .rng file, Result 2). Pramer additionally teaches that the complex can be delivered via lipid nanoparticles (Pg. 8, 1st para.).
PNG
media_image4.png
152
748
media_image4.png
Greyscale
Therefore, it would have been obvious to one having ordinary skill in the art, before the effective filing date of the claimed invention to choose SEQ ID NO: 94 as taught by Pramer for use in the RNA-based CRISPR/CAS/guideRNA composition as taught by Bawage with a reasonable expectation of success. A skilled artisan, at the time of the invention, would have been well aware of the COVID-19 pandemic caused by SARS-CoV-2 and the magnitude of global research surrounding development of vaccines and treatments for COVID-19/SARS-CoV-2, and would have been motivated to choose Pramer’s SEQ ID NO: 94 for use in the CRISPR/CAS/guideRNA composition because Pramer teaches SEQ ID NO: 94 corresponds to highly conserved region of the SARS-CoV-2 virus and is suitable for targeting the virus (Pg. 1, last para.). One having ordinary skill in the art would have had a reasonable expectation of success as both Bawage and Pramer teach use of systems comprising a Cas13 protein and a guideRNA having a Cas13 protein recognition sequence and a targeting sequence for use in treating viral infections.
Citation of Pertinent Prior Art
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure: Bawage et al. (2018, Synthetic mRNA expressed Cas13a mitigates RNA virus infections. biorxiv, 370460.
Bawage et al. teaches that a CRISPR-Cas13a system can be used as anti-viral therapeutics for the treatment of infectious diseases such as influenza A (IVA) and human respiratory syncytial virus (hRSV) (Abstract). Bawage teaches use of mRNA encoding Cas13a paired with guide crRNA to target RNA of H1N1 and hRSV A2 (Pg. 1, 2nd para.) and that the crRNA used comprised a conserved direct repeat sequence which is specifically recognized by the Cas13a, which is considered to reasonably read on a Cas13 protein recognition sequence, and an influenza or hRSV virus targeting sequence (Pg. 2, 2nd para). Bawage further teaches use of lipofectamine to deliver the Cas13-crRNA system to cells (Pg. 2, last para.).
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ERIN V PAULUS whose telephone number is (571)272-6301. The examiner can normally be reached Mon-Fri 8 AM-5 PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Doug Schultz can be reached at 571-272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ERIN V PAULUS/Examiner, Art Unit 1631
/ARTHUR S LEONARD/Examiner, Art Unit 1631
Prosecution Insights