Prosecution Insights
Last updated: October 04, 2026
Application No. 18/431,041

Method for Diagnosing and Assessing Endometriosis

Non-Final OA §101§103
Filed
Feb 02, 2024
Priority
Aug 23, 2019 — provisional 62/890,896 +1 more
Examiner
BORGEEST, CHRISTINA M
Art Unit
1675
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Mcmaster University
OA Round
5 (Non-Final)
56%
Grant Probability
Moderate
5-6
OA Rounds
6m
Est. Remaining
77%
With Interview

Examiner Intelligence

Grants 56% of resolved cases
56%
Career Allowance Rate
403 granted / 725 resolved
-4.4% vs TC avg
Strong +21% interview lift
Without
With
+21.4%
Interview Lift
resolved cases with interview
Typical timeline
3y 2m
Avg Prosecution
53 currently pending
Career history
766
Total Applications
across all art units

Statute-Specific Performance

§101
9.1%
-30.9% vs TC avg
§103
26.0%
-14.0% vs TC avg
§102
15.1%
-24.9% vs TC avg
§112
31.8%
-8.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 725 resolved cases

Office Action

§101 §103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Supplemental Office Action The previous Office action, mailed 07/14/2026 is hereby vacated in order to correct an oversight with respect to new claim 16. The examiner regrets any inconvenience to Applicant. Please refer to the PTO-892, references and search summaries that were mailed 07/14/2026. In the amendment filed 04/24/2026, claim 1 is amended, claim 2 is newly canceled and claim 16 is new. Applicant used the status identifier “(Currently Amended)” in claim 15. Note that 37 CFR 1.121 contains guidance for the manner of making amendments to the claims. Specifically, all claims being currently amended in an amendment paper shall be presented in the claim listing, indicate a status of “currently amended,” and be submitted with markings to indicate the changes that have been made relative to the immediate prior version of the claims. The text of any added subject matter must be shown by underlining the added text. The text of any deleted matter must be shown by strike-through except that double brackets placed before and after the deleted characters may be used to show deletion of five or fewer consecutive characters. The text of any deleted subject matter must be shown by being placed within double brackets if strike-through cannot be easily perceived. In the instant case, there are no markings to indicate that claim 15 has been amended. Claims 1, 3, 5-8 and 11-16 are under examination. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. The rejection of claims 1-3 and 5-7 under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception without significantly more is maintained for reasons of record and the following. In addition, new claim 16 is hereby included in this rejection. New claim 16 also recites wherein the expression level of the at least 3 miRNA markers is less than the expression level of corresponding miRNA control samples and detecting the expression level of at least one miRNA reference marker which is stable across biological samples and control samples. This wherein clause requires comparing the miRNA marker expression levels to corresponding controls in order to determine that the expression level is less than that of control. Response to Arguments Applicant argues at p. 5 of the Remarks filed 04/24/2026 the amendment to claim 1 to recite “wherein the mammal is a female with endometriosis” adds significantly more than the judicial exception because prior to the invention, the presence of the claimed miRNA in such a sample was not known and thus, conducting the claimed method would not have been a routine or conventional step. Applicant argues that the previously cited art by Onrat et al. and Chowdhury et al. confirm this because they teach quantifying the expression of miRNA molecules in patients with ischemic cardiomyopathy (IsDC) or idiopathic cardiomyopathy (IdDC) and ovarian cancer, respectively. Applicant argues further at pages 5-6 that the fact patterns Ariosa Diagnostics v. Sequenom Inc. do not map onto those of the instant case because the claimed method relates to detecting specific miRNAs at unconventional levels, i.e. less than control levels, in an unconventional sample, i.e. sample from a female with endometriosis while Sequenom method was detecting DNA within the maternal blood sample that was conventionally present. This argument has been fully considered, but is not found persuasive. Applicant appears to be arguing that since the discovery of the presence of these markers in endometrial samples is novel, this adds significantly more to the judicial exception. See MPEP 2106.04(l), which states: The Supreme Court’s cited rationale for considering even “just discovered” judicial exceptions as exceptions stems from the concern that “without this exception, there would be considerable danger that the grant of patents would ‘tie up’ the use of such tools and thereby ‘inhibit future innovation premised upon them.’” Myriad, 569 U.S. at 589, 106 USPQ2d at 1978-79 (quoting Mayo, 566 U.S. at 86, 101 USPQ2d at 1971). See also Myriad, 569 U.S. at 591, 106 USPQ2d at 1979 (“Groundbreaking, innovative, or even brilliant discovery does not by itself satisfy the §101 inquiry.”). The Federal Circuit has also applied this principle, for example, when holding a concept of using advertising as an exchange or currency to be an abstract idea, despite the patentee’s arguments that the concept was “new”. Ultramercial, Inc. v. Hulu, LLC, 772 F.3d 709, 714-15, 112 USPQ2d 1750, 1753-54 (Fed. Cir. 2014). Cf. Synopsys, Inc. v. Mentor Graphics Corp., 839 F.3d 1138, 1151, 120 USPQ2d 1473, 1483 (Fed. Cir. 2016) (“a new abstract idea is still an abstract idea”). Further, in explaining Prong Two of Step 2A, MPEP 2104.04(II)(A)(2) states patent “eligibility ‘cannot be furnished by the unpatentable law of nature (or natural phenomenon or abstract idea’” itself. While the presence of lower levels of certain miRNAs in endometriosis was not previously known, the existence of lower levels of these miRNAs in endometriosis is a natural phenomenon, and thus their detection is merely claiming the natural phenomena itself, similar to the fact patterns in Sequenom (see also MPEP, 2106.04(c)(I)(C). Applicant argues at p. 6 that because new claim 16 recites detecting specific mRNAs in a sample from a mammal with endometriosis using novel custom primers, this is significantly more than the judicial exception, citing to claim 3 of the hypothetical Julitis example. This argument has been fully considered, but is not found persuasive. The final step in determining whether the claims recite patent eligible subject matter is to consider whether the claims recite additional elements that amount to significantly more than the judicial exception. Claims 6 and 16 recite the primers that are used to detect miRNA expression levels. Nevertheless, these primers were routine and conventional in the art. For instance, Chowdhury et al. teach each of the sequences that correspond to miR-199a-3p, let-7b-5p, miR-17-5p, miR-20a-5p and miR-103a-3p, which share 100% sequence identity with the sequences recited in the instant claims. In addition, Chowdhury et al. teach that these primers “can be reproducibly detected in human serum”. See Table 2, pages 30-36 of Chowdhury and colleagues. The instant specification defines the biological samples as including serum (see paragraph [0018]). Thus, the primers are not novel or custom. Further, the instant specification discloses that “[a]s one of skill in the art will appreciate, the expression level of each biomarker may be determined using one of several techniques established in the art, including methods of quantifying nucleic acids, such as PCR-based techniques, microarrays, gene expression systems, and Northern or Southern blotting techniques” (see p. 5, paragraph [0020]). By using known primers and measuring techniques, Applicant is applying these known elements to a different field-of-use, which the courts have identified do not integrate a judicial exception into a practical application (see MPEP 2106.04(d)(I)). In the instant case, the encompassed detecting steps are simply appending well-understood, routine, conventional activities previously known to the industry, specified at a high level of generality, to the judicial exception (see MPEP 2106.05(d)). Applicant cites to claim 3 of hypothetical Example 29 of the Life Sciences Guidance issued May 2016, in which diagnosis of “julitis” with a porcine anti-JUL-1 antibody is found to be patent eligible. In the May 2016 Guidance, hypothetical claim 3 of Example 29 is deemed patent eligible because the JUL-1 protein is detected in a human plasma sample with a porcine anti-JUL-1 antibody, and the hypothetical specification discloses that porcine anti-JUL-1 antibody was not routinely used to detect human JUL-1 protein. See the explanation at p. 13 of the May 2016 Guidance (2nd paragraph): Step b, however, also requires detecting using a porcine anti-JUL-1 antibody. Prior to applicant’s invention, and at the time the application was filed, the use of porcine antibodies in veterinary therapeutics was known to most scientists in the field. But significantly, there is no evidence that porcine antibodies were routinely or conventionally used to detect human proteins such as JUL-1. Thus, the claim’s recitation of detecting JUL-1 using a porcine antibody is an unconventional step that is more than a mere instruction to “apply” the correlation and critical thinking step (the exception) using well-understood, routine or conventional techniques in the field. In the instant case, the primers are known in the art to be useful for reliably detecting the recited primers in human serum. In contrast, the instantly recited primers were known to be useful for detecting human miRNA in human serum samples. The MPEP 2106.05(I) states that when evaluating eligibility under Step 2B, an inventive concept “cannot be furnished by the unpatentable law of nature (or natural phenomenon or abstract idea) itself”, citing Genetic Techs. Ltd. v. Merial LLC, 818 F.3d 1369, 1376, 118 USPQ2d 1541, 1546 (Fed. Cir. 2016). Finally, the novelty or non-obviousness of the judicial exception is not a consideration when determining whether the instant claims are patentable under 35 USC § 101. In Diamond v. Diehr, 450 U.S. 175, 188-92, 101 S. Ct. 1048, 1058-59, 67 L. Ed. 2d 155 (1981) (Diamond), it stated that “[t]he ‘novelty’ of any element or steps in a process, or even of the process itself, is of no relevance in determining whether the subject matter of a claim falls within the § 101 categories of possibly patentable subject matter”: It has been urged that novelty is an appropriate consideration under § 101. Presumably, this argument results from the language in § 101 referring to any “new and useful” process, machine, etc. Section 101, however, is a general statement of the type of subject matter that is eligible for patent protection “subject to the conditions and requirements of this title.” Specific conditions for patentability follow and § 102 covers in detail the conditions relating to novelty. The question therefore of whether a particular invention is novel is “wholly apart from whether the invention falls into a category of statutory subject matter.” In re Bergy, 596 F.2d 952, 961 (Cust. & Pat. App., 1979). See also Nickola v. Peterson, 580 F.2d 898 (CA6 1978)...[A]n inquiry must be made into whether the claim is seeking patent protection for that formula in the abstract. A mathematical formula as such is not accorded the protection of our patent laws, Gottschalk v. Benson, 409 U.S. 63, 93 S.Ct. 253, 34 L.Ed.2d 273 (1972), and this principle cannot be circumvented by attempting to limit the use of the formula to a particular technological environment. Parker v. Flook, 437 U.S. 584, 98 S.Ct. 2522, 57 L.Ed.2d 451 (1978). Similarly, insignificant post-solution activity will not transform an unpatentable principle into a patentable process. To hold otherwise would allow a competent draftsman to evade the recognized limitations on the type of subject matter eligible for patent protection. In summary, Applicant's recognition of the relationship of a naturally existing correlation between lower levels of certain miRNAs and the presence of endometriosis do not constitute a judicial exception even if the finding is novel. Notice for all US Patent Applications filed on or after March 16, 2013: In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claims 1, 3 and 7 are rejected under 35 U.S.C. 103 as being unpatentable over Wang et al. (Reproductive Sciences 2016, Vol. 23(10) 1359-1370) in view of Nematian et al. (J Clin Endocrinol Metab, January 2018, 103(1):64-74) and Wu et al. (Journal of biological regulators and homeostatic agents, (2016 Jan-Mar) Vol. 30, No. 1, pp. 211-7). The first factor to consider when making a rejection under 35 U.S.C. 103(a) is to determine the scope and contents of the prior art. Wang et al. teach detecting serum levels of miR-20a-5p, among others, using RT-PCR in endometriosis patients (see p. 1360, right column, last paragraph). Wang et al. teach miR-20a-5p levels are lower in endometriosis patients than controls and that all results are normalized to cel-miR-39 levels (see paragraph bridging pages 1360-1361; p. 1364, Table 2). Therefore, Wang et al. teach a method of detecting lower expression levels of miR-20a-5p in the serum of endometriosis sufferers and detecting at least one miRNA reference marker. The second factor to consider is to ascertain the differences between the prior art and the instant claims. Wang et al. do not teach detecting lower levels of two additional recited miRNA markers, for instance, let-7b-5p and miR-17-5p. Nematian et al. teach let-7b-5p levels are lower in the sera of endometriosis patients compared to controls (see abstract; p. 68, Figure 2). In addition, Wu et al. teach lower miRNA-20a and miR-17-5p are lower in the sera of endometriosis patients compared to controls (see p. 213, right column, last paragraph; p. 216, left column, 1st paragraph). It would have been obvious to the person of ordinary skill in the art at the time of the filing of the invention to modify the teachings of Wang et al. by measuring, for instance, let-7b-5p, as taught in Nematian et al. because it was strongly down-regulated in the serum of endometriosis patients, and supplemental let-7b-5p expression decreased the expression of proinflammatory genes, thereby suggesting not only a role for let-7b-5p as a diagnostic biomarker but also a therapeutic target (see p. 68, Figure 2; p. 72, right column; p. 73, left column, last paragraph). Further, it would have been obvious to the person of ordinary skill in the art at the time of the filing of the invention to modify the teachings of Wang et al. by measuring, for instance, miR-17-5p, as taught in Wu et al. because it was strongly down-regulated in the serum of endometriosis patients (see p. 213, right column, last paragraph; p. 216, left column, 1st paragraph). The person of ordinary skill in the art would have been motivated to add let-7b-5p and miR-17-5p to the list of measured miRNAs because of their significant decline in sera from endometriosis patients and because adding biomarkers could generally be expected to increase the sensitivity and specificity of a potential diagnostic test. Wang et al. also suggest that sera may be a more reliable sample because previous studies measuring miRNAs in endometria had less consistency (see p. 1366, right column, 1st paragraph). Furthermore, the person of ordinary skill in the art could have reasonably expected success because Wang et al. teach miRNAs are stable in serum, and measuring them is noninvasive (see p. 1363, right column, 2nd full paragraph). Wang et al. state in this passage: “[t]he obviously differential expression pattern between physiological and pathological status in specific disease could make miRNAs promising biomarkers for diagnosis”. Thus, the claims do not contribute anything non-obvious over the prior art. Claims 6 and 16 are rejected under 35 U.S.C. 103 as being unpatentable over Wang et al., Nematian et al. and Wu et al. as applied to claims 1, 3 and 7 above, and further in view of Chowdhury et al. (WO2018129535—of record). The first factor to consider when making a rejection under 35 U.S.C. 103(a) is to determine the scope and contents of the prior art. The combined teachings of Wang et al., Nematian et al. and Wu et al. and how they meet the limitations of claims 1, 3 and 7 are outlined above in the preceding rejection and are hereby incorporated. The second factor to consider is to ascertain the differences between the prior art and the instant claims. The combined teachings of Wang et al., Nematian et al. and Wu et al. do not disclose the primers used to measure miR-20a-5p, let-7b-5p and miR-17-5p. Chowdhury et al. teach the primer UAAAGUGCUUAUAGUGCAGGUAG can be used to measure miR-20a-5p, the primer UGAGGUAGUAGGUUGUGUGGUU can be used to measure let-7b-5p and the primer CAAAGUGCUUACAGUGCAGGUAG can be used to measure miR-17-5p (see p. 31, Table 2). The primers for miR-20a-5p, let-7b-5p and miR-17-5p disclosed in Chowdhury et al. share 100% sequence identity with instant SEQ ID NOs: 5, 2 and 4, respectively. It would have been obvious to the person of ordinary skill at the time of the filing of the invention to modify the combined teachings of Wang et al., Nematian et al. and Wu et al. by using the primers taught in Chowdhury et al. because Chowdhury and colleagues teach that the primers can be used to “reproducibly” detect miR-20a-5p, let-7b-5p and miR-17-5p in serum (see p. 31, Table 2). The person of ordinary skill in the art would have been motivated to use published primer sequences for measuring the requisite miRNAs in serum because they have already been shown to be effective therefor. For this reason, as well, the person of ordinary skill in the art could have reasonably expected success. Thus, the claims do not contribute anything non-obvious over the prior art. Conclusion Claims 1-3, 5-7 and 16 are rejected and claims 8 and 11-15 are allowed. The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. Ramón et al. (Human Reproduction, Vol.26, No.5 pp. 1082-1090, 2011) teach lower expression of miR-17-5p and miR-20a-5p than controls in endometrial biopsies from endometriosis patients compared to controls, though miR-21-5p levels were higher in endometriosis patients than controls (see abstract; p. 1083, right column, last paragraph; p. 1085, Figure 2). Park et al. (Reproductive Sciences, 2018, Vol. 25(2) 292-301) also teach that miR-21-5p levels are higher in the endometrial cells of those with endometriosis compared to controls (see abstract; p. 297, right column, 1st paragraph). Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA M BORGEEST whose telephone number is (571)272-4482. The examiner can normally be reached M-F 9-5:30 EDT. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jeffrey Stucker can be reached at 5712720911. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /CHRISTINA M BORGEEST/Primary Examiner, Art Unit 1675
Read full office action

Prosecution Timeline

Show 6 earlier events
Oct 31, 2025
Response Filed
Dec 29, 2025
Final Rejection mailed — §101, §103
Apr 21, 2026
Applicant Interview (Telephonic)
Apr 22, 2026
Examiner Interview Summary
Jun 19, 2026
Request for Continued Examination
Jun 23, 2026
Response after Non-Final Action
Jul 14, 2026
Non-Final Rejection mailed — §101, §103
Jul 21, 2026
Non-Final Rejection mailed — §101, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12747282
Process for Preparing Immunoglobulin Compositions
4y 5m to grant Granted Sep 29, 2026
Patent 12742764
METHODS FOR PREDICTING CANCER DRUG RESPONSIVENESS
6y 2m to grant Granted Sep 22, 2026
Patent 12742012
HUMANIZED ANTI-TRKA ANTIBODIES AND USES THEREOF
4y 0m to grant Granted Sep 22, 2026
Patent 12723070
ANTIBODY SPECIFICALLY BINDING TO STREP-TAG II TAG AND USE THEREOF
3y 2m to grant Granted Sep 01, 2026
Patent 12715908
TAU EPITOPE AND BINDING MOLECULES
4y 8m to grant Granted Aug 25, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

5-6
Expected OA Rounds
56%
Grant Probability
77%
With Interview (+21.4%)
3y 2m (~6m remaining)
Median Time to Grant
High
PTA Risk
Based on 725 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month