Prosecution Insights
Last updated: October 04, 2026
Application No. 18/432,678

METHOD FOR DETECTING CD19 EXPRESSION

Non-Final OA §101§103§112
Filed
Feb 05, 2024
Priority
Apr 18, 2023 — CN 202310413024.9
Examiner
HANEY, AMANDA MARIE
Art Unit
1682
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
UNION HOSPITAL, TONGJI MEDICAL COLLEGE, HUAZHONG UNIVERSITY OF SCIENCE AND TECHNOLOGY
OA Round
1 (Non-Final)
36%
Grant Probability
At Risk
1-2
OA Rounds
10m
Est. Remaining
81%
With Interview

Examiner Intelligence

Grants only 36% of cases
36%
Career Allowance Rate
262 granted / 720 resolved
-23.6% vs TC avg
Strong +45% interview lift
Without
With
+44.9%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
53 currently pending
Career history
782
Total Applications
across all art units

Statute-Specific Performance

§101
23.1%
-16.9% vs TC avg
§103
23.6%
-16.4% vs TC avg
§102
10.2%
-29.8% vs TC avg
§112
32.6%
-7.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 720 resolved cases

Office Action

§101 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status 1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . 2. Applicant’s election without traverse of Invention I in the reply filed on May 26, 2026 is acknowledged. Claims 1-2 and 4-9 are currently pending and have been examined herein. Claim Objections 3. Claims 4-9 are objected to because of the following informalities: the claims are grammatically incorrect. The preamble of each claim recites “in a tumor patient underwent an anti-CD19 CAR-T cell therapy”. This should say “in a tumor patient who has received anti-CD19 CAR-T cell therapy”. Appropriate correction is required. Claim Rejections - 35 USC § 101 4. 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 1-2 are rejected under 35 U.S.C. 101 because the claimed invention is directed to non-statutory subject matter. The claim(s) does/do not fall within at least one of the four categories of patent eligible subject matter. Claims 1-2 are drawn to a method of using a primer combination in the preparation of a product for detecting a prognostic effect of an anti-CD19 chimeric antigen receptor (CAR)-T cell therapy in a tumor. The claim defines the primers but fails to provide any active process steps of the method. MPEP 2173.05(q) provides that “use” claims that do not purport to claim a process, machine, manufacture, or composition of matter fail to comply with 101 because a “use” is not among the categories of patentable inventions specified in 101. Claim Rejections - 35 USC § 112 5. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-2 and 4-9 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claims 1-2 and 4-9 are generally narrative and indefinite, failing to conform with current U.S. practice. They appear to be a literal translation into English from a foreign document and are replete with grammatical and idiomatic errors. Claims 1-2 are drawn to a method of using a primer combination in the preparation of a product for detecting a prognostic effect of an anti-CD19 chimeric antigen receptor (CAR)-T cell therapy in a tumor. The claim defines the primers but fails to provide any active process steps of the method. Therefore it is entirely unclear what steps are required to be practiced in order to meet the claimed invention. Dependent claim 2 additionally does not recite any active process steps. Claims 1-2 recite that the primer combination comprises a primer and 4 primer pairs as follows: PNG media_image1.png 428 722 media_image1.png Greyscale In the instant case the Table contains more information than the sequences of the primer and primer pairs (i.e., serial number, names, orientation). In the instant case, it is unclear how much weight, if any, this additional information should be given when examining the claim. For example it is unclear if a primer having the same sequence as SEQ ID NO: 1 would meet this limitation if the primer was not called “Reverse transcription primer GSP19”. Clarification is requested. Claims 4-9 are rejected over the recitation of the following: “S1, extracting ribonucleic acid (RNA) from a bone marrow sample and synthesizing complementary deoxyribonucleic acid (cDNA): extracting total RNA from the bone marrow sample of a patient, and determining a concentration and an A260/280 value of the total RNA; and subjecting the total RNA to reverse transcription using a specific primer GSP19 of 5'-AAGTGTCACTGGCATGTATACAC-3' (SEQ ID NO: 1) to obtain a cDNA stock solution, and determining a concentration and an A260/280 value of the cDNA stock solution” The claims are rejected as being indefinite because it is unclear whether the limitation(s) following the “:” are part of the claimed invention OR if they are just an example of how the recitation of extracting RNA from a bone marrow sample and synthesizing cDNA could be met. Clarification is required. Claims 4-9 are rejected over the recitation of the following: S2, conducting polymerase chain reaction (PCR) amplification and quantitative real-time PCR (qRT-PCR): mixing primer pair J13, primer pair EX34, and primer pair EX45 in a reaction system in a kit to obtain a mixture, centrifuging the mixture, aliquoting the mixture into a well plate for the qRT-PCR, adding a template cDNA into the well plate, centrifuging the well plate, conducting the PCR amplification, and monitoring a result of the qRT-PCR; The claims are rejected as being indefinite because it is unclear whether the limitation(s) following the “:” are part of the claimed invention OR if they are just an example of how the recitation of conducting PCR and qRT-PCR could be met. Clarification is required. Claims 4-9 are indefinite over the recitation of the phrase “mixing primer pair J13, primer pair EX34, and primer pair EX45 in a reaction system in a kit”. This phrase is confusing because it’s unclear if the mixing is actually occurring inside of a kit OR if the kit comprises some sort of container, i.e., test tube and the primers are mixed in the container. Clarification is required. Claims 4-9 recites “sequences of amplification primer pairs are shown in the following: PNG media_image2.png 412 736 media_image2.png Greyscale In the instant case the Table contains more information than the sequences of the primers (i.e., serial number, amplification region, primer pair names, orientation, primer name). In the instant case, it is unclear how much weight, if any, this additional information should be given when examining the claim. For example it is unclear if a primer having the same sequence as SEQ ID NO: 2 would meet this limitation if the primer was not called “EX34-F”. Further the inclusion of SEQ ID NOs: 8 and 9 in the Table is confusing because in step S2 only requires mixing primer pairs J13, EX34, and EX45. Clarification is requested. Claims 4-9 recite “S3, obtaining cycle threshold (CT) values of multiple duplicates of an amplification curve of each of the amplification primer pairs according to an effective amplification result of the qRT-PCR”. Here it is unclear what is encompassed by “each of the amplification primer pairs”. Does this mean all of the amplification primer pairs that are in the Table recited in S2 (including pair H) or if this only includes primer pairs J13, EX34, and EX45. Claims 4-9 recite “averaging the CT values of the multiple duplicates of the amplification curve of each of the amplification primer pairs, calculating Act according to a formula II with an internal reference HPRT1 or an amplification curve of CD19exon3-4 as a control; and calculating a level of a target CD19 mRNA by a 2-Act relative quantification method according to formulas III and IV; wherein formula I: MEANct(X)=(ct(duplicate 1X)+ct(duplicate 2X)+...+ct(duplicate nX))/n, formula II: Act (target mRNA)=MEANct (target mRNA)-MEANct (internal reference), formula III: relative expression level (fold-change)=2`(-Act (target mRNA)), and formula IV: MEANct (target mRNA)=(ct(duplicate 1 target RNA)+ct(duplicate 2 target RNA)+ +ct(duplicate n target RNA))/n. In the instant case these formulas are considered indefinite because it is unclear what “X” is. Claim 7 recites “using the forward amplification primer and the reverse amplification primer in S2”. This recitation is confusing because it’s not clear which forward and reverse amplification primer is being used since S2 recites four different primer pairs. Clarification is required. Claim Rejections - 35 USC § 103 6. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. 7. Claims 1-2 are rejected under 35 U.S.C. 103 as being unpatentable over Fischer (J Immunology Vol 40 No 5 June 2017) in view of Sotillo (Cancer Discovery 12/2015 5(12) pages 1282-1295). Regarding Claim 1 Fischer teaches preparing a sample of cDNA by performing a reverse transcription reaction using a reverse CD19 primer (5′AAGTGTCACTGGCATGTATACAC) and a reverse HRPT1 primer (page 188, col 2). It is noted that the reverse CD19 primer is 100% identical to SEQ ID NO: 1. Fisher then teaches performing PCR and qRT-PCR on the cDNA. For the qRT-PCR assay, Fischer used (i) a first primer pair to detect the ex2part-isoform of CD19 comprising a forward primer (5′GCCTCCTCTTCTTCCTCCTCTT) and a reverse primer (5′CCGGAACAGCTCCCCTTCCACCTTC) and (ii) a second primer pair to detect HRPT1 comprising a forward primer (5′TGACACTGGCAAAACAATGCA) and a reverse primer (5′GGTCCTTTTCACCAGCAA). It is noted that these primers are 100% identical to SEQ ID NOs: 6-9. Thus Fischer teaches a method of using a primer combination wherein the primers are SEQ ID NOs: 1 and 6-9. Fischer does not teach a method further comprising using the primers of SEQ ID NOs: 2-5. However Sotillo teaches qRT-PCR analysis of CD19. Sotillo discloses that the following pairs of oligos were used. PNG media_image3.png 179 644 media_image3.png Greyscale It is noted that these primers are 100% identical to SEQ ID NOs: 2-5. Accordingly, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the method of Fischer by further using the primers of SEQ ID NOs: 2-5 as suggested by Sotillo. One of skill in the art would have been motivated to add additional primers for the benefit of being able to detect additional CD19 isoforms. The recitation in claim 1 that the primer combination is used in the “preparation of a product for detecting a prognostic effect of an anti-CD 19 chimeric antigen receptor (CAR)-T cell therapy in a tumor”, does not limit the scope of the claims because it merely recites the intended use of the method without requiring any active process steps. Regarding Claim 2, the claim states that the primer combination is used to “detect an expression abundance of CD19 on a surface of a tumor cell and/or to detect a proportion of alternatively spliced isoforms in CD 19 messenger ribonucleic acid (mRNA)”, does not limit the scope of the claims because it merely recites the intended use of the method without requiring any active process steps. 8. Claims 4-7 are rejected under 35 U.S.C. 103 as being unpatentable over Fischer (J Immunology Vol 40 No 5 June 2017) in view of Sotillo (Cancer Discovery 12/2015 5(12) pages 1282-1295) and Qiagen (QuantiFast SYBR Green RT-PCR Handbook July 2011). MPEP 2111.02 states that “If the body of a claim fully and intrinsically sets forth all of the limitations of the claimed invention, and the preamble merely states, for example, the purpose or intended use of the invention, rather than any distinct definition of any of the claimed invention’s limitations, then the preamble is not considered a limitation and is of no significance to claim construction.” In the present situation, the process steps are able to stand alone and the preamble limitation is not accorded patentable weight. Accordingly, the claim language of “A method for detecting an expression state of CD19 in a tumor patient underwent an anti-CD 19 CAR-T cell therapy”, merely sets forth the purpose of the process, but does not limit the scope of the claims. Regarding Claim 4 Fischer teaches that total RNA was isolated from bone marrow. RNA concentration was measured by Nanodrop 2000. Quality control was performed by the RNA 6000 Nano Assay. cDNA was prepared by reverse transcription using a reverse CD19 primer (5’ AAGTGTCACTGGCATGTATACAC) and a reverse HPRT1 primer (page 188, col 2). It is noted that the reverse CD19 primer is 100% identical to SEQ ID NO: 1. Thus Fischer teaches a method comprising: S1 extracting ribonucleic acid (RNA) from a bone marrow sample and synthesizing complementary deoxyribonucleic acid (cDNA): extracting total RNA from the bone marrow sample of a patient, and determining a concentration of the total RNA; and subjecting the total RNA to reverse transcription using primer 5'-AAGTGTCACTGGCATGTATACAC-3' (SEQ ID NO: 1) to obtain a cDNA stock ∆solution. Fisher then teaches performing PCR and qRT-PCR on the cDNA. For the qRT-PCR assay, Fischer used (i) a primer pair to detect the ∆ex2-isoform of CD19; (ii) a primer pair to detect the ex2part-isoform of CD19 comprising a forward primer (5′GCCTCCTCTTCTTCCTCCTCTT) and a reverse primer (5′CCGGAACAGCTCCCCTTCCACCTTC) and (iii) a primer pair to detect HRPT1 comprising a forward primer (5′TGACACTGGCAAAACAATGCA) and a reverse primer (5′GGTCCTTTTCACCAGCAA) (page 188, col 2). It is noted that these primers are 100% identical to SEQ ID NOs: 6-9. After normalization to the housekeeping gene HPRT1, the relative quantification value was expressed as 2-∆∆Ct. Thus Fischer teaches a method of using a primer combination wherein the primers are SEQ ID NOs: 1 and 6-9. Thus Fisher teaches a method comprising: S2, conducting polymerase chain reaction (PCR) amplification and quantitative real-time PCR (qRT-PCR): contacting primer pair J13 (SEQ ID NOs: 6-7) with template cDNA from the cDNA stock solution, conducting PCR amplification, and monitoring the results of the qRT-PCR. S3, obtaining cycle threshold (CT) values and calculating a level of target CD19 mRNA by a relative quantification method. Fischer does not teach a method further comprising using primer pair EX34 (SEQ ID NOs: 2-3) and primer pair EX45 (SEQ ID NOs: 4-5). However Sotillo teaches qRT-PCR analysis of CD19. Sotillo discloses that the following pairs of oligos were used. PNG media_image3.png 179 644 media_image3.png Greyscale It is noted that these primers are 100% identical to SEQ ID NOs: 2-3 and 4-5. Accordingly, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the method of Fischer by further using the primers of SEQ ID NOs: 2-5 as suggested by Sotillo. One of skill in the art would have been motivated to add additional primer pairs for the benefit of being able to detect additional CD19 isoforms. The combined references do not teach a method further comprising determining (i) the A260/280 value of the RNA and (i) the A260/280 value of the cDNA (clm 4, S1). However Qiagen teaches that the concentration and purity of RNA/DNA can be determined by measuring the absorbance in a spectrophotometer. The ratio between the absorbance values at 260 nm and 280 nm gives an estimate of the purity. Pure samples have a A260/A280 ratio of 1.9–2.1. Lower ratios indicate the presence of contaminants such as proteins. Note that absorbance measurements cannot discriminate between DNA and RNA. (page 18). Accordingly, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the method of Fischer and Sotillo by determining the A260/280 value of the RNA and cDNA as suggested by Illumibna. One of skill in the art would have been motivated to determine the A260/280 value for the benefit of being able to determine purity and detect the presence of contaminants. The combined references do not teach mixing the primer pairs and template cDNA by centrifugation of a well plate (clm 4, S2). However Qiagen teaches well plates can be centrifuged (page 34). Accordingly, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the method of Fischer and Sotillo by determining centrifuging the well plate being used for PCR as suggested by Illumibna. One of skill in the art would have been motivated to centrifuge the well plate being used for PCR for the benefit of being able to pull down liquid to the bottom of the wells and remove bubbles. The combined references do not teach calculating a level of target mRNA by a 2-∆Ct method (clm 4, step S3). However Qiagen teaches that if the amplification efficiencies of the target and reference genes are the same, only the standard curve for the reference gene needs to be generated. The amounts of the target and reference genes are determined by comparing their CT values with this standard curve. Alternatively, the comparative or ΔΔCT method can be used. This involves comparing CT values, and does not require preparation of standard curves. This method can only be used if the amplification efficiencies of the target and reference genes are nearly equivalent (page 25). Accordingly, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the method of Fischer and Sotillo by calculating a level of target mRNA by a 2-∆Ct method as suggested by Qiagen. The claim would have been obvious because the substitution of one known method for calculasting the level of mRNA (2-∆∆Ct) for another known method (2-∆Ct) would have yielded predictable results to one of ordinary skill in the art at the time of the invention. Regarding Claim 5 Fischer teaches expression of the CD19 ex2part-isoform, the ∆ex2-isoform, and CD19 ex8–9 in pediatric patients and controls (C) and adult patients (E) was analyzed by qRT-PCR. The percentage of the expression of the isoforms relative to CD19 ex8–9 is shown (see Fig 1). Thus Fisher teaches a method further comprising determining a proportion of expression levels of different alternatively spliced isoforms of CD19 mRNA. The combined references do not teach that the qRT-PCR in step S2 comprises: 1) initial denaturation at 95°C, 2) denaturation at 95°C and annealing at 60°C, 40 cycles, 3) melt curve, denaturation at 95°C, annealing at 58°C to 62°C, and denaturation at 95°C (clm 5). However Qiagen discloses the following Real Time Cycler Conditions: PNG media_image4.png 556 680 media_image4.png Greyscale Qiagen teaches that to carry out melting curve analysis, the temperature is increased very slowly from a low temperature (e.g., 65ºC) to a high temperature (e.g., 95ºC). At low temperatures, all PCR products are double stranded, so SYBR Green I binds to them and fluorescence is high, whereas at high temperatures, PCR products are denatured, resulting in rapid decreases in fluorescence (page 33). Accordingly, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the method of Fischer and Sotillo by using the PCR and melting curve analysis temperatures disclosed by Qiagen. In the instant case one of skill in the art would have been motivated to use the recited temperatures since these temperatures were known in the prior art to successfully perform these methods. 9. Claim 6 is rejected under 35 U.S.C. 103 as being unpatentable over Fischer (J Immunology Vol 40 No 5 June 2017) in view of Sotillo (Cancer Discovery 12/2015 5(12) pages 1282-1295) and Qiagen (QuantiFast SYBR Green RT-PCR Handbook July 2011) as applied to claim 4 and in further view of Andersen (US 2004/0175733 9/9/2004). The teachings of Fischer, Sotillo, and Qiagen are presented above. Regarding Claim 6 the combined references do not teach reaction system wherein the primer pair J13 has a final concentration of 200 nM, the primer pair EX34 and the primer pair EX45 each have a final concentration of 100 nM, and the cDNA stock solution has a final concentration of 100 ng/µL. However Andersen teaches methods for performing nucleic acid amplification. Anderson teaches that amplification primers can be used at concentrations in the range of about 30-900 nM each primer. Different amplification primer pairs may be present at different concentrations within this range or, alternatively, some or all of the amplification primers may be present at approximately equimolar concentrations within this range (para 0067). Further Anderson teaches that the cDNA template may be 100 ng (para 0104). Accordingly, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the method of Fischer, Sotillo, and Qiagen by using primers having the claimed concentrations to amplify 100 ng of template cDNA as suggested by Andersen. To have determined the optimum concentration of primers would have been obvious to one of ordinary skill in the art and well within the skill of the art. As discussed in MPEP 2144.05(b), “(w)here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. In re Aller, 220 F.2d 454, 105 USPQ 233, 235 (CCPA 1955). MPEP 2144.05(b): “Generally, differences in concentration or temperature will not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration or temperature is critical. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955)” “A particular parameter must first be recognized as a result-effective variable, i.e., a variable which achieves a recognized result, before the determination of the optimum or workable ranges of said variable might be characterized as routine experimentation. In re Antonie, 559 F.2d 618, 195 USPQ 6 (CCPA 1977).” 10. Claim 7 is rejected under 35 U.S.C. 103 as being unpatentable over Fischer (J Immunology Vol 40 No 5 June 2017) in view of Sotillo (Cancer Discovery 12/2015 5(12) pages 1282-1295) and Qiagen (QuantiFast SYBR Green RT-PCR Handbook July 2011) as applied to claims 4 and 5 above and in further view of Andersen (US 2004/0175733 9/9/2004). Regarding Claim 7 Fischer does not teach a method further comprising using primer pair CD19exon1-4 (SEQ ID NOs: 14-15). However Sotillo teaches qRT-PCR analysis of CD19. Sotillo discloses that the following pairs of oligos were used. PNG media_image5.png 179 644 media_image5.png Greyscale It is noted that the primers with the arrows are 100% identical to SEQ ID NOs: 14-15. Accordingly, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the method of Fischer by further using the primers of SEQ ID NOs: 14-15 as suggested by Sotillo. One of skill in the art would have been motivated to add additional primer pairs for the benefit of being able to detect additional CD19 isoforms. Fisher does not teach subjecting a product obtained from the PCR amplification in step S4 to 1.5% agarose gel electrophoresis, determining a band and cutting a gel containing the band to allow purification, conducting bidirectional first-generation sequencing (clm 7). However Sotillo teaches that CD19 mRNA isoforms were visualized in 1% agarose gels after semiquantitative PCR amplification of cDNA. When required, individual bands were gel-purified (QIAquick Gel Extraction Kit; Qiagen) and Sanger sequenced (page 1293, col 2). Accordingly, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the method of Fischer by further sequencing the isoforms as suggested by Sotillo. One of skill in the art would have been motivated to sequence the isoforms for the benefit of being able to verify the nucleotide sequence of the amplicon. The combined references do not teach a reaction system comprising the CD19exonl-4 amplification primer pair with a final concentration of 400 nM, 2 pL to 5 pL of the cDNA stock solution synthesized in step S1 as the template cDNA, and a 2xTaq master mix DNA polymerase (clm 7). However Andersen teaches methods for performing nucleic acid amplification. Anderson teaches that amplification primers can be used at concentrations in the range of about 30-900 nM each primer. Different amplification primer pairs may be present at different concentrations within this range or, alternatively, some or all of the amplification primers may be present at approximately equimolar concentrations within this range (para 0067). Further Andersen teaches that the cDNA template may be 5µl (para 0104). Finally Andersen teaches amplification with 2x TaqMan Universal PCR Master Mix that comprises AmpliTaq Gold DNA polymerase (para 0104, 0057). Accordingly, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the method of Fischer, Sotillo, and Qiagen by using primers having the claimed concentrations to amplify 5µl of template cDNA using a 2x TaqMan Mastermix as suggested by Andersen. To have determined the optimum concentration of primers, cDNA template, and polymerase would have been obvious to one of ordinary skill in the art and well within the skill of the art. As discussed in MPEP 2144.05(b), “(w)here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. In re Aller, 220 F.2d 454, 105 USPQ 233, 235 (CCPA 1955). MPEP 2144.05(b): “Generally, differences in concentration or temperature will not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration or temperature is critical. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955)” “A particular parameter must first be recognized as a result-effective variable, i.e., a variable which achieves a recognized result, before the determination of the optimum or workable ranges of said variable might be characterized as routine experimentation. In re Antonie, 559 F.2d 618, 195 USPQ 6 (CCPA 1977).” The combination of Fischer and Sotillo do not teach a PCR amplification comprises: initial denaturation at 95°C; denaturation at 95°C, annealing at 58°C to 62°C, and extension at 72°C, 35 cycles (clm 7). However Qiagen discloses the following Real Time Cycler Conditions: PNG media_image4.png 556 680 media_image4.png Greyscale Accordingly, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the method of Fischer, Sotillo by carrying out the PCR amplification at the claimed temperatures and number of cycles as suggested by Qiagen. To have determined the optimum cycler conditions would have been obvious to one of ordinary skill in the art and well within the skill of the art. As discussed in MPEP 2144.05(b), “(w)here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. In re Aller, 220 F.2d 454, 105 USPQ 233, 235 (CCPA 1955). MPEP 2144.05(b): “Generally, differences in concentration or temperature will not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration or temperature is critical. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955)” “A particular parameter must first be recognized as a result-effective variable, i.e., a variable which achieves a recognized result, before the determination of the optimum or workable ranges of said variable might be characterized as routine experimentation. In re Antonie, 559 F.2d 618, 195 USPQ 6 (CCPA 1977).” Allowable Subject Matter 11. The prior art does not appear to teach or suggest a method further comprising amplification of hPAX5 using primer pair P (SEQ ID NOs: 10 and 11) as recited in claim 8. 13. Any inquiry concerning this communication or earlier communications from the examiner should be directed to AMANDA HANEY whose telephone number is (571)272-8668. The examiner can normally be reached Monday-Friday, 8:15am-4:45pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Wu-Cheng Shen can be reached at 571-272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /AMANDA HANEY/ Primary Examiner, Art Unit 1682
Read full office action

Prosecution Timeline

Feb 05, 2024
Application Filed
Mar 19, 2024
Response after Non-Final Action
Aug 05, 2026
Non-Final Rejection mailed — §101, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12747478
COMPOSITIONS AND METHODS FOR CANCER DIAGNOSIS AND PROGNOSIS
5y 1m to grant Granted Sep 29, 2026
Patent 12735745
FUS/TLS-BASED COMPOUNDS AND METHODS FOR DIAGNOSIS, TREATMENT AND PREVENTION OF AMYOTROPHIC LATERAL SCLEROSIS AND RELATED MOTOR NEURON DISEASES
5y 3m to grant Granted Sep 15, 2026
Patent 12698528
Assemblies
5y 6m to grant Granted Aug 04, 2026
Patent 12577612
DEVICES AND METHOD FOR DETECTING AN AMPLIFICATION EVENT
5y 3m to grant Granted Mar 17, 2026
Patent 12546786
CIRCULATORY BIOMARKERS FOR PLACENTAL OR FETAL HEALTH
5y 2m to grant Granted Feb 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
36%
Grant Probability
81%
With Interview (+44.9%)
3y 6m (~10m remaining)
Median Time to Grant
Low
PTA Risk
Based on 720 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month