Prosecution Insights
Last updated: July 17, 2026
Application No. 18/437,991

MYCOBACTERIUM TUBERCULOSIS (Mtb) ADENOSINE TRIPHOSPHATE (ATP) SYNTHASE-EXPRESSING RECOMBINANT BACTERIUM, AND CONSTRUCTION METHOD AND EXPRESSION METHOD THEREOF

Non-Final OA §103§112
Filed
Feb 09, 2024
Priority
Apr 27, 2023 — CN 202310468268.7
Examiner
ZEMAN, ROBERT A
Art Unit
1645
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Nankai University
OA Round
1 (Non-Final)
54%
Grant Probability
Moderate
1-2
OA Rounds
1y 2m
Est. Remaining
82%
With Interview

Examiner Intelligence

Grants 54% of resolved cases
54%
Career Allowance Rate
420 granted / 777 resolved
-5.9% vs TC avg
Strong +28% interview lift
Without
With
+27.9%
Interview Lift
resolved cases with interview
Typical timeline
3y 8m
Avg Prosecution
44 currently pending
Career history
836
Total Applications
across all art units

Statute-Specific Performance

§101
1.4%
-38.6% vs TC avg
§103
34.6%
-5.4% vs TC avg
§102
16.6%
-23.4% vs TC avg
§112
45.3%
+5.3% vs TC avg
Black line = Tech Center average estimate • Based on career data from 777 resolved cases

Office Action

§103 §112
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Election/Restrictions Applicant’s election without traverse of Group I in the reply filed on 1-27-2026 is acknowledged. Claims 1-20 are pending. Claims 8-20 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Claims 1-7 are currently under examination. Information Disclosure Statement To date no Information Disclosure Statement has been filed in this application. Applicant is reminded that the listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-7 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. With respect to claim 1, the preamble should be amended to clearly recite the goal of the method. It is suggested that language similar to the be used instead to properly reflect the invention. “A method of constructing a Mycobacterium tuberculosis (Mtb) adenosine triphosphate (ATP) synthase-expressing recombinant Mycobacteria smegmatis (Msm) bacterium, comprising the following steps:…” With respect to claim 1, step 1, the metes and bounds of the phrase “…an Mtb ATP synthase gene cluster with an affinity purification tag” are unclear with respect to which open reading frame of the gene cluster has the affinity purification tag attached. The ATP synthase gene cluster in mycobacteria comprises at least 7 separate genes or open reading frames encoding differing subunits of the overall synthase complex. This recitation fails to particularly point out and distinctly claim whether all the genes are included, and further it is unclear which gene of the cluster is intended to be used in subsequent purifications of the expressed complex, and to which gene the affinity purification tag should be attached. With respect to claim 1, step 1, the metes and bounds of the phrase “Msm competent cell” are unclear. This limitation fails to particularly point out and distinctly claim what makes a Msm strain competent in the context of the remaining steps of the method. While this appears to refer to Msm strains known in the art to be permissive for uptake of plasmids, homologous recombination, or recombineering (such as the strain known as mc2155), the claim is not clearly limited to this interpretation and it is unclear what other Msm strains would be useful or competent to carry out the claimed method. With respect to claim 1, step 1, it is unclear if the Mtb ATP synthase gene cluster is to be incorporated into the “auxiliary gene knockout plasmid” which is present in the Msm competent strain as recited. While a reading of the specification suggests the Mtb ATP synthase gene cluster is present on a separate plasmid (Plasmid A), which is used to transform the mc2155, which already contains the auxiliary gene knockout plasmid pJV53; the claim is not limited to this interpretation, and it is unclear the method would be able to be carried out as written. With respect to claim 1, step 1, the metes and bounds of “a strain a” are unclear. Grammatically, this should be changed to “an isolate of strain a”, as “a strain” is a collective noun, representing a multiplicity of mycobacterial cells. This applies to every strain created in claim 1. Claim 1 is rendered vague and indefinite by the use of the term “strain a” in claim 1, step 1. The term “strain a” is not a recognized term of the prior art for transformed strains of mycobacteria, and this limitation fails to specifically describe the necessary and sufficient genes which characterize “strain a”. It is suggested that Applicant identify the elements of “strain a” in an art-recognized manner, which lists what is necessary, what has been added, or what has been deleted from the base strain, such as: Msm mc2155:: MtbATP+ :: MsmATP+ :: StrR+ :: KanR+, or other similar description. With respect to claim 1 step 2, the metes and bounds of “Msm ATP synthase genome in the strain a” are unclear. It would appear this should read “Msm ATP synthase gene cluster in strain a to obtain an isolate of strain b;” The whole genome of the Msm is not knocked out, merely the gene cluster, and “a strain” is a collective noun, representing a multiplicity of mycobacterial cells. Claim 1 is rendered vague and indefinite by the use of the term “strain b” in claim 1, step 2. The term “strain b” is not a recognized term of the prior art for transformed strains of mycobacteria, and this limitation fails to specifically describe the necessary and sufficient genes which characterize “strain b”. It is suggested that Applicant identify the elements of “strain b” in an art-recognized manner, which lists what is necessary, what has been added, or what has been deleted from the base strain, such as: Msm mc2155:: MtbATP+ :: MsmATP- :: HygR+ :: StrR+ :: KanR+, or other similar description. Claim 1 is rendered vague and indefinite by the use of the term "repeated subculture" in claim 1, step 3. Said term is a relative term which renders the claim indefinite. The term "repeated" is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. Further in this step, it appears “kanamycin resistance-free plate” should read “kanamycin-free plate” as the plate does not comprise the antibiotic compound known as kanamycin, and does not refer to the presence or absence of the kanamycin resistance gene itself in the plate media. With respect to claim 1 step 3, the phrase “to obtain a strain c” should read “to obtain an isolate of strain c…” Claim 1 is rendered vague and indefinite by the use of the term “stain c”. “Strain c” is not a recognized term of the prior art, nor does it specifically describe the required elements for Strain c. It is suggested that Applicant identify the elements of Strain c in an art-recognized manner, which lists what is necessary, what has been added, or what has been deleted from the base strain, such as: Msm mc2155 Mtb ATP+/ Msm ATP-, hygR+, KanR- With respect to claim 1, step 4, it is suggested that “a prokaryotic expression vector” be replaced with “an overexpression vector” or “an inducible prokaryotic expression vector” to properly reflect the invention. Further with respect to claim 1, step 4, it is suggested that “to obtain the Mtb ATP synthase expressing recombinant bacterium” be amended to “to obtain the Mtb ATP synthase expression recombinant Msm bacterium” to properly reflect what is created. The metes and bounds of claim 2 are unclear, in that the Mtb ATP synthase gene cluster appears to be cloned into the sodC gene in plasmid A, and then used in a homologous recombination step which then inserts the ATP synthase gene cluster into the Msm competent cell, by virtue of recombining with the sodC gene in the cell. The streptomycin selection marker is a part of Plasmid A. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1 and 5 are under 35 U.S.C. 103 as being unpatentable over Tran et al. (Journal of Bacteriology, Vol. 187, issue 14, pages 1-10), Chhotaray et al. (Journal of Genetics and Genomics Vol. 45, pages 281-297), Seral (Fighting antimicrobial resistance in mycobacteria: development of an antivirulence screening platform and a genetic methodology to confirm drug resistance phenotypes. Thesis, Universidad de Zaragoza, 169 pages) and Converse et al. (J. Bacteriology Vol. 187 Issue 4, pages 1-16). The rejected claims are directed to a method of using genetic engineering to create a Mycobacteria smegmatis strain, which has the ATP synthase gene cluster from Mycobacteria tuberculosis knocked in, and the ATP synthase gene cluster from Msm knocked out. The claimed process first knocks in the Mtb gene cluster, through homologous recombination, to provide constitutive Mtb ATP synthase activity. Next the Msm ATP synthase gene cluster is knocked out through homologous recombination. Finally, after culturing in kanamycin free media, to encourage loss of the auxiliary plasmid, an overexpression vector, or inducible vector also encoding the Mtb ATP synthase gene cluster is introduced. Tran et al. provide the Mtb and Msm ATP synthase gene cluster sequence information. “The putative atp operon coding for the F1Fo-ATP synthase of M. smegmatis was identified in an unfinished genome database (www.tigr.org). The DNA sequence shows that this operon is similar to those of many bacteria and is colinear to the atp operon of Mycobacterium tuberculosis with the gene order atpBEFHAGDC.” (see page 1). Tran et al. provide Msm competent cells, comprising an auxiliary gene knockout vector. Tran discloses mc2155 strain of Msm, which appears to meet this limitation. (see page 2). Tran et al. modify the Msm ATP synthase gene cluster, by deleting one copy of atpD, by homologous recombination using a pST100 vector. (Fig 1, and p2) Deletion of both copies of the gene led to no colony growth, as this gene is essential for replication under the fermentation conditions of Tran et al. (see page 5). Tran does not teach replacing the Msm ATP synthase gene cluster with that of Mtb. In the same field of technology, Chhotaray et al. review common strategies for analyzing Mtb, including genetic engineering and recombineering. At page 283 the disclose: “In mycobacteria, the construction of plasmids and/or cloning vectors has three basic requirements: (i) the ability to replicate in E. coli and mycobacteria or to integrate into mycobacterial genome: (ii) the presence of multiple cloning sites containing suitable restriction enzyme sites: and (iii) the presence of a suitable selectable marker. Based on their ability to replicate in both E. coli and mycobacteria, most of these plasmids are shuttle plasmids that are broadly categorized in two families: pMSC262 and pALS00. pMSC262 was isolated from M. scrofulaceum and pALS00 from M..Fortuitus (Labidi et al., 1985). Numerous extra-chromosomally replicating plasmids have been developed for M. tuberculosis, such as the widely used E. coli mycobacterial pYUB12 and pMV261 shuttle plasmids (Snapper et al., 1990; Stover et al., 1991). In addition to extra-chromosomal plasmids, integrative plasmids are also widely used in mycobacterial research. These types of plasmids contain the integrase gene ( int) and the phage attachment site ( attP) from mycobacteriophages (Snapper et al., 1988). Integrative plasmids have the following advantages: (i) the integration of a foreign gene is highly efficient; (ii) the inserted gene remains in a single copy; and (iii) inheritance stability of the gene is greater in the absence of antibiotic selection. However, their integration site may affect the expression of the integrated gene because of the presence of native promoters…”. Chhotaray et al. further disclose common plasmids used in the analysis of Mtb in Table 1 (including the pJV53 auxiliary gene knockout vector and pMV261 shuttle vector as disclosed in the specification). As disclosed above, the use of the correct integration vector leads to efficient integration of a foreign gene, in a single copy, and is stable. Chhotaray et al. further discuss the plasmid vectors on p283 where they disclose: “Plasmid vectors play a vital role in studies on mechanisms underlying drug resistance and in the generation of recombinant vaccines (AJdovini and Young, 1991; Stover et al., 1991; Zhang et al., 1992 ). An appropriate selection marker is required for the selection of mycobacterial cells that carry the recombinant DNA. Importantly, the transformation efficiency of mycobacterial species is different, depending on the plasmid and the marker gene used (Garbe et al., 1994). Unfortunately, M. tuberculosis is naturally resistant to many antibiotics which limit the marker choices (Parish and Brown, 2008). Snapper et al. (1988) first used the aminoglycoside phosphotransferase gene, which confers resistance to kanamycin (KAN), as a selection marker for mycobacteria. However, mutation in the single rRNA operon of slow-growing mycobacteria also causes resistance to KAN and thus limits the application of this selection marker (Bottger, 1994; Hatfull, 1996). Therefore, Radford and Hodgson (1991) introduced the hygromycin (HYG) resistance gene as a selection marker for mycobacteria. Their study revealed that the transformation efficiency was higher ( 103 -105 transformants/ μg DNA) when the vectors expressing the HYG resistance gene were used. Currently, HYG is a popular selection marker for M. tuberculosis without cross-resistance to anti-TB drugs (Garbe et al., 1994).” The plasmid vectors used in the recombineering of claim 1 also include Kanamycin and/or Hygromycin resistance genes, as set forth in Figures 2 and 3. Chhotaray reviews the strategies used in recombineering mycobacterial strains, using combinations of homologous recombination and recombineering with an inducible vector, in sections 3.3.1 and 3.3.5. “3.3.1. Gene replacement using short and long linear DNA substrates “Chromosomal gene inactivation is the principal approach used in bacterial genomic functional studies. Homologous recombination (HR), a mechanism generally used by pathogens to maintain genomic stability, has been widely adopted to study gene function by inactivating the chromosomal genes in mycobacteria and in other bacteria. Successful disruption of M. tuberculosis genes, using short and long linear DNA fragments as allelic exchange substrates for HR has been reported (Balasubramanian et al., 1996; Armitige et al., 2000; Piddington et al., 2001 ). These linear DNA substrates carrying the target gene as well as a selection marker (kanR and/or hygR) were transformed into M. tuberculosis via electroporation to disrupt the target gene. Short linear substrates ( <5 kb) have been widely used to generate target gene mutants in different strains of M. tuberculosis (Kalpana et al., 1991; Berthet et al., 1998; Yuan et al., 1998; Armitige et al., 2000; Piddington et al., 2001 ). Only one study used 40-50 kb long linear DNA substrates to disrupt leuD gene in M. tuberculosis (Balasubramanian et al., 1996). Even though the technique uses high amounts of substrate, low transformation efficiency coupled with low HR rates in M. tuberculosis limits its use.” (see page 285). While Tran et al. disclose knocking out or disrupting mycobacterial genes using allelic exchange substrates for homologous recombination as reviewed by Chhotaray et al. they do not explicitly disclose “knocking in” Mtb genes in place of the Msm genes that have been inactivated. Seral provides methods of knocking in genes from Mtb into Msm, while also knocking out the related Msm genes. Seral provides Msm mc2155 cells containing pJV53H, which are modified to delete Msm PhoPR, and to knock in Mtb PhoPR. At page 2 they disclose: “We have also explored the possibility of using a non-pathogenic mycobacterium, Mycobacterium smegmatis, as M. tuberculosis surrogate for the discovery of PhoPR inhibitors. To do so, we have engineered a M. smegmatis strain to replace its endogenous PhoPR system by the heterologous system from M. tuberculosis. We have also constructed a ∆phoPR mutant as control of inactive PhoPR system in M. smegmatis. Reporter strains constructed in the different M. smegmatis strains have demonstrated preliminary but promising results of the reporter plasmids in M. smegmatis strains carrying the PhoPR system from M. tuberculosis.” Seral further discloses: “Engineering M. smegmatis as a surrogate of M. Tuberculosis PhoPR reporter strain.” Seral points out the high level of homology between Msm and Mtb gene and related protein sequences. Seral notes several advantages in the use of Msm, as opposed to Mtb, in laboratory culture practices. Mtb requires a higher level of biosafety, and has a slower growth rate, as compared to Msm.” (see page 78). Seral further notes: “To develop a safer organism, like M. smegmatis, to test potential inhibitors of the PhoPR system, we need to express the heterologous PhoPR system to which we want to screen the potential inhibitors. Introducing the M. tuberculosis PhoPR system directly into a M. smegmatis strain might appear an interesting approach, however, simultaneous expression of two different PhoPR systems at the same time in the same organism might lead to cross activation or repression of both systems, leading to confusing results. In order to avoid this phenotype, we decided to replace the endogenous PhoPR system from M. smegmatis by its homologous system from M. tuberculosis. In addition, we also decided to construct a knock-out mutant of the Pho PR system in M. smegmatis as control strain with an inactive PhoPR system.” (see page 79). Seral performs the genetic engineering as set forth beginning at page 81, and Fig 28 wherein the inactivation of the Msm occurs first (Fig 28), followed by the addition of the Mtb genes (Fig 29). Seral represents knocking out the constitutive Msm gene cluster/ system, and knocking in the Mtb gene cluster/ system, to obtain “M. smegmatis mc2155 ΔSMphoPR::TBphoPR::Km” using the strategy of homologous recombination, as reviewed by Chhotaray. However, as set forth by Tran et al. the ATP synthase gene cluster is essential for Msm and Mtb growth, such that the process of Seral would have had to be reversed, as knocking out the Msm genes first would have led to no bacterial growth of the Msm lacking the ATP synthase cluster. One of skill would have recognized the problem with knocking out genes essential for replication, prior to knocking in a replacement of those genes, and reversed the steps. Neither Tran nor Seral increase Mtb ATP synthase gene cluster expression using an inducible plasmid vector containing an additional copy of the gene cluster. Converse et al. disclose the use of inducible gene expression plasmid vectors in Msm, in a strategy of knocking out certain Msm genes, and knocking in genes from Mtb. Converse et al. (2005) also create mc2155 deletion mutants, including the final step of adding an overexpression vector of the desired gene, with an affinity purification tag, to the deletion mutant, as set forth in the Materials and Methods section. “Construction of M. smegmatis deletion strains and Southern analysis. To generate deletion strains, the 5′ and 3′ 800-bp flanks surrounding each gene were amplified by PCR, sequence analyzed, and introduced into pjsc232, … This strategy created an in-frame gene deletion which encodes a truncated gene product (see Table 2 for precise truncated sizes of each deleted gene). These plasmids were introduced as described previously (11), and integrants were selected by growth on 7H10 agar containing kanamycin. Single colonies were picked and grown to late log phase in liquid 7H9 media without kanamycin, and recombinants were selected by growth on 7H10 agar with 5% sucrose. Deletion generation was confirmed by PCR and Southern analysis. Strains are listed in Table 1, and more details of Southern analysis are given in Table 2.” Overexpression plasmid for expression proteins in mc2155 cells: “Construction of snm and esx complementation plasmids…Complementation vectors were derived from pMV261.kan, a high-copy episomal plasmid in which transcription is driven by the constitutive groEL2 promoter (32) … C-terminal 2× hemagglutinin (HA) (pMJ13) or Myc (pMJ31) tags were created by PCR and ligated into pMV261.kan… Each of the snm and esx genes were amplified by PCR from wild-type M. smegmatis genomic DNA, sequenced, and introduced into pMJ13 or pMJ31, creating C-terminally tagged constructs.” In KSR Int 'l v. Teleflex, the Supreme Court, in rejecting the rigid application of the teaching, suggestion, and motivation test by the Federal Circuit, indicated that “The principles underlying [earlier] cases are instructive when the question is whether a patent claiming the combination of elements of prior art is obvious. When a work is available in one field of endeavor, design incentives and other market forces can prompt variations of it, either in the same field or a different one. If a person of ordinary skill can implement a predictable variation, § 103 likely bars its patentability.” KSR Int'l v. Teleflex lnc., 127 S. Ct. 1727, 1740 (2007). Applying the KSR standard of obviousness to Tran et al., Chhotaray et al., Seral and Converse et al., the Examiner concludes that the use of genetic engineering and recombineering techniques as reviewed by Chhotaray et al., to knock in the Mtb ATP synthase gene cluster, knock out the Msm ATP synthase gene cluster, and transform the strain with an additional inducible expression vector represented the use of a known technique to improve similar methods. The nature of the problem to be solved may lead inventors to look at references relating to possible solutions to that problem. Tran et al. provide the ATP synthase gene clusters for both Msm and Mtb, and provide evidence that these genes are essential for replication. Seral uses similar techniques to knock out Msm genes and replace them with the related Mtb genes, and obtained viable transformed Msm expressing the Mtb gene complex. Converse et al. also provides knocking out Msm genes and replacing them with Mtb genes, using homologous recombination, and in addition, Converse provided the transformation of the modified Msm with inducible overexpression plasmids to increase the production of the gene within the plasmid, under the inducible promoter. Chhotaray provides the rationale for the series of steps required to achieve the desired finally transformed Msm, as they indicate that recombineering is more successful in Msm, than in Mtb strains. Therefore, it would have been obvious to have carried out the knock in of the Mtb genes first, in view of the disclosure by Tran et al., as the synthase genes were shown by Tran et al. to be essential for replication. Knocking out the Msm genes would have been obvious in view of both Tran et al., and Seral, who noted that having two sets of the gene system could lead to conflicting results, and that knocking out the undesired gene cluster is possible, while achieving good expression of the knocked in genes. Converse et al. notes that constituitive expression may not be enough to achieve the desired quantities of the gene in question, and provides the inducible expression plasmid vectors to increase production of the desired genes. Using the known techniques would have been obvious to one of ordinary skill in the art at the time of filing, absent evidence to the contrary. With respect to claim 5, Chhotaray et al. provided the use of hygR as a common selection marker in knock out/ knock in experiments. Claims 1, 3 and 5 are under 35 U.S.C. 103 as being unpatentable over Tran et al. (Journal of Bacteriology, Vol. 187, issue 14, pages 1-10), Chhotaray et al. (Journal of Genetics and Genomics Vol. 45, pages 281-297), Seral (Fighting antimicrobial resistance in mycobacteria: development of an antivirulence screening platform and a genetic methodology to confirm drug resistance phenotypes. Thesis, Universidad de Zaragoza, 169 pages), Converse et al. (J. Bacteriology Vol. 187 Issue 4, pages 1-16) and Ichinose et al. (Mycobacterium tuberculosis DNA, complete genome, strain: NGCM946K2, alignment with SEQ ID NO: 1). The rejected claims are directed to a method of using genetic engineering to create a Mycobacteria smegmatis strain, which has the ATP synthase gene cluster from Mycobacteria tuberculosis knocked in, and the ATP synthase gene cluster from Msm knocked out. The claimed process first knocks in the Mtb gene cluster, through homologous recombination, to provide constitutive Mtb ATP synthase activity. Next the Msm ATP synthase gene cluster is knocked out through homologous recombination. Finally, after culturing in kanamycin free media, to encourage loss of the auxiliary plasmid, an overexpression vector, or inducible vector also encoding the Mtb ATP synthase gene cluster is introduced. Moreover, claim 3 requires the Mtb ATP synthase gene cluster have the sequence of SEQ ID NO:1. Tran et al. provide the Mtb and Msm ATP synthase gene cluster sequence information. “The putative atp operon coding for the F1Fo-ATP synthase of M. smegmatis was identified in an unfinished genome database (www.tigr.org). The DNA sequence shows that this operon is similar to those of many bacteria and is colinear to the atp operon of Mycobacterium tuberculosis with the gene order atpBEFHAGDC.” (see page 1). Tran et al. provide Msm competent cells, comprising an auxiliary gene knockout vector. Tran discloses mc2155 strain of Msm, which appears to meet this limitation. (see page 2). Tran et al. modify the Msm ATP synthase gene cluster, by deleting one copy of atpD, by homologous recombination using a pST100 vector. (Fig 1, and p2) Deletion of both copies of the gene led to no colony growth, as this gene is essential for replication under the fermentation conditions of Tran et al. (see page 5). Tran does not teach replacing the Msm ATP synthase gene cluster with that of Mtb. In the same field of technology, Chhotaray et al. review common strategies for analyzing Mtb, including genetic engineering and recombineering. At page 283 the disclose: “In mycobacteria, the construction of plasmids and/or cloning vectors has three basic requirements: (i) the ability to replicate in E.coli and mycobacteria or to integrate into mycobacterial genome: (ii) the presence of multiple cloning sites containing suitable restriction enzyme sites: and (iii) the presence of a suitable selectable marker. Based on their ability to replicate in both E. coli and mycobacteria, most of these plasmids are shuttle plasmids that are broadly categorized in two families: pMSC262 and pALS00. pMSC262 was isolated from M. scrofulaceum and pALS00 from M.fortuitum (Labidi et al., 1985). Numerous extra-chromosomally replicating plasmids have been developed for M. tuberculosis, such as the widely used E. coli mycobacterial pYUB12 and pMV261 shuttle plasmids (Snapper et al., 1990; Stover et al., 1991). In addition to extra-chromosomal plasmids, integrative plasmids are also widely used in mycobacterial research. These types of plasmids contain the integrase gene ( int) and the phage attachment site ( attP) from mycobacteriophages (Snapper et al., 1988). Integrative plasmids have the following advantages: (i) the integration of a foreign gene is highly efficient; (ii) the inserted gene remains in a single copy; and (iii) inheritance stability of the gene is greater in the absence of antibiotic selection. However, their integration site may affect the expression of the integrated gene because of the presence of native promoters…”. Chhotaray et al. further disclose common plasmids used in the analysis of Mtb in Table 1 (including the pJV53 auxiliary gene knockout vector and pMV261 shuttle vector as disclosed in the specification). As disclosed above, the use of the correct integration vector leads to efficient integration of a foreign gene, in a single copy, and is stable. Chhotaray et al. further discuss the plasmid vectors on p283 where they disclose: “Plasmid vectors play a vital role in studies on mechanisms underlying drug resistance and in the generation of recombinant vaccines (AJdovini and Young, 1991; Stover et al., 1991; Zhang et al., 1992 ). An appropriate selection marker is required for the selection of mycobacterial cells that carry the recombinant DNA. Importantly, the transformation efficiency of mycobacterial species is different, depending on the plasmid and the marker gene used (Garbe et al., 1994). Unfortunately, M. tuberculosis is naturally resistant to many antibiotics which limit the marker choices (Parish and Brown, 2008). Snapper et al. (1988) first used the aminoglycoside phosphotransferase gene, which confers resistance to kanamycin (KAN), as a selection marker for mycobacteria. However, mutation in the single rRNA operon of slow-growing mycobacteria also causes resistance to KAN and thus limits the application of this selection marker (Bottger, 1994; Hatfull, 1996). Therefore, Radford and Hodgson (1991) introduced the hygromycin (HYG) resistance gene as a selection marker for mycobacteria. Their study revealed that the transformation efficiency was higher ( 103 -105 transformants/ μg DNA) when the vectors expressing the HYG resistance gene were used. Currently, HYG is a popular selection marker for M. tuberculosis without cross-resistance to anti-TB drugs (Garbe et al., 1994).” The plasmid vectors used in the recombineering of claim 1 also include Kanamycin and/or Hygromycin resistance genes, as set forth in Figures 2 and 3. Chhotaray reviews the strategies used in recombineering mycobacterial strains, using combinations of homologous recombination and recombineering with an inducible vector, in sections 3.3.1 and 3.3.5. “3.3.1. Gene replacement using short and long linear DNA substrates “Chromosomal gene inactivation is the principal approach used in bacterial genomic functional studies. Homologous recombination (HR), a mechanism generally used by pathogens to maintain genomic stability, has been widely adopted to study gene function by inactivating the chromosomal genes in mycobacteria and in other bacteria. Successful disruption of M. tuberculosis genes, using short and long linear DNA fragments as allelic exchange substrates for HR has been reported (Balasubramanian et al., 1996; Armitige et al., 2000; Piddington et al., 2001 ). These linear DNA substrates carrying the target gene as well as a selection marker (kanR and/or hygR) were transformed into M. tuberculosis via electroporation to disrupt the target gene. Short linear substrates ( <5 kb) have been widely used to generate target gene mutants in different strains of M. tuberculosis (Kalpana et al., 1991; Berthet et al., 1998; Yuan et al., 1998; Armitige et al., 2000; Piddington et al., 2001 ). Only one study used 40-50 kb long linear DNA substrates to disrupt leuD gene in M. tuberculosis (Balasubramanian et al., 1996). Even though the technique uses high amounts of substrate, low transformation efficiency coupled with low HR rates in M. tuberculosis limits its use.” (see page 285). While Tran et al. disclose knocking out or disrupting mycobacterial genes using allelic exchange substrates for homologous recombination as reviewed by Chhotaray et al. they do not explicitly disclose “knocking in” Mtb genes in place of the Msm genes that have been inactivated. Seral provides methods of knocking in genes from Mtb into Msm, while also knocking out the related Msm genes. Seral provides Msm mc2155 cells containing pJV53H, which are modified to delete Msm PhoPR, and to knock in Mtb PhoPR. At page 2 they disclose: “We have also explored the possibility of using a non-pathogenic mycobacterium, Mycobacterium smegmatis, as M. tuberculosis surrogate for the discovery of PhoPR inhibitors. To do so, we have engineered a M. smegmatis strain to replace its endogenous PhoPR system by the heterologous system from M. tuberculosis. We have also constructed a ∆phoPR mutant as control of inactive PhoPR system in M. smegmatis. Reporter strains constructed in the different M. smegmatis strains have demonstrated preliminary but promising results of the reporter plasmids in M. smegmatis strains carrying the PhoPR system from M. tuberculosis.” Seral further discloses: “Engineering M. smegmatis as a surrogate of M. Tuberculosis PhoPR reporter strain.” Seral points out the high level of homology between Msm and Mtb gene and related protein sequences. Seral notes several advantages in the use of Msm, as opposed to Mtb, in laboratory culture practices. Mtb requires a higher level of biosafety, and has a slower growth rate, as compared to Msm.” (see page 78). Seral further notes: “To develop a safer organism, like M. smegmatis, to test potential inhibitors of the PhoPR system, we need to express the heterologous PhoPR system to which we want to screen the potential inhibitors. Introducing the M. tuberculosis PhoPR system directly into a M. smegmatis strain might appear an interesting approach, however, simultaneous expression of two different PhoPR systems at the same time in the same organism might lead to cross activation or repression of both systems, leading to confusing results. In order to avoid this phenotype, we decided to replace the endogenous PhoPR system from M. smegmatis by its homologous system from M. tuberculosis. In addition, we also decided to construct a knock-out mutant of the Pho PR system in M. smegmatis as control strain with an inactive PhoPR system.” (see page 79). Seral performs the genetic engineering as set forth beginning at page 81, and Fig 28 wherein the inactivation of the Msm occurs first (Fig 28), followed by the addition of the Mtb genes (Fig 29). Seral represents knocking out the constitutive Msm gene cluster/ system, and knocking in the Mtb gene cluster/ system, to obtain “M. smegmatis mc2155 ΔSMphoPR::TBphoPR::Km” using the strategy of homologous recombination, as reviewed by Chhotaray. However, as set forth by Tran et al. the ATP synthase gene cluster is essential for Msm and Mtb growth, such that the process of Seral would have had to be reversed, as knocking out the Msm genes first would have led to no bacterial growth of the Msm lacking the ATP synthase cluster. One of skill would have recognized the problem with knocking out genes essential for replication, prior to knocking in a replacement of those genes, and reversed the steps. Neither Tran nor Seral increase Mtb ATP synthase gene cluster expression using an inducible plasmid vector containing an additional copy of the gene cluster. Converse et al. disclose the use of inducible gene expression plasmid vectors in Msm, in a strategy of knocking out certain Msm genes, and knocking in genes from Mtb. Converse et al. (2005) also create mc2155 deletion mutants, including the final step of adding an overexpression vector of the desired gene, with an affinity purification tag, to the deletion mutant, as set forth in the Materials and Methods section. “Construction of M. smegmatis deletion strains and Southern analysis. To generate deletion strains, the 5′ and 3′ 800-bp flanks surrounding each gene were amplified by PCR, sequence analyzed, and introduced into pjsc232, … This strategy created an in-frame gene deletion which encodes a truncated gene product (see Table 2 for precise truncated sizes of each deleted gene). These plasmids were introduced as described previously (11), and integrants were selected by growth on 7H10 agar containing kanamycin. Single colonies were picked and grown to late log phase in liquid 7H9 media without kanamycin, and recombinants were selected by growth on 7H10 agar with 5% sucrose. Deletion generation was confirmed by PCR and Southern analysis. Strains are listed in Table 1, and more details of Southern analysis are given in Table 2.” Overexpression plasmid for expression proteins in mc2155 cells: “Construction of snm and esx complementation plasmids…Complementation vectors were derived from pMV261.kan, a high-copy episomal plasmid in which transcription is driven by the constitutive groEL2 promoter (32) … C-terminal 2× hemagglutinin (HA) (pMJ13) or Myc (pMJ31) tags were created by PCR and ligated into pMV261.kan… Each of the snm and esx genes were amplified by PCR from wild-type M. smegmatis genomic DNA, sequenced, and introduced into pMJ13 or pMJ31, creating C-terminally tagged constructs.” In KSR Int 'l v. Teleflex, the Supreme Court, in rejecting the rigid application of the teaching, suggestion, and motivation test by the Federal Circuit, indicated that “The principles underlying [earlier] cases are instructive when the question is whether a patent claiming the combination of elements of prior art is obvious. When a work is available in one field of endeavor, design incentives and other market forces can prompt variations of it, either in the same field or a different one. If a person of ordinary skill can implement a predictable variation, § 103 likely bars its patentability.” KSR Int'l v. Teleflex lnc., 127 S. Ct. 1727, 1740 (2007). Applying the KSR standard of obviousness to Tran et al., Chhotaray et al., Seral and Converse et al., the Examiner concludes that the use of genetic engineering and recombineering techniques as reviewed by Chhotaray et al., to knock in the Mtb ATP synthase gene cluster, knock out the Msm ATP synthase gene cluster, and transform the strain with an additional inducible expression vector represented the use of a known technique to improve similar methods. The nature of the problem to be solved may lead inventors to look at references relating to possible solutions to that problem. Tran et al. provide the ATP synthase gene clusters for both Msm and Mtb, and provide evidence that these genes are essential for replication. Seral uses similar techniques to knock out Msm genes and replace them with the related Mtb genes, and obtained viable transformed Msm expressing the Mtb gene complex. Converse et al. also provides knocking out Msm genes and replacing them with Mtb genes, using homologous recombination, and in addition, Converse provided the transformation of the modified Msm with inducible overexpression plasmids to increase the production of the gene within the plasmid, under the inducible promoter. Chhotaray provides the rationale for the series of steps required to achieve the desired finally transformed Msm, as they indicate that recombineering is more successful in Msm, than in Mtb strains. Therefore, it would have been obvious to have carried out the knock in of the Mtb genes first, in view of the disclosure by Tran et al., as the synthase genes were shown by Tran et al. to be essential for replication. Knocking out the Msm genes would have been obvious in view of both Tran et al., and Seral, who noted that having two sets of the gene system could lead to conflicting results, and that knocking out the undesired gene cluster is possible, while achieving good expression of the knocked in genes. Converse et al. notes that constituitive expression may not be enough to achieve the desired quantities of the gene in question, and provides the inducible expression plasmid vectors to increase production of the desired genes. Using the known techniques would have been obvious to one of ordinary skill in the art at the time of filing, absent evidence to the contrary. With respect to claim 5, Chhotaray et al. provided the use of hygR as a common selection marker in knock out/ knock in experiments. As set forth supra, Tran et al. Chhotaray et al., Seral and Converse et al. make the method of claim 1 obvious. Moreover, Tran et al. disclose the sequences of the ATP synthase gene cluster were known, as of 2005, but does not provide the actual nucleotide sequence of the cluster. Ichinose et al. disclose the nucleotide sequence of the Mtb ATP synthase gene cluster, 100% matching the sequence of SEQ ID NO 1, as set forth in the attached alignment. Tran et al., while teaching that the Mtb and Msm ATP synthase gene cluster sequences were known at the time of publication, it did not provide the specific nucleotide sequences. However, the sequences of Mtb ATP synthase gene cluster for multiple strains of Mtb were well known in the prior art. Ichinose et al is cited to demonstrate one strain of Mtb having the same ATP synthase gene sequence as SEQ ID NO 1. One of ordinary skill in the art would have been motivated to identify the full ATP synthase gene cluster sequence, by looking to disclosures such as Ichinose, to ensure the full set of genes required by the cluster were accurately cloned into the desired vector, for insertion into the Msm competent strain. Such a combination is merely a "predictable use of prior art elements according to their established functions." KSR Int’l 7, 127 S. Ct. at 1740. Claims 1 and 5-7 are under 35 U.S.C. 103 as being unpatentable over Tran et al. (Journal of Bacteriology, Vol. 187, issue 14, pages 1-10), Chhotaray et al. (Journal of Genetics and Genomics Vol. 45, pages 281-297), Seral (Fighting antimicrobial resistance in mycobacteria: development of an antivirulence screening platform and a genetic methodology to confirm drug resistance phenotypes. Thesis, Universidad de Zaragoza, 169 pages), Converse et al. (J. Bacteriology Vol. 187 Issue 4, pages 1-16) Perrodou et al. (Nucleic Acids Res. Vol. 34 (DATABASE ISSUE), pages D338-D343 (2006)). The rejected claims are directed to a method of using genetic engineering to create a Mycobacteria smegmatis strain, which has the ATP synthase gene cluster from Mycobacteria tuberculosis knocked in, and the ATP synthase gene cluster from Msm knocked out. The claimed process first knocks in the Mtb gene cluster, through homologous recombination, to provide constitutive Mtb ATP synthase activity. Next the Msm ATP synthase gene cluster is knocked out through homologous recombination. Finally, after culturing in kanamycin free media, to encourage loss of the auxiliary plasmid, an overexpression vector, or inducible vector also encoding the Mtb ATP synthase gene cluster is introduced. Moreover, claim 3 requires the Msm ATP synthase gene cluster have the sequence of SEQ ID NO:2. Tran et al. provide the Mtb and Msm ATP synthase gene cluster sequence information. “The putative atp operon coding for the F1Fo-ATP synthase of M. smegmatis was identified in an unfinished genome database (www.tigr.org). The DNA sequence shows that this operon is similar to those of many bacteria and is colinear to the atp operon of Mycobacterium tuberculosis with the gene order atpBEFHAGDC.” (see page 1). Tran et al. provide Msm competent cells, comprising an auxiliary gene knockout vector. Tran discloses mc2155 strain of Msm, which appears to meet this limitation. (see page 2). Tran et al. modify the Msm ATP synthase gene cluster, by deleting one copy of atpD, by homologous recombination using a pST100 vector. (Fig 1, and p2) Deletion of both copies of the gene led to no colony growth, as this gene is essential for replication under the fermentation conditions of Tran et al. (see page 5). Tran does not teach replacing the Msm ATP synthase gene cluster with that of Mtb. In the same field of technology, Chhotaray et al. review common strategies for analyzing Mtb, including genetic engineering and recombineering. At page 283 the disclose: “In mycobacteria, the construction of plasmids and/or cloning vectors has three basic requirements: (i) the ability to replicate in E.coli and mycobacteria or to integrate into mycobacterial genome: (ii) the presence of multiple cloning sites containing suitable restriction enzyme sites: and (iii) the presence of a suitable selectable marker. Based on their ability to replicate in both E. coli and mycobacteria, most of these plasmids are shuttle plasmids that are broadly categorized in two families: pMSC262 and pALS00. pMSC262 was isolated from M. scrofulaceum and pALS00 from M.fortuitum (Labidi et al., 1985). Numerous extra-chromosomally replicating plasmids have been developed for M. tuberculosis, such as the widely used E. coli mycobacterial pYUB12 and pMV261 shuttle plasmids (Snapper et al., 1990; Stover et al., 1991). In addition to extra-chromosomal plasmids, integrative plasmids are also widely used in mycobacterial research. These types of plasmids contain the integrase gene ( int) and the phage attachment site ( attP) from mycobacteriophages (Snapper et al., 1988). Integrative plasmids have the following advantages: (i) the integration of a foreign gene is highly efficient; (ii) the inserted gene remains in a single copy; and (iii) inheritance stability of the gene is greater in the absence of antibiotic selection. However, their integration site may affect the expression of the integrated gene because of the presence of native promoters…”. Chhotaray et al. further disclose common plasmids used in the analysis of Mtb in Table 1 (including the pJV53 auxiliary gene knockout vector and pMV261 shuttle vector as disclosed in the specification). As disclosed above, the use of the correct integration vector leads to efficient integration of a foreign gene, in a single copy, and is stable. Chhotaray et al. further discuss the plasmid vectors on p283 where they disclose: “Plasmid vectors play a vital role in studies on mechanisms underlying drug resistance and in the generation of recombinant vaccines (AJdovini and Young, 1991; Stover et al., 1991; Zhang et al., 1992 ). An appropriate selection marker is required for the selection of mycobacterial cells that carry the recombinant DNA. Importantly, the transformation efficiency of mycobacterial species is different, depending on the plasmid and the marker gene used (Garbe et al., 1994). Unfortunately, M. tuberculosis is naturally resistant to many antibiotics which limit the marker choices (Parish and Brown, 2008). Snapper et al. (1988) first used the aminoglycoside phosphotransferase gene, which confers resistance to kanamycin (KAN), as a selection marker for mycobacteria. However, mutation in the single rRNA operon of slow-growing mycobacteria also causes resistance to KAN and thus limits the application of this selection marker (Bottger, 1994; Hatfull, 1996). Therefore, Radford and Hodgson (1991) introduced the hygromycin (HYG) resistance gene as a selection marker for mycobacteria. Their study revealed that the transformation efficiency was higher ( 103 -105 transformants/ μg DNA) when the vectors expressing the HYG resistance gene were used. Currently, HYG is a popular selection marker for M. tuberculosis without cross-resistance to anti-TB drugs (Garbe et al., 1994).” The plasmid vectors used in the recombineering of claim 1 also include Kanamycin and/or Hygromycin resistance genes, as set forth in Figures 2 and 3. Chhotaray reviews the strategies used in recombineering mycobacterial strains, using combinations of homologous recombination and recombineering with an inducible vector, in sections 3.3.1 and 3.3.5. “3.3.1. Gene replacement using short and long linear DNA substrates “Chromosomal gene inactivation is the principal approach used in bacterial genomic functional studies. Homologous recombination (HR), a mechanism generally used by pathogens to maintain genomic stability, has been widely adopted to study gene function by inactivating the chromosomal genes in mycobacteria and in other bacteria. Successful disruption of M. tuberculosis genes, using short and long linear DNA fragments as allelic exchange substrates for HR has been reported (Balasubramanian et al., 1996; Armitige et al., 2000; Piddington et al., 2001 ). These linear DNA substrates carrying the target gene as well as a selection marker (kanR and/or hygR) were transformed into M. tuberculosis via electroporation to disrupt the target gene. Short linear substrates ( <5 kb) have been widely used to generate target gene mutants in different strains of M. tuberculosis (Kalpana et al., 1991; Berthet et al., 1998; Yuan et al., 1998; Armitige et al., 2000; Piddington et al., 2001 ). Only one study used 40-50 kb long linear DNA substrates to disrupt leuD gene in M. tuberculosis (Balasubramanian et al., 1996). Even though the technique uses high amounts of substrate, low transformation efficiency coupled with low HR rates in M. tuberculosis limits its use.” (see page 285). While Tran et al. disclose knocking out or disrupting mycobacterial genes using allelic exchange substrates for homologous recombination as reviewed by Chhotaray et al. they do not explicitly disclose “knocking in” Mtb genes in place of the Msm genes that have been inactivated. Seral provides methods of knocking in genes from Mtb into Msm, while also knocking out the related Msm genes. Seral provides Msm mc2155 cells containing pJV53H, which are modified to delete Msm PhoPR, and to knock in Mtb PhoPR. At page 2 they disclose: “We have also explored the possibility of using a non-pathogenic mycobacterium, Mycobacterium smegmatis, as M. tuberculosis surrogate for the discovery of PhoPR inhibitors. To do so, we have engineered a M. smegmatis strain to replace its endogenous PhoPR system by the heterologous system from M. tuberculosis. We have also constructed a ∆phoPR mutant as control of inactive PhoPR system in M. smegmatis. Reporter strains constructed in the different M. smegmatis strains have demonstrated preliminary but promising results of the reporter plasmids in M. smegmatis strains carrying the PhoPR system from M. tuberculosis.” Seral further discloses: “Engineering M. smegmatis as a surrogate of M. Tuberculosis PhoPR reporter strain.” Seral points out the high level of homology between Msm and Mtb gene and related protein sequences. Seral notes several advantages in the use of Msm, as opposed to Mtb, in laboratory culture practices. Mtb requires a higher level of biosafety, and has a slower growth rate, as compared to Msm.” (see page 78). Seral further notes: “To develop a safer organism, like M. smegmatis, to test potential inhibitors of the PhoPR system, we need to express the heterologous PhoPR system to which we want to screen the potential inhibitors. Introducing the M. tuberculosis PhoPR system directly into a M. smegmatis strain might appear an interesting approach, however, simultaneous expression of two different PhoPR systems at the same time in the same organism might lead to cross activation or repression of both systems, leading to confusing results. In order to avoid this phenotype, we decided to replace the endogenous PhoPR system from M. smegmatis by its homologous system from M. tuberculosis. In addition, we also decided to construct a knock-out mutant of the Pho PR system in M. smegmatis as control strain with an inactive PhoPR system.” (see page 79). Seral performs the genetic engineering as set forth beginning at page 81, and Fig 28 wherein the inactivation of the Msm occurs first (Fig 28), followed by the addition of the Mtb genes (Fig 29). Seral represents knocking out the constitutive Msm gene cluster/ system, and knocking in the Mtb gene cluster/ system, to obtain “M. smegmatis mc2155 ΔSMphoPR::TBphoPR::Km” using the strategy of homologous recombination, as reviewed by Chhotaray. However, as set forth by Tran et al. the ATP synthase gene cluster is essential for Msm and Mtb growth, such that the process of Seral would have had to be reversed, as knocking out the Msm genes first would have led to no bacterial growth of the Msm lacking the ATP synthase cluster. One of skill would have recognized the problem with knocking out genes essential for replication, prior to knocking in a replacement of those genes, and reversed the steps. Neither Tran nor Seral increase Mtb ATP synthase gene cluster expression using an inducible plasmid vector containing an additional copy of the gene cluster. Converse et al. disclose the use of inducible gene expression plasmid vectors in Msm, in a strategy of knocking out certain Msm genes, and knocking in genes from Mtb. Converse et al. (2005) also create mc2155 deletion mutants, including the final step of adding an overexpression vector of the desired gene, with an affinity purification tag, to the deletion mutant, as set forth in the Materials and Methods section. “Construction of M. smegmatis deletion strains and Southern analysis. To generate deletion strains, the 5′ and 3′ 800-bp flanks surrounding each gene were amplified by PCR, sequence analyzed, and introduced into pjsc232, … This strategy created an in-frame gene deletion which encodes a truncated gene product (see Table 2 for precise truncated sizes of each deleted gene). These plasmids were introduced as described previously (11), and integrants were selected by growth on 7H10 agar containing kanamycin. Single colonies were picked and grown to late log phase in liquid 7H9 media without kanamycin, and recombinants were selected by growth on 7H10 agar with 5% sucrose. Deletion generation was confirmed by PCR and Southern analysis. Strains are listed in Table 1, and more details of Southern analysis are given in Table 2.” Overexpression plasmid for expression proteins in mc2155 cells: “Construction of snm and esx complementation plasmids…Complementation vectors were derived from pMV261.kan, a high-copy episomal plasmid in which transcription is driven by the constitutive groEL2 promoter (32) … C-terminal 2× hemagglutinin (HA) (pMJ13) or Myc (pMJ31) tags were created by PCR and ligated into pMV261.kan… Each of the snm and esx genes were amplified by PCR from wild-type M. smegmatis genomic DNA, sequenced, and introduced into pMJ13 or pMJ31, creating C-terminally tagged constructs.” In KSR Int 'l v. Teleflex, the Supreme Court, in rejecting the rigid application of the teaching, suggestion, and motivation test by the Federal Circuit, indicated that “The principles underlying [earlier] cases are instructive when the question is whether a patent claiming the combination of elements of prior art is obvious. When a work is available in one field of endeavor, design incentives and other market forces can prompt variations of it, either in the same field or a different one. If a person of ordinary skill can implement a predictable variation, § 103 likely bars its patentability.” KSR Int'l v. Teleflex lnc., 127 S. Ct. 1727, 1740 (2007). Applying the KSR standard of obviousness to Tran et al., Chhotaray et al., Seral and Converse et al., the Examiner concludes that the use of genetic engineering and recombineering techniques as reviewed by Chhotaray et al., to knock in the Mtb ATP synthase gene cluster, knock out the Msm ATP synthase gene cluster, and transform the strain with an additional inducible expression vector represented the use of a known technique to improve similar methods. The nature of the problem to be solved may lead inventors to look at references relating to possible solutions to that problem. Tran et al. provide the ATP synthase gene clusters for both Msm and Mtb, and provide evidence that these genes are essential for replication. Seral uses similar techniques to knock out Msm genes and replace them with the related Mtb genes, and obtained viable transformed Msm expressing the Mtb gene complex. Converse et al. also provides knocking out Msm genes and replacing them with Mtb genes, using homologous recombination, and in addition, Converse provided the transformation of the modified Msm with inducible overexpression plasmids to increase the production of the gene within the plasmid, under the inducible promoter. Chhotaray provides the rationale for the series of steps required to achieve the desired finally transformed Msm, as they indicate that recombineering is more successful in Msm, than in Mtb strains. Therefore, it would have been obvious to have carried out the knock in of the Mtb genes first, in view of the disclosure by Tran et al., as the synthase genes were shown by Tran et al. to be essential for replication. Knocking out the Msm genes would have been obvious in view of both Tran et al., and Seral, who noted that having two sets of the gene system could lead to conflicting results, and that knocking out the undesired gene cluster is possible, while achieving good expression of the knocked in genes. Converse et al. notes that constituitive expression may not be enough to achieve the desired quantities of the gene in question, and provides the inducible expression plasmid vectors to increase production of the desired genes. Using the known techniques would have been obvious to one of ordinary skill in the art at the time of filing, absent evidence to the contrary. With respect to claim 5, Chhotaray et al. provided the use of hygR as a common selection marker in knock out/ knock in experiments. As set forth supra, Tran et al. Chhotaray et al., Seral and Converse et al. make the method of claim 1 obvious. Moreover, Tran et al. disclose the sequences of the ATP synthase gene cluster were known, as of 2005, but does not provide the actual nucleotide sequence of the cluster. Perrodou et al. disclose the nucleotide sequence of the Msm ATP synthase gene cluster, 100% matching the sequence of SEQ ID NO:2 (see alignment below). Tran et al., while teaching that the Mtb and Msm ATP synthase gene cluster sequences were known at the time of publication, it did not provide the specific nucleotide sequences. However, the sequences of Mtb ATP synthase gene cluster for multiple strains of Mtb were well known in the prior art. Ichinose et al is cited to demonstrate one strain of Mtb having the same ATP synthase gene sequence as SEQ ID NO 1. One of ordinary skill in the art would have been motivated to identify the full ATP synthase gene cluster sequence, by looking to disclosures such as Ichinose, to ensure the full set of genes required by the cluster were accurately cloned into the desired vector, for insertion into the Msm competent strain. Such a combination is merely a "predictable use of prior art elements according to their established functions." KSR Int’l 7, 127 S. Ct. at 1740. Query Match 100.0%; Score 7472; Length 6988208; Best Local Similarity 100.0%; Matches 7472; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GTGCTGGCCGCTGAAGAGGGTGGCGCAGCCATCCACGTCGGCCATCACACGCTCGTGTTC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5041308 GTGCTGGCCGCTGAAGAGGGTGGCGCAGCCATCCACGTCGGCCATCACACGCTCGTGTTC 5041249 Qy 61 GAGCTGTTCGGCATGACGTTCAATGGCGACACCATTCTCGCCACTGCCGTCACCGCCGTG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5041248 GAGCTGTTCGGCATGACGTTCAATGGCGACACCATTCTCGCCACTGCCGTCACCGCCGTG 5041189 Qy 121 ATCGTGATCGCGCTGGCCTTCTACCTGCGGGCCAAGGTCACCTCCACCGGGGTGCCCAGC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5041188 ATCGTGATCGCGCTGGCCTTCTACCTGCGGGCCAAGGTCACCTCCACCGGGGTGCCCAGC 5041129 Qy 181 GGTGTGCAGCTGTTCTGGGAGGCGCTGACGATCCAGATGCGTCAGCAGATCGAGGGCTCG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5041128 GGTGTGCAGCTGTTCTGGGAGGCGCTGACGATCCAGATGCGTCAGCAGATCGAGGGCTCG 5041069 Qy 241 ATCGGCATGAAGATCGCCCCGTTCGTGCTGCCGCTGTCGGTGACGATCTTCGTGTTCATC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5041068 ATCGGCATGAAGATCGCCCCGTTCGTGCTGCCGCTGTCGGTGACGATCTTCGTGTTCATC 5041009 Qy 301 CTGATCTCCAACTGGCTCGCGGTGCTCCCGCTGCAGTACGGCGGAGCCGACGGCGCCGCG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5041008 CTGATCTCCAACTGGCTCGCGGTGCTCCCGCTGCAGTACGGCGGAGCCGACGGCGCCGCG 5040949 Qy 361 GCCGAGTTGTACAAGGCACCCGCCTCCGACATCAACTTCGTGCTGGCGCTCGCGCTGTTC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5040948 GCCGAGTTGTACAAGGCACCCGCCTCCGACATCAACTTCGTGCTGGCGCTCGCGCTGTTC 5040889 Qy 421 GTGTTCGTCTGCTACCACGCGGCAGGCATCTGGCGTCGCGGCATCGTCGGCCACCCGATC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5040888 GTGTTCGTCTGCTACCACGCGGCAGGCATCTGGCGTCGCGGCATCGTCGGCCACCCGATC 5040829 Qy 481 AAGGTTGTCAAGGGCCACGTCGCGTTCCTCGCGCCGATCAACATCGTCGAAGAACTCGCC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5040828 AAGGTTGTCAAGGGCCACGTCGCGTTCCTCGCGCCGATCAACATCGTCGAAGAACTCGCC 5040769 Qy 541 AAGCCGATCTCGCTGGCCCTCCGTCTTTTCGGCAACATCTTCGCCGGCGGCATCCTGGTC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5040768 AAGCCGATCTCGCTGGCCCTCCGTCTTTTCGGCAACATCTTCGCCGGCGGCATCCTGGTC 5040709 Qy 601 GCGCTGATCGCCATGTTCCCCTGGTACATCCAGTGGTTCCCCAACGCCGTGTGGAAGACC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5040708 GCGCTGATCGCCATGTTCCCCTGGTACATCCAGTGGTTCCCCAACGCCGTGTGGAAGACC 5040649 Qy 661 TTCGACCTGTTCGTCGGCCTCATCCAGGCCTTCATCTTCTCGCTGCTGACGATCCTGTAC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5040648 TTCGACCTGTTCGTCGGCCTCATCCAGGCCTTCATCTTCTCGCTGCTGACGATCCTGTAC 5040589 Qy 721 TTCAGCCAGTCGATGGAACTGGACCACGAGGACCACTGACGAGCAACCCTGCTGGACCGA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5040588 TTCAGCCAGTCGATGGAACTGGACCACGAGGACCACTGACGAGCAACCCTGCTGGACCGA 5040529 Qy 781 ACAAATCCCTACGACCCGATCGACACGAACTCTGACGGCAACATTTACTGAGCCGCCAGT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5040528 ACAAATCCCTACGACCCGATCGACACGAACTCTGACGGCAACATTTACTGAGCCGCCAGT 5040469 Qy 841 TACCAAGGAGGAATAAAGGAATGGATCTCGATCCCAACGCCATCATCACGGCCGGCGCCC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5040468 TACCAAGGAGGAATAAAGGAATGGATCTCGATCCCAACGCCATCATCACGGCCGGCGCCC 5040409 Qy 901 TGATCGGCGGTGGATTGATCATGGGTGGCGGCGCCATCGGTGCCGGTATCGGCGACGGTA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5040408 TGATCGGCGGTGGATTGATCATGGGTGGCGGCGCCATCGGTGCCGGTATCGGCGACGGTA 5040349 Qy 961 TCGCGGGTAACGCGCTGATCTCGGGTATCGCCCGTCAGCCCGAGGCCCAGGGCCGGCTGT 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5040348 TCGCGGGTAACGCGCTGATCTCGGGTATCGCCCGTCAGCCCGAGGCCCAGGGCCGGCTGT 5040289 Qy 1021 TCACCCCGTTCTTCATCACCGTCGGTCTGGTGGAAGCCGCGTACTTCATCAACCTGGCCT 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5040288 TCACCCCGTTCTTCATCACCGTCGGTCTGGTGGAAGCCGCGTACTTCATCAACCTGGCCT 5040229 Qy 1081 TCATGGCGCTGTTCGTCTTCGCCACTCCTGGCCTTCAGTAATCCGCCGGCATGGGTGAAT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5040228 TCATGGCGCTGTTCGTCTTCGCCACTCCTGGCCTTCAGTAATCCGCCGGCATGGGTGAAT 5040169 Qy 1141 TCAGCGCAACGATCCTGGCGGCCAGCCAGGCAGCCGAGGAAGGCGGGGGCGGAAGCAACT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5040168 TCAGCGCAACGATCCTGGCGGCCAGCCAGGCAGCCGAGGAAGGCGGGGGCGGAAGCAACT 5040109 Qy 1201 TCCTGATCCCCAACGGCACCTTCTTCGCCGTGCTGATCATTTTCTTGATCGTGCTCGGCG 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5040108 TCCTGATCCCCAACGGCACCTTCTTCGCCGTGCTGATCATTTTCTTGATCGTGCTCGGCG 5040049 Qy 1261 TGATCTCGAAATGGGTTGTGCCACCGATCAGCAAGGTGCTGGCCGAGCGGGAAGCGATGC 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5040048 TGATCTCGAAATGGGTTGTGCCACCGATCAGCAAGGTGCTGGCCGAGCGGGAAGCGATGC 5039989 Qy 1321 TGGCCAAGACCGCAGCCGACAACCGCAAGTCCGCCGAGCAGGTCGCTGCGGCACAGGCGG 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5039988 TGGCCAAGACCGCAGCCGACAACCGCAAGTCCGCCGAGCAGGTCGCTGCGGCACAGGCGG 5039929 Qy 1381 ACTACGAGAAGGAAATGGCCGAGGCGCGTGCCCAGGCCTCGGCGCTTCGCGACGAGGCCC 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5039928 ACTACGAGAAGGAAATGGCCGAGGCGCGTGCCCAGGCCTCGGCGCTTCGCGACGAGGCCC 5039869 Qy 1441 GCGCGGCCGGTCGCTCGGTGGTCGACGAGAAGCGTGCACAAGCCAGTGGTGAGGTGGCCC 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5039868 GCGCGGCCGGTCGCTCGGTGGTCGACGAGAAGCGTGCACAAGCCAGTGGTGAGGTGGCCC 5039809 Qy 1501 AGACCCTGACCCAGGCGGACCAGCAGTTGTCCGCCCAGGGTGATCAGGTGCGCAGTGGCC 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5039808 AGACCCTGACCCAGGCGGACCAGCAGTTGTCCGCCCAGGGTGATCAGGTGCGCAGTGGCC 5039749 Qy 1561 TCGAGTCGTCGGTGGACGGGCTGTCAGCCAAGCTGGCCAGCAGGATCCTCGGCGTCGACG 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5039748 TCGAGTCGTCGGTGGACGGGCTGTCAGCCAAGCTGGCCAGCAGGATCCTCGGCGTCGACG 5039689 Qy 1621 TGAATTCAGGTGGGACACAGTAGATGTCGATTTTCATCGGACAGCTGATCGGCTTTGCCG 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5039688 TGAATTCAGGTGGGACACAGTAGATGTCGATTTTCATCGGACAGCTGATCGGCTTTGCCG 5039629 Qy 1681 TCATCGCGTTCATCATCGTCAAGTGGGTGGTGCCACCCGTACGGACCCTGATGCGTAACC 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5039628 TCATCGCGTTCATCATCGTCAAGTGGGTGGTGCCACCCGTACGGACCCTGATGCGTAACC 5039569 Qy 1741 AGCAGGAGGCCGTGCGTGCGGCGCTCGCCGAGAGTGCCGAGGCAGCCAAGAAGCTCGCTG 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5039568 AGCAGGAGGCCGTGCGTGCGGCGCTCGCCGAGAGTGCCGAGGCAGCCAAGAAGCTCGCTG 5039509 Qy 1801 ATGCCGACGCGATGCACGCCAAGGCGCTTGCCGACGCCAAGGCCGAGTCGGAGAAGGTCA 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5039508 ATGCCGACGCGATGCACGCCAAGGCGCTTGCCGACGCCAAGGCCGAGTCGGAGAAGGTCA 5039449 Qy 1861 CCGAGGAGGCCAAGCAGGACTCCGAGCGCATCGCCGCGCAGCTGTCCGAACAGGCCGGCT 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5039448 CCGAGGAGGCCAAGCAGGACTCCGAGCGCATCGCCGCGCAGCTGTCCGAACAGGCCGGCT 5039389 Qy 1921 CCGAGGCGGAGCGGATCAAGGCCCAAGGCGCACAGCAGATCCAGTTGATGCGCCAGCAGC 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5039388 CCGAGGCGGAGCGGATCAAGGCCCAAGGCGCACAGCAGATCCAGTTGATGCGCCAGCAGC 5039329 Qy 1981 TCATCCGTCAGCTGCGCACCGGGCTCGGCGCGGAGGCCGTGAACAAGGCCGCCGAGATCG 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5039328 TCATCCGTCAGCTGCGCACCGGGCTCGGCGCGGAGGCCGTGAACAAGGCCGCCGAGATCG 5039269 Qy 2041 TCCGGGCGCACGTCGCCGATCCGCAGGCACAGTCGGCCACCGTCGACCGCTTCCTGAGCG 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5039268 TCCGGGCGCACGTCGCCGATCCGCAGGCACAGTCGGCCACCGTCGACCGCTTCCTGAGCG 5039209 Qy 2101 AACTCGAGCAGATGGCGCCGTCGAGCGTCGTCATCGACACCGCCGCGACGAGCCGGCTGC 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5039208 AACTCGAGCAGATGGCGCCGTCGAGCGTCGTCATCGACACCGCCGCGACGAGCCGGCTGC 5039149 Qy 2161 GTGCCGCGAGCCGCCAATCGCTCGCGGCGCTGGTCGAGAAGTTCGACTCGGTCGCGGGCG 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5039148 GTGCCGCGAGCCGCCAATCGCTCGCGGCGCTGGTCGAGAAGTTCGACTCGGTCGCGGGCG 5039089 Qy 2221 GCCTCGACGCCGACGGGCTCACCAACCTCGCCGACGAACTGGCCTCGGTCGCGAAGCTGC 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5039088 GCCTCGACGCCGACGGGCTCACCAACCTCGCCGACGAACTGGCCTCGGTCGCGAAGCTGC 5039029 Qy 2281 TGCTGAGCGAGACCGCGCTCAACAAGCACCTGGCCGAGCCCACCGACGACAGCGCTCCCA 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5039028 TGCTGAGCGAGACCGCGCTCAACAAGCACCTGGCCGAGCCCACCGACGACAGCGCTCCCA 5038969 Qy 2341 AGGTGCGCCTGCTCGAGCGTCTGCTGTCGGACAAGGTCAGCGCCACCACGCTGGACCTGC 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5038968 AGGTGCGCCTGCTCGAGCGTCTGCTGTCGGACAAGGTCAGCGCCACCACGCTGGACCTGC 5038909 Qy 2401 TGCGCACCGCGGTGTCGAACCGCTGGTCGACCGAGTCGAACCTGATCGACGCCGTCGAGC 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5038908 TGCGCACCGCGGTGTCGAACCGCTGGTCGACCGAGTCGAACCTGATCGACGCCGTCGAGC 5038849 Qy 2461 ACACCGCACGCCTGGCCCTGCTCAAGCGCGCCGAGATCGCCGGTGAGGTCGACGAGGTCG 2520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5038848 ACACCGCACGCCTGGCCCTGCTCAAGCGCGCCGAGATCGCCGGTGAGGTCGACGAGGTCG 5038789 Qy 2521 AGGAGCAGCTGTTCCGCTTCGGCCGGGTCCTCGACGCCGAGCCGCGCCTGTCGGCACTGC 2580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5038788 AGGAGCAGCTGTTCCGCTTCGGCCGGGTCCTCGACGCCGAGCCGCGCCTGTCGGCACTGC 5038729 Qy 2581 TGAGCGACTACACCACCCCCGCGGAAGGTCGTGTCGCGCTGCTGGACAAGGCGCTCACCG 2640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5038728 TGAGCGACTACACCACCCCCGCGGAAGGTCGTGTCGCGCTGCTGGACAAGGCGCTCACCG 5038669 Qy 2641 GTCGCCCCGGCGTGAACCAGACGGCAGCGGCCCTGCTGTCGCAGACCGTCGGACTGCTCC 2700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5038668 GTCGCCCCGGCGTGAACCAGACGGCAGCGGCCCTGCTGTCGCAGACCGTCGGACTGCTCC 5038609 Qy 2701 GCGGCGAGCGCGCCGACGAGGCCGTCATCGATCTCGCCGAACTCGCGGTGTCCCGGCGAG 2760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5038608 GCGGCGAGCGCGCCGACGAGGCCGTCATCGATCTCGCCGAACTCGCGGTGTCCCGGCGAG 5038549 Qy 2761 GCGAGGTTGTGGCGCATGTGTCGGCCGCGGCCGAACTCAGCGACGCACAGCGCACGCGTC 2820 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5038548 GCGAGGTTGTGGCGCATGTGTCGGCCGCGGCCGAACTCAGCGACGCACAGCGCACGCGTC 5038489 Qy 2821 TGACCGAGGTGCTCTCCCGCATCTACGGCCGTCCGGTGTCCGTGCAACTCCACGTCGACC 2880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5038488 TGACCGAGGTGCTCTCCCGCATCTACGGCCGTCCGGTGTCCGTGCAACTCCACGTCGACC 5038429 Qy 2881 CGGAACTCCTCGGTGGCCTGTCGATCACGGTCGGTGACGAAGTGATCGACGGTTCCATCG 2940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5038428 CGGAACTCCTCGGTGGCCTGTCGATCACGGTCGGTGACGAAGTGATCGACGGTTCCATCG 5038369 Qy 2941 CCTCCCGTTTGGCCGCCGCGCAGACCGGCTTGCCGGACTGACTTGATCCACGAACCACCC 3000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5038368 CCTCCCGTTTGGCCGCCGCGCAGACCGGCTTGCCGGACTGACTTGATCCACGAACCACCC 5038309 Qy 3001 AAGAACTAGGTAGGAAGACGAAAAACCATGGCAGAGTTGACAATCTCGGCTGCTGATATC 3060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5038308 AAGAACTAGGTAGGAAGACGAAAAACCATGGCAGAGTTGACAATCTCGGCTGCTGATATC 5038249 Qy 3061 GAAGGTGCCATCGAGGACTACGTATCCTCGTTTTCCGCCGACACCGAGCGTGAAGAGATC 3120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5038248 GAAGGTGCCATCGAGGACTACGTATCCTCGTTTTCCGCCGACACCGAGCGTGAAGAGATC 5038189 Qy 3121 GGCACCGTCATCGACGCCGGTGACGGCATCGCCCACGTCGAGGGTCTGCCCTCGGTCATG 3180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5038188 GGCACCGTCATCGACGCCGGTGACGGCATCGCCCACGTCGAGGGTCTGCCCTCGGTCATG 5038129 Qy 3181 ACGCAGGAACTGCTCGAGTTCCCCGGCGGGGTCCTCGGCGTGGCACTGAACCTCGACGAG 3240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5038128 ACGCAGGAACTGCTCGAGTTCCCCGGCGGGGTCCTCGGCGTGGCACTGAACCTCGACGAG 5038069 Qy 3241 CACAGCGTCGGCGCCGTCATCCTGGGTGAGTTCGAGAAGATCGAAGAGGGCCAGCAGGTC 3300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5038068 CACAGCGTCGGCGCCGTCATCCTGGGTGAGTTCGAGAAGATCGAAGAGGGCCAGCAGGTC 5038009 Qy 3301 AAGCGGACCGGCGAGGTGCTCTCGGTCCCGGTCGGCGACGCCTTCCTGGGCCGCGTCGTC 3360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5038008 AAGCGGACCGGCGAGGTGCTCTCGGTCCCGGTCGGCGACGCCTTCCTGGGCCGCGTCGTC 5037949 Qy 3361 AACCCGCTGGGCCAGCCGATCGACGGCCAGGGCGACATCGCCGCCGAGACCCGCCGCGCC 3420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5037948 AACCCGCTGGGCCAGCCGATCGACGGCCAGGGCGACATCGCCGCCGAGACCCGCCGCGCC 5037889 Qy 3421 CTCGAGCTGCAGGCGCCTTCTGTGGTGCAGCGCCAGAGCGTGTCCGAGCCGCTGCAGACC 3480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5037888 CTCGAGCTGCAGGCGCCTTCTGTGGTGCAGCGCCAGAGCGTGTCCGAGCCGCTGCAGACC 5037829 Qy 3481 GGCATCAAGGCCATCGACGCCATGACCCCGATCGGCCGCGGTCAGCGCCAGCTGATCATC 3540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5037828 GGCATCAAGGCCATCGACGCCATGACCCCGATCGGCCGCGGTCAGCGCCAGCTGATCATC 5037769 Qy 3541 GGCGACCGCAAGACCGGCAAGACCGCCGTCTGCGTCGACACCATCCTCAACCAGCGTGAG 3600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5037768 GGCGACCGCAAGACCGGCAAGACCGCCGTCTGCGTCGACACCATCCTCAACCAGCGTGAG 5037709 Qy 3601 GCCTGGCTGACCGGCGACCCCAAGCAGCAGGTCCGCTGCGTCTACGTCGCCATCGGCCAG 3660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5037708 GCCTGGCTGACCGGCGACCCCAAGCAGCAGGTCCGCTGCGTCTACGTCGCCATCGGCCAG 5037649 Qy 3661 AAGGGCACCACCATCGCCAGCGTGAAGCGCGCGCTGGAAGAGGGCGGCGCCATGGAGTAC 3720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5037648 AAGGGCACCACCATCGCCAGCGTGAAGCGCGCGCTGGAAGAGGGCGGCGCCATGGAGTAC 5037589 Qy 3721 ACGACGATCGTCGCCGCCCCGGCATCCGACGCCGCAGGCTTCAAGTGGCTGGCCCCCTAC 3780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5037588 ACGACGATCGTCGCCGCCCCGGCATCCGACGCCGCAGGCTTCAAGTGGCTGGCCCCCTAC 5037529 Qy 3781 ACCGGCTCGGCCATCGGCCAGCACTGGATGTACAACGGCAAGCACGTCCTGATCGTGTTC 3840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5037528 ACCGGCTCGGCCATCGGCCAGCACTGGATGTACAACGGCAAGCACGTCCTGATCGTGTTC 5037469 Qy 3841 GACGACCTGTCCAAGCAGGCCGACGCCTACCGCGCGATCTCGCTGCTGCTGCGCCGCCCG 3900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5037468 GACGACCTGTCCAAGCAGGCCGACGCCTACCGCGCGATCTCGCTGCTGCTGCGCCGCCCG 5037409 Qy 3901 CCGGGCCGCGAGGCGTTCCCCGGTGACGTGTTCTACCTGCACTCGCGCCTGCTGGAGCGC 3960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5037408 CCGGGCCGCGAGGCGTTCCCCGGTGACGTGTTCTACCTGCACTCGCGCCTGCTGGAGCGC 5037349 Qy 3961 TGCGCGAAGCTGTCGGACGAACTCGGCGGCGGTTCGATGACGGGTCTGCCGATCATCGAG 4020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5037348 TGCGCGAAGCTGTCGGACGAACTCGGCGGCGGTTCGATGACGGGTCTGCCGATCATCGAG 5037289 Qy 4021 ACCAAGGCCAACGACATCTCGGCGTTCATCCCGACCAACGTCATCTCGATCACCGACGGC 4080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5037288 ACCAAGGCCAACGACATCTCGGCGTTCATCCCGACCAACGTCATCTCGATCACCGACGGC 5037229 Qy 4081 CAGTGCTTCCTGGAGTCCGACCTGTTCAACCAGGGTGTGCGGCCGGCCATCAACGTCGGT 4140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5037228 CAGTGCTTCCTGGAGTCCGACCTGTTCAACCAGGGTGTGCGGCCGGCCATCAACGTCGGT 5037169 Qy 4141 GTGTCGGTGTCCCGCGTCGGTGGCGCCGCCCAGATCAAGGCCATGAAAGAGGTCGCAGGC 4200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5037168 GTGTCGGTGTCCCGCGTCGGTGGCGCCGCCCAGATCAAGGCCATGAAAGAGGTCGCAGGC 5037109 Qy 4201 TCGCTGCGTCTGGACCTGTCGCAGTACCGCGAGCTGGAGGCCTTCGCGGCCTTCGCCTCG 4260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5037108 TCGCTGCGTCTGGACCTGTCGCAGTACCGCGAGCTGGAGGCCTTCGCGGCCTTCGCCTCG 5037049 Qy 4261 GACCTCGACGCCGCGTCGAAGGCCCAGCTGGACCGCGGTGCCCGCCTGGTCGAGCTGCTC 4320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5037048 GACCTCGACGCCGCGTCGAAGGCCCAGCTGGACCGCGGTGCCCGCCTGGTCGAGCTGCTC 5036989 Qy 4321 AAGCAGCCGCAGTACAGCCCGCTGGCCGTCGAGGAGCAGGTCGTCGCGATCTTCCTCGGC 4380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5036988 AAGCAGCCGCAGTACAGCCCGCTGGCCGTCGAGGAGCAGGTCGTCGCGATCTTCCTCGGC 5036929 Qy 4381 ACCCAGGGCCACCTGGATTCCGTTCCGGTCGAAGACGTTCAGCGCTTCGAGTCCGAGCTG 4440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5036928 ACCCAGGGCCACCTGGATTCCGTTCCGGTCGAAGACGTTCAGCGCTTCGAGTCCGAGCTG 5036869 Qy 4441 CTGGAGCACGTGAAGGCCAGCCACTCCGACATCTTCGACGGCATCCGTGAGACCAAGAAG 4500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5036868 CTGGAGCACGTGAAGGCCAGCCACTCCGACATCTTCGACGGCATCCGTGAGACCAAGAAG 5036809 Qy 4501 CTCTCCGAGGAAGCCGAGGAGAAGCTGGTCTCGGTCATCAACGAATTCAAGAAGGGCTTC 4560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5036808 CTCTCCGAGGAAGCCGAGGAGAAGCTGGTCTCGGTCATCAACGAATTCAAGAAGGGCTTC 5036749 Qy 4561 CAGGCCTCTGACGGCAGCTCGGTGGTCGTCTCCGAGAACGCCGAGGCCCTCGATCCCGAG 4620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5036748 CAGGCCTCTGACGGCAGCTCGGTGGTCGTCTCCGAGAACGCCGAGGCCCTCGATCCCGAG 5036689 Qy 4621 GACCTGGAGAAGGAATCCGTCAAGGTCCGCAAGCCGGCACCCAAGAAGGCCTAGGTAACA 4680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5036688 GACCTGGAGAAGGAATCCGTCAAGGTCCGCAAGCCGGCACCCAAGAAGGCCTAGGTAACA 5036629 Qy 4681 GATGGCAGCCACACTGCGCGAACTACGCGGGCGCATCCGCTCCGCCGGGTCGATCAAGAA 4740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5036628 GATGGCAGCCACACTGCGCGAACTACGCGGGCGCATCCGCTCCGCCGGGTCGATCAAGAA 5036569 Qy 4741 GATCACCAAGGCCCAGGAGCTGATCGCGACCTCGCGGATCGCCAAGGCGCAGGCACGGGT 4800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5036568 GATCACCAAGGCCCAGGAGCTGATCGCGACCTCGCGGATCGCCAAGGCGCAGGCACGGGT 5036509 Qy 4801 CGAAGCAGCCCGTCCCTATGCCGCCGAGATCACCAACATGCTCACCGAACTTGCGGGTGC 4860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5036508 CGAAGCAGCCCGTCCCTATGCCGCCGAGATCACCAACATGCTCACCGAACTTGCGGGTGC 5036449 Qy 4861 CAGTGCGCTGGACCACCCGCTGCTCGTGGAGCGCAAGCAGCCCAAGCGGGCCGGCGTGCT 4920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5036448 CAGTGCGCTGGACCACCCGCTGCTCGTGGAGCGCAAGCAGCCCAAGCGGGCCGGCGTGCT 5036389 Qy 4921 GGTGGTGTCGTCGGACCGCGGCCTGTGCGGTGCCTACAACGCCAACGTGCTGCGCCGCGC 4980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5036388 GGTGGTGTCGTCGGACCGCGGCCTGTGCGGTGCCTACAACGCCAACGTGCTGCGCCGCGC 5036329 Qy 4981 CGAGGAGCTGTTCTCGCTGCTGCGCGACGAGGGCAAGGACCCGGTGCTGTACGTGGTCGG 5040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5036328 CGAGGAGCTGTTCTCGCTGCTGCGCGACGAGGGCAAGGACCCGGTGCTGTACGTGGTCGG 5036269 Qy 5041 CCGTAAGGCGTTGGGCTACTTCAGCTTCCGGCAGCGCACCGTGGTCGAGTCGTGGACCGG 5100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5036268 CCGTAAGGCGTTGGGCTACTTCAGCTTCCGGCAGCGCACCGTGGTCGAGTCGTGGACCGG 5036209 Qy 5101 CTTCTCCGAGCGCCCGACCTACGAGAACGCCAGGGAGATCGCCGACACCTTGGTGAACGC 5160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5036208 CTTCTCCGAGCGCCCGACCTACGAGAACGCCAGGGAGATCGCCGACACCTTGGTGAACGC 5036149 Qy 5161 CTTCATGGCGGGCGCCGACGACGAGGGTGACGACGCGGGCGCCGACGGCATCCTCGGGGT 5220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5036148 CTTCATGGCGGGCGCCGACGACGAGGGTGACGACGCGGGCGCCGACGGCATCCTCGGGGT 5036089 Qy 5221 CGACGAACTGCACATCGTGTTCACCGAGTTCCGGTCGATGCTCTCGCAGACCGCGGTCGC 5280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5036088 CGACGAACTGCACATCGTGTTCACCGAGTTCCGGTCGATGCTCTCGCAGACCGCGGTCGC 5036029 Qy 5281 CCGTCGTGCCGCGCCGATGGAGGTCGAGTACGTCGGCGAGGTCGAGACCGGGCCGCGCAC 5340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5036028 CCGTCGTGCCGCGCCGATGGAGGTCGAGTACGTCGGCGAGGTCGAGACCGGGCCGCGCAC 5035969 Qy 5341 GCTCTACTCGTTCGAACCGGATCCGGAGACGCTGTTCGACGCGTTGTTGCCGCGCTACAT 5400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5035968 GCTCTACTCGTTCGAACCGGATCCGGAGACGCTGTTCGACGCGTTGTTGCCGCGCTACAT 5035909 Qy 5401 CGCGACCCGCGTGTACGCCGCACTTCTCGAGGCCGCAGCGTCCGAGTCGGCCTCGCGCCG 5460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5035908 CGCGACCCGCGTGTACGCCGCACTTCTCGAGGCCGCAGCGTCCGAGTCGGCCTCGCGCCG 5035849 Qy 5461 GCGCGCCATGAAGTCGGCCACCGACAACGCCGACGACCTCATCAAGGCGCTGACGCTGGC 5520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5035848 GCGCGCCATGAAGTCGGCCACCGACAACGCCGACGACCTCATCAAGGCGCTGACGCTGGC 5035789 Qy 5521 GGCGAACCGCGAGCGCCAGGCACAGATCACCCAGGAAATCAGCGAGATCGTCGGCGGCGC 5580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5035788 GGCGAACCGCGAGCGCCAGGCACAGATCACCCAGGAAATCAGCGAGATCGTCGGCGGCGC 5035729 Qy 5581 CAACGCGCTGGCCGGCTCGAAATAGGCTGAGAAGCAAGCCCCTTTCAGGAAGCGAAGAGA 5640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5035728 CAACGCGCTGGCCGGCTCGAAATAGGCTGAGAAGCAAGCCCCTTTCAGGAAGCGAAGAGA 5035669 Qy 5641 GAATGACTGCTACTGCAGAAAAGACCGCGGGTCGCGTAGTCCGCATCACCGGCCCGGTGG 5700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5035668 GAATGACTGCTACTGCAGAAAAGACCGCGGGTCGCGTAGTCCGCATCACCGGCCCGGTGG 5035609 Qy 5701 TGGACGTCGAATTCCCGCGTGGCTCTGTGCCCGAGCTGTTCAACGCGCTGCACGCCGAGA 5760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5035608 TGGACGTCGAATTCCCGCGTGGCTCTGTGCCCGAGCTGTTCAACGCGCTGCACGCCGAGA 5035549 Qy 5761 TCACGTTCGGTGCGCTCGCCAAGACCCTGACCCTCGAGGTCGCCCAGCACCTCGGTGACA 5820 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5035548 TCACGTTCGGTGCGCTCGCCAAGACCCTGACCCTCGAGGTCGCCCAGCACCTCGGTGACA 5035489 Qy 5821 GCCTGGTGCGCTGCATCTCCATGCAGCCCACCGACGGCCTGGTGCGTGGCGTCGAGGTCA 5880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5035488 GCCTGGTGCGCTGCATCTCCATGCAGCCCACCGACGGCCTGGTGCGTGGCGTCGAGGTCA 5035429 Qy 5881 CCGACACCGGCGCCTCGATCTCCGTCCCGGTCGGCGACGGCGTCAAGGGCCACGTGTTCA 5940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5035428 CCGACACCGGCGCCTCGATCTCCGTCCCGGTCGGCGACGGCGTCAAGGGCCACGTGTTCA 5035369 Qy 5941 ACGCGCTCGGCGACTGCCTCGACGATCCGGGCTACGGCAAGGACTTCGAGCACTGGTCGA 6000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5035368 ACGCGCTCGGCGACTGCCTCGACGATCCGGGCTACGGCAAGGACTTCGAGCACTGGTCGA 5035309 Qy 6001 TCCACCGCAAGCCGCCGGCCTTCTCTGACCTGGAGCCCCGCACCGAGATGCTGGAGACCG 6060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5035308 TCCACCGCAAGCCGCCGGCCTTCTCTGACCTGGAGCCCCGCACCGAGATGCTGGAGACCG 5035249 Qy 6061 GTCTGAAGGTCGTCGACCTGCTCACCCCGTACGTGCGTGGCGGCAAGATCGCCCTGTTCG 6120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5035248 GTCTGAAGGTCGTCGACCTGCTCACCCCGTACGTGCGTGGCGGCAAGATCGCCCTGTTCG 5035189 Qy 6121 GCGGCGCGGGCGTGGGCAAGACGGTTCTGATCCAGGAGATGATCAACCGTATCGCCCGCA 6180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5035188 GCGGCGCGGGCGTGGGCAAGACGGTTCTGATCCAGGAGATGATCAACCGTATCGCCCGCA 5035129 Qy 6181 ACTTCGGTGGTACCTCGGTGTTCGCCGGCGTGGGTGAGCGCACCCGTGAGGGCAACGACC 6240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5035128 ACTTCGGTGGTACCTCGGTGTTCGCCGGCGTGGGTGAGCGCACCCGTGAGGGCAACGACC 5035069 Qy 6241 TGTGGGTCGAGCTCGCCGACGCCAACGTGCTCAAGGACACCGCGTTGGTGTTCGGTCAGA 6300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5035068 TGTGGGTCGAGCTCGCCGACGCCAACGTGCTCAAGGACACCGCGTTGGTGTTCGGTCAGA 5035009 Qy 6301 TGGACGAGCCGCCGGGCACCCGTATGCGCGTCGCCCTGTCGGCCCTGACCATGGCCGAGT 6360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5035008 TGGACGAGCCGCCGGGCACCCGTATGCGCGTCGCCCTGTCGGCCCTGACCATGGCCGAGT 5034949 Qy 6361 TCTTCCGCGACGAGCAGGGCCAGGACGTGCTGCTGTTCATCGACAACATCTTCCGGTTCA 6420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5034948 TCTTCCGCGACGAGCAGGGCCAGGACGTGCTGCTGTTCATCGACAACATCTTCCGGTTCA 5034889 Qy 6421 CCCAGGCCGGTTCCGAGGTGTCGACCCTGCTGGGTCGTATGCCTTCGGCCGTGGGTTACC 6480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5034888 CCCAGGCCGGTTCCGAGGTGTCGACCCTGCTGGGTCGTATGCCTTCGGCCGTGGGTTACC 5034829 Qy 6481 AGCCGACGCTGGCCGACGAGATGGGTGAGCTGCAGGAGCGCATCACCTCGACCCGTGGTC 6540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5034828 AGCCGACGCTGGCCGACGAGATGGGTGAGCTGCAGGAGCGCATCACCTCGACCCGTGGTC 5034769 Qy 6541 GCTCCATCACCTCGATGCAGGCCGTGTACGTGCCCGCCGACGACTACACCGACCCGGCCC 6600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5034768 GCTCCATCACCTCGATGCAGGCCGTGTACGTGCCCGCCGACGACTACACCGACCCGGCCC 5034709 Qy 6601 CGGCGACGACGTTCGCCCACCTGGACGCCACCACCGAGCTCTCGCGTGCGGTGTTCTCGA 6660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5034708 CGGCGACGACGTTCGCCCACCTGGACGCCACCACCGAGCTCTCGCGTGCGGTGTTCTCGA 5034649 Qy 6661 AGGGCATCTTCCCGGCGGTGGATCCGCTGGCGTCGTCCTCGACCATCCTGGACCCGGCGA 6720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5034648 AGGGCATCTTCCCGGCGGTGGATCCGCTGGCGTCGTCCTCGACCATCCTGGACCCGGCGA 5034589 Qy 6721 TCGTCGGTGACGAGCACTACCGCGTCGCCCAGGAAGTCATCCGGATCCTGCAGCGCTACA 6780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5034588 TCGTCGGTGACGAGCACTACCGCGTCGCCCAGGAAGTCATCCGGATCCTGCAGCGCTACA 5034529 Qy 6781 AGGATCTCCAGGACATCATCGCGATCCTCGGTATCGACGAGCTGTCCGAAGAGGACAAGC 6840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5034528 AGGATCTCCAGGACATCATCGCGATCCTCGGTATCGACGAGCTGTCCGAAGAGGACAAGC 5034469 Qy 6841 AGCTGGTGAACCGGGCGCGTCGTATCGAGCGCTTCCTGAGCCAGAACATGATGGCCGCCG 6900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5034468 AGCTGGTGAACCGGGCGCGTCGTATCGAGCGCTTCCTGAGCCAGAACATGATGGCCGCCG 5034409 Qy 6901 AGCAGTTCACCGGTCAGCCGGGCTCGACCGTGCCGCTCAAGGAGACCATCGAGGCGTTCG 6960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5034408 AGCAGTTCACCGGTCAGCCGGGCTCGACCGTGCCGCTCAAGGAGACCATCGAGGCGTTCG 5034349 Qy 6961 ACAAGCTCACCAAGGGCGAGTTCGATCACCTGCCCGAGCAGGCGTTCTTCCTGATCGGTG 7020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5034348 ACAAGCTCACCAAGGGCGAGTTCGATCACCTGCCCGAGCAGGCGTTCTTCCTGATCGGTG 5034289 Qy 7021 GTCTGGACGACCTGGCGAAGAAGGCCGAGAGCCTCGGCGCCAAGCTGTGATTGCCATGTC 7080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5034288 GTCTGGACGACCTGGCGAAGAAGGCCGAGAGCCTCGGCGCCAAGCTGTGATTGCCATGTC 5034229 Qy 7081 CTTGAGCGTCCGAAAGGTGGTGTGGTGTGGCTGATCTGAACGTCGAGATCGTCGCCGTCG 7140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5034228 CTTGAGCGTCCGAAAGGTGGTGTGGTGTGGCTGATCTGAACGTCGAGATCGTCGCCGTCG 5034169 Qy 7141 AGCGTGAGCTCTGGTCCGGACCCGCTACGTTCGTGTTCACCCGCACCACCGCCGGTGAGA 7200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5034168 AGCGTGAGCTCTGGTCCGGACCCGCTACGTTCGTGTTCACCCGCACCACCGCCGGTGAGA 5034109 Qy 7201 TCGGCATCCTGCCGCGGCACATCCCGCTCGTGGCGCAGCTGGTCGACGACGCGATGGTTC 7260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5034108 TCGGCATCCTGCCGCGGCACATCCCGCTCGTGGCGCAGCTGGTCGACGACGCGATGGTTC 5034049 Qy 7261 GGGTCGAGCGCGAGGGCGAGGACGATCTGCGGATCGCGGTCGACGGCGGTTTCCTGTCGG 7320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5034048 GGGTCGAGCGCGAGGGCGAGGACGATCTGCGGATCGCGGTCGACGGCGGTTTCCTGTCGG 5033989 Qy 7321 TGACCGAGGAGACCGTCCGGATCCTCGTGGAGAACGCACAATTCGAGTCCGAGATCGACG 7380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5033988 TGACCGAGGAGACCGTCCGGATCCTCGTGGAGAACGCACAATTCGAGTCCGAGATCGACG 5033929 Qy 7381 CGGATGCTGCCAAGGAAGACGCAGCATCCGACGACGAGCGGACCGCGGCATGGGGCCGGG 7440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5033928 CGGATGCTGCCAAGGAAGACGCAGCATCCGACGACGAGCGGACCGCGGCATGGGGCCGGG 5033869 Qy 7441 CGCGGCTGCGCGCCCTCGGCCAGATCGACTAG 7472 |||||||||||||||||||||||||||||||| Db 5033868 CGCGGCTGCGCGCCCTCGGCCAGATCGACTAG 5033837 Conclusion No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ROBERT A ZEMAN whose telephone number is (571)272-0866. The examiner can normally be reached Monday thru Friday; 6:30 am - 3pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Heather Calamita can be reached at 571-272-2876. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ROBERT A ZEMAN/Primary Examiner, Art Unit 1645 May 29, 2026
Read full office action

Prosecution Timeline

Feb 09, 2024
Application Filed
Jun 03, 2026
Non-Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12667610
VACCINE COMPOSITION COMPRISING RECOMBINANT PROTEIN OF STAPHYLOCOCCUS AUREUS ATTENUATED ENTEROTOXIN AND CYTOTOXIN
4y 3m to grant Granted Jun 30, 2026
Patent 12667595
COMPOSITION FOR PREVENTING, IMPROVING OR TREATING BENIGN PROSTATIC HYPERPLASIA OR ALOPECIA, COMPRISING HEAT-KILLED PROBIOTICS AS ACTIVE INGREDIENT
3y 4m to grant Granted Jun 30, 2026
Patent 12653878
VACCINE COMPOSITION AGAINST STREPTOCOCCUS SUIS INFECTION
3y 10m to grant Granted Jun 16, 2026
Patent 12638447
Compositions, Methods, and Systems for Detecting Methicillin-Resistant Staphylococcus Aureus
5y 0m to grant Granted May 26, 2026
Patent 12637656
RECOMBINANT YEAST CAPABLE OF PRODUCING CAFFEIC ACID AND/OR FERULIC ACID
4y 0m to grant Granted May 26, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
54%
Grant Probability
82%
With Interview (+27.9%)
3y 8m (~1y 2m remaining)
Median Time to Grant
Low
PTA Risk
Based on 777 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month