DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicants’ election without traverse of Group I, claim1-15, in the reply filed on 14 May 2026 is acknowledged.
Applicants’ election without traversal of a single and specific scaffold strand, corresponding to the sequence as described in SEQ ID NO: 19 in the reply filed 14 May 2026 is acknowledged.
Applicants’ election without traversal of the staple strands corresponding to SEQ ID NOs: 20 and 21 in the reply filed 14 May 2026 is acknowledged.
Applicants’ election without traversal of the peptides, and peptide lengths, comprised in the staple strands corresponding to SEQ ID NO: 1 (9 amino acids), SEQ ID NO: 2 (10 amino acids), and SEQ ID NO: 3 (10 amino acids) in the reply filed 14 May 2026 is acknowledged.
Applicants’ election without traversal of the peptide-protein contact regions corresponding to SEQ ID NO: 1 (contact region IL-1RAcP position R157); SEQ ID NO: 2 (contact region IL-1RAcP position K238); and SEQ ID NO: 3 (contact region IL-1RAcP positions K343/K346) in the reply filed 14 May 2026 is acknowledged.
Claims 16-20 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 14 May 2026.
Claims 1-15 under consideration.
Status of Claims
The claim listing filed 05 September 2023 is pending. In response to the restriction requirement mailed on 17 March 2026, Applicant elected, without traverse, the invention of Group I, claims 1-15, is acknowledged. Claims 16-20 are withdrawn from further consideration for the reasons set forth above, 37 CFR 1.142(b). Claims 1-15, drawn to SEQ ID NO: 19, are being examined on the merits in this office action.
The search was expanded to the full scope of claim 1 as it pertains to the identity of the heteromultivalent nucleic acid scaffold. The closest match to the elected nucleic acid scaffold of SEQ ID NO: 19 is a sequence described by Venter et al. (US 2005/0208558 A1) with 40.3% sequence similarity.
PNG
media_image1.png
306
994
media_image1.png
Greyscale
The restriction between Groups I and II is maintained.
Priority
The present application claims benefit under 35 U.S.C. 119(e) to U.S. Provisional Application No. 63/403,897 filed 06 September 2022. Applicants claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, or 365 (c) is acknowledged.
Information Disclosure Statement
The Information Disclosure Statement (IDS) submitted on 14 May 2026 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the Information Disclosure Statement is being considered by the examiner.
Drawings
The drawings are objected to because the figures are illegible. One of ordinary skill in the art would be unable to tell what the figures are showing due to the poor quality. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency - This application fails to comply with the requirements of 37 CFR 1.831-1.834 because it does not contain a “Sequence Listing XML” as a separate part of the disclosure. A “Sequence Listing XML” is required because claim 8 contains three formulas, where all three formulas comprise more than 4 amino acids. Per MPEP §2422, sequences containing more than 4 or more amino acids must be assigned a SEQ ID NO:.
Required response - Applicant must provide:
• A “Sequence Listing XML” part of the disclosure, as described above in item 1. or 2.; together with
o A statement that indicates the basis for the amendment, with specific references to particular parts of the application as originally filed, as required by 37 CFR 1.835(a)(3);
o A statement that the “Sequence Listing XML” includes no new matter as required by 37 CFR 1.835(a)(4)
AND
• A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required incorporation by reference paragraph as required by 37 CFR 1.835(a)(2), consisting of:
o A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
o A copy of the amended specification without markings (clean version); and
o A statement that the substitute specification contains no new matter.
Claim Objections
Claim 8 is objected to because of the following informalities:
Claim 8 states “The heteromultivalent nucleic acid scaffold of claim 1, … wherein the first peptide is Ac-C-K(N3)-EYGIQRITC-NH2, the second peptide is Ac-A-K(N3)-VGSPKNAVPPC-NH2, and the third peptide is Ac-C-K(N3)-GEVAKAAKVKC-NH2.”. The peptides as described in the instant claim 8 comprise 4 or more amino acids, meaning they must be assigned a SEQ ID NO:, per MPEP §2422. Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 8 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 8 recites “wherein the first peptide is Ac-C-K(N3)-EYGIQRITC-NH2, the second peptide is Ac-A-K(N3)-VGSPKNAVPPC-NH2, and the third peptide is Ac-C-K(N3)-GEVAKAAKVKC-NH2.”. The claim is indefinite because it is unclear what “wherein the first peptide is Ac-C-K(N3)-EYGIQRITC-NH2, the second peptide is Ac-A-K(N3)-VGSPKNAVPPC-NH2, and the third peptide is Ac-C-K(N3)-GEVAKAAKVKC-NH2” is meant to represent. The specification shows Ac-C-K(N3)-EYGIQRITC-NH2, Ac-A-K(N3)-VGSPKNAVPPC-NH2, and Ac-C-K(N3)-GEVAKAAKVKC-NH2 to correspond to SEQ ID NOs: 16-18, respectively; however, the claim does not recite these sequences and it is improper to read limitations from the specification into the claims. Appropriate correction is required.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-2, 9, and 11-12 are rejected under 35 U.S.C. 103 as being unpatentable over Wang et al., hereafter “Wang” (“The Beauty and Utility of DNA Origami.” Chem. 2. 359-382. 9 March 2017; 10.1016/j.chempr.2017.02.009.) and Gietl et al., hereafter “Gietl” (“DNA origami as biocompatible surface to match single-molecule and ensemble experiments.” Nucleic Acids Res. 2012 Aug;40(14):e110. doi: 10.1093/nar/gks326. Epub 2012 Apr 20. PMID: 22523083; PMCID: PMC3413134.).
Regarding claim 1, Wang teaches a nucleic acid scaffold (DNA origami) comprising a scaffold strand and hundreds of staple strands (pg. 359, “DNA origami is a process of molecular self-folding: a long single-stranded DNA (scaffold), typically M13 phage genomic DNA (∼7,000 bp), is folded into prescribed objects by hundreds of short synthetic DNA oligonucleotides, typically 20–60 bp long, which are designed to be complementary to different parts of the scaffold DNA (Figure 1A). The synthetic DNA strands crosslink spatially distant segments of a scaffold together, hence the term “staples.””).
Wang does not teach each staple strand comprising a peptide.
Gietl teaches DNA origami comprising a scaffold strand and hundreds of staple strands, while also teaching that extending staple strands with the sequence of interest allows for hybridization and self-assembly (pg. 2, “DNA origami structures are based on a ‘scaffold’ DNA strand (the single-stranded DNA genome of bacteriophage M13), which can be folded into 2D and 3D assemblies at the nanometre scale with the help of hundreds of short oligonucleotides called ‘staple strands’ (24). … staple (‘anchor strand’) strand is extended by a sequence of interest that allows hybridization with complementary sequences to form a specific and functional DNA structure. The assembly of a DNA origami including modified staple strands, oligonucleotides complementary to the anchor staple strand and additional oligonucleotides required for the functional DNA entity follows the same convenient protocol of temperature-controlled self-assembly described.”).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify Wang’s teachings with Gietl’s teachings because both references teach DNA origami comprising a scaffold strand and hundreds of staple strands. Gietl teaches that extending staple strands with the sequence of interest allows for hybridization and self-assembly. The combination of references would have had a reasonable expectation of success due to both references teaching DNA origami and Gietl teaching the benefits of adding sequences to staple strands.
Therefore, it would have been prima facie obvious to the artisan of ordinary skill in the art at the time before the effective filling date of the claimed invention.
Regarding the limitation “wherein each peptide specifically contacts a different region of a protein, thereby binding the multivalent nucleic acid scaffold to the protein”, a recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. If the prior art peptide is capable of performing the intended use, then it meets the claim. The scaffold as described by Wang and Gietl meets the limitations as described in the instant claim 1, thus it is interpreted as being sufficient enough to have the peptide contact a different region of a protein, thereby binding the multivalent nucleic acid scaffold to the protein as described in the instant claim.
Regarding claim 2, Wang teaches the scaffold strand being a long single stranded DNA molecule (pg. 359, “DNA origami is a process of molecular self-folding: a long single-stranded DNA (scaffold)…”).
Regarding claim 9, regarding the limitation “wherein the binding of the multivalent nucleic acid scaffold to the protein prevents or disrupts association of the protein with a binding partner by mimicking at least two different protein-protein interaction hotspots with which the protein interacts with the binding partner”, a recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. If the prior art scaffold is capable of performing the intended use, then it meets the claim. The scaffold as described by Wang and Gietl is meets the limitations as described in the instant claim 1, thus it is interpreted as being sufficient for preventing or disrupting the association of the protein with a binding partner by mimicking protein-protein interactions as described in the instant claim.
Regarding claim 11, regarding the limitation “wherein each peptide is capable of preventing or disrupting association of IL1RAcP with an ST2/IL3 complex at a surface of a cell”, a recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. If the prior art peptide is capable of performing the intended use, then it meets the claim. The scaffold as described by Wang and Gietl meets the limitations as described in the instant claim 1, thus it is interpreted as being sufficient for preventing or disrupting association of IL1RAcP with an ST2/IL3 complex at a surface of a cell as described in the instant claim.
Regarding claim 12, regarding the limitation “wherein each peptide, independently, targets position R157, K238, K343, and/or K346 of IL1RAcP (SEQ ID NO: 31)”, a recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. If the prior art peptide is capable of performing the intended use, then it meets the claim. The scaffold as described by Wang and Gietl meets the limitations as described in the instant claim 11, thus it is interpreted as the comprised peptides being sufficient for targeting position R157, K238, K343, and/or K346 of IL1RAcP (SEQ ID NO: 31) as described in the instant claim.
Claim 3 is rejected under 35 U.S.C. 103 as being unpatentable over Wang et al., hereafter “Wang” (“The Beauty and Utility of DNA Origami.” Chem. 2. 359-382. 9 March 2017; 10.1016/j.chempr.2017.02.009.) and Gietl et al., hereafter “Gietl” (“DNA origami as biocompatible surface to match single-molecule and ensemble experiments.” Nucleic Acids Res. 2012 Aug;40(14):e110. doi: 10.1093/nar/gks326. Epub 2012 Apr 20. PMID: 22523083; PMCID: PMC3413134.), as applied to claim 2 above, and further in view of Knappe et al., hereafter “Knappe” (“In Situ Covalent Functionalization of DNA Origami Virus-like Particles.” ACS Nano 28 September 2021; 15 (9): 14316–14322. https://doi.org/10.1021/acsnano.1c03158.).
Regarding claim 3, Wang teaches a nucleic acid scaffold (DNA origami) comprising a scaffold strand and hundreds of staple strands (pg. 359, “DNA origami is a process of molecular self-folding: a long single-stranded DNA (scaffold), typically M13 phage genomic DNA (∼7,000 bp), is folded into prescribed objects by hundreds of short synthetic DNA oligonucleotides, typically 20–60 bp long, which are designed to be complementary to different parts of the scaffold DNA (Figure 1A). The synthetic DNA strands crosslink spatially distant segments of a scaffold together, hence the term “staples.””).
Wang and Gietl do not teach the scaffold strand and/or the at least two staples strands, independently, each is PEGylated.
Knappe teaches the PEGylation of the scaffold strand of a DNA origami nanostructure (pg. 14316,“ This platform should provide broader access to covalently functionalized DNA origami, as illustrated here by PEGylation”; See pg. 14319, Figure 3A). Knappe also teaches that PEGylation is used to passivate therapeutics, increase circulation time, inhibit nuclease activity, and protect against endonucleases (pg. 14318, “PEGylation is commonly used to passivate therapeutic materials, increase circulation time, and inhibit nuclease activity. To inhibit exonuclease activity, researchers have incorporated hexaethylene glycol onto 3′/5′-termini in DNA nanostructures. PEGylation was also implemented noncovalently into DNA origami through the electrostatic complexation of poly-(lysine)-co-poly-(ethylene glycol) block copolymers to the DNA origami surface, (54) resulting in protection against endonucleases.”).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify Wang’s teachings with Knappe’s teachings because both references teach DNA origami comprising a scaffold strand and at least two staple strands. Knappe teaches that the PEGylation of DNA origami results in passivated therapeutics, increased circulation time, inhibited nuclease activity, and protects against endonucleases. The combinations would have had a reasonable expectation of success due to both references teaching DNA origami and Knappe teaching the benefits of PEGylation.
Therefore, it would have been prima facie obvious to the artisan of ordinary skill in the art at the time before the effective filling date of the claimed invention.
Claim 4 is rejected under 35 U.S.C. 103 as being unpatentable over Wang et al., hereafter “Wang” (“The Beauty and Utility of DNA Origami.” Chem. 2. 359-382. 9 March 2017; 10.1016/j.chempr.2017.02.009.) and Gietl et al., hereafter “Gietl” (“DNA origami as biocompatible surface to match single-molecule and ensemble experiments.” Nucleic Acids Res. 2012 Aug;40(14):e110. doi: 10.1093/nar/gks326. Epub 2012 Apr 20. PMID: 22523083; PMCID: PMC3413134.), as applied to claim 1 above, and further in view of Michelotti et al., hereafter “Michelotti” (“Beyond DNA origami: the unfolding prospects of nucleic acid nanotechnology.” Wiley Interdiscip Rev Nanomed Nanobiotechnol. 2012 Mar-Apr;4(2):139-52. doi: 10.1002/wnan.170. Epub 2011 Nov 30. PMID: 22131292; PMCID: PMC3360889.).
Regarding claim 4, Wang teaches a nucleic acid scaffold (DNA origami) comprising a scaffold strand and hundreds of staple strands (pg. 359, “DNA origami is a process of molecular self-folding: a long single-stranded DNA (scaffold), typically M13 phage genomic DNA (∼7,000 bp), is folded into prescribed objects by hundreds of short synthetic DNA oligonucleotides, typically 20–60 bp long, which are designed to be complementary to different parts of the scaffold DNA (Figure 1A). The synthetic DNA strands crosslink spatially distant segments of a scaffold together, hence the term “staples.””).
Wang and Gietl do not teach the scaffold strand and/or the at least two staples strands, independently, each comprises peptide nucleic acids (PNA) or phosphorothioate-polymerized nucleotides.
Michelotti teaches DNA origami is defined as one long DNA strand held in place by hundreds of DNA “staples” (pg. 1, “DNA origami transformed the field by providing a versatile platform for self-assembly of arbitrary shapes from one long DNA strand held in place by hundreds of short, site-specific (spatially addressable) DNA ”staples”.”). Michelotti teaches that the addition of peptide nucleic acids (PNA) results in a higher thermal stability between PNA/DNA strands than between DNA/DNA strands, while also teaching that PNA has an uncharged nature and nuclease resistance (pg. 3, “Nucleic acids undergo chemical base modifications in vivo, impacting their cellular functions. … As a more drastic modification, peptide nucleic acids (PNA) have an uncharged backbone of N-(2-aminoethyl)-glycine units joined by a peptide bond, resulting in higher thermal stability between PNA/DNA strands than corresponding DNA/DNA strands (Figure 1b). The uncharged nature and nuclease resistance of PNA make it an appealing option for nanodevices and 2D nucleic acid arrays.”).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify Wang’s teachings with Michelotti’s teachings because both references teach DNA origami comprising a scaffold strand and at least two staple strands. Michelotti teaches that the addition of peptide nucleic acids (PNA) results in a higher thermal stability between PNA/DNA strands than between DNA/DNA strands, while also teaching that PNA has an uncharged nature and nuclease resistance. The combinations would have had a reasonable expectation of success due to both references teaching DNA origami and Michelotti teaching the benefits of adding PNA to DNA strands in nucleic acid scaffolds.
Therefore, it would have been prima facie obvious to the artisan of ordinary skill in the art at the time before the effective filling date of the claimed invention.
Claim 5 is rejected under 35 U.S.C. 103 as being unpatentable over Wang et al., hereafter “Wang” (“The Beauty and Utility of DNA Origami.” Chem. 2. 359-382. 9 March 2017; 10.1016/j.chempr.2017.02.009.) and Gietl et al., hereafter “Gietl” (“DNA origami as biocompatible surface to match single-molecule and ensemble experiments.” Nucleic Acids Res. 2012 Aug;40(14):e110. doi: 10.1093/nar/gks326. Epub 2012 Apr 20. PMID: 22523083; PMCID: PMC3413134.), as applied to claim 1 above, and further in view of Huang et al., hereafter “Huang” (“Arranging Small Molecules with Subnanometer Precision on DNA Origami Substrates for the Single-Molecule Investigation of Protein–Ligand Interactions.” (2020) Small Struct., 1: 2000038. https://doi.org/10.1002/sstr.202000038.).
Regarding claim 5, Wang teaches a nucleic acid scaffold (DNA origami) comprising a scaffold strand and hundreds of staple strands (pg. 359, “DNA origami is a process of molecular self-folding: a long single-stranded DNA (scaffold), typically M13 phage genomic DNA (∼7,000 bp), is folded into prescribed objects by hundreds of short synthetic DNA oligonucleotides, typically 20–60 bp long, which are designed to be complementary to different parts of the scaffold DNA (Figure 1A). The synthetic DNA strands crosslink spatially distant segments of a scaffold together, hence the term “staples.””).
Gietl teaches DNA origami comprising a scaffold strand and hundreds of staple strands, while also teaching that extending staple strands with the sequence of interest allows for hybridization and self-assembly (pg. 2, “DNA origami structures are based on a ‘scaffold’ DNA strand (the single-stranded DNA genome of bacteriophage M13), which can be folded into 2D and 3D assemblies at the nanometre scale with the help of hundreds of short oligonucleotides called ‘staple strands’ (24). … staple (‘anchor strand’) strand is extended by a sequence of interest that allows hybridization with complementary sequences to form a specific and functional DNA structure. The assembly of a DNA origami including modified staple strands, oligonucleotides complementary to the anchor staple strand and additional oligonucleotides required for the functional DNA entity follows the same convenient protocol of temperature-controlled self-assembly described.”).
Wang and Gietl do not teach at least one staple strand comprising a small molecule.
Huang teaches a DNA origami comprising a scaffold strand and hundreds of modified staple strands, which were modified by adding the small molecules 4-aminobenzamidine (B) and 3-iodophenyl isothiocyanate (I) (pg. 2, “The two ligands B and I are attached to the 5′ and 3′ ends of two neighboring staples in the DNA origami triangle, respectively.”; See pg. 2, Figure 1). Huang also teaches that the addition of B- and I- binders, known trypsin binders, resulted in high monodentate trypsin binding (pg. 8, “However, as we could further demonstrate in this work, the anchoring of small-molecule ligands to a DNA origami surface itself may affect protein binding. For instance, surprisingly high monodentate trypsin binding yields have been determined for ligand I, which may even overcome those of the much stronger trypsin binder B. ”).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify Wang and Gietl’s teachings with Huang’s teachings because Huang teaching that adding small binding molecules to the staple strands of DNA origami results in increased binding. One of ordinary skill in the art would be motivated to modify the teachings of Wang and Gietl with the teachings of Huang because adding a protein binder to the staple strand would result in more bonding.
Claim 6 is rejected under 35 U.S.C. 103 as being unpatentable over Wang et al., hereafter “Wang” (“The Beauty and Utility of DNA Origami.” Chem. 2. 359-382. 9 March 2017; 10.1016/j.chempr.2017.02.009.), Gietl et al., hereafter “Gietl” (“DNA origami as biocompatible surface to match single-molecule and ensemble experiments.” Nucleic Acids Res. 2012 Aug;40(14):e110. doi: 10.1093/nar/gks326. Epub 2012 Apr 20. PMID: 22523083; PMCID: PMC3413134.) and Huang et al., hereafter “Huang” (“Arranging Small Molecules with Subnanometer Precision on DNA Origami Substrates for the Single-Molecule Investigation of Protein–Ligand Interactions. Small Struct.”, 26 August 2020, 1: 2000038. https://doi.org/10.1002/sstr.202000038), as applied to claim 5 above, and further in view of Bathe et al., hereafter “Bathe”( US 2020/0237903 A1).
Regarding claim 6, Wang teaches a nucleic acid scaffold (DNA origami) comprising a scaffold strand and hundreds of staple strands (pg. 359, “DNA origami is a process of molecular self-folding: a long single-stranded DNA (scaffold), typically M13 phage genomic DNA (∼7,000 bp), is folded into prescribed objects by hundreds of short synthetic DNA oligonucleotides, typically 20–60 bp long, which are designed to be complementary to different parts of the scaffold DNA (Figure 1A). The synthetic DNA strands crosslink spatially distant segments of a scaffold together, hence the term “staples.””).
Gietl teaches DNA origami comprising a scaffold strand and hundreds of staple strands, while also teaching that extending staple strands with the sequence of interest allows for hybridization and self-assembly (pg. 2, “DNA origami structures are based on a ‘scaffold’ DNA strand (the single-stranded DNA genome of bacteriophage M13), which can be folded into 2D and 3D assemblies at the nanometre scale with the help of hundreds of short oligonucleotides called ‘staple strands’ (24). … staple (‘anchor strand’) strand is extended by a sequence of interest that allows hybridization with complementary sequences to form a specific and functional DNA structure. The assembly of a DNA origami including modified staple strands, oligonucleotides complementary to the anchor staple strand and additional oligonucleotides required for the functional DNA entity follows the same convenient protocol of temperature-controlled self-assembly described.”).
Wang and Gietl do not teach at least one staple strand comprising a small molecule.
Huang teaches a DNA origami comprising a scaffold strand and hundreds of modified staple strands, which were modified by adding the small molecules 4-aminobenzamidine (B) and 3-iodophenyl isothiocyanate (I) (pg. 2, “The two ligands B and I are attached to the 5′ and 3′ ends of two neighboring staples in the DNA origami triangle, respectively.”; See pg. 2, Figure 1). Huang also teaches that the addition of B- and I- binders, known trypsin binders, resulted in high monodentate trypsin binding (pg. 8, “However, as we could further demonstrate in this work, the anchoring of small-molecule ligands to a DNA origami surface itself may affect protein binding. For instance, surprisingly high monodentate trypsin binding yields have been determined for ligand I, which may even overcome those of the much stronger trypsin binder B. ”).
Wang, Gietl and Huang do not teach the peptide being attached using copper-free click chemistry and staple overhangs.
Bathe teaches that additional nucleotides can be added to staple strands at either end via modifying the staple overhangs and using click chemistry resulting in a functionalized staple overhang that can hybridize to a nucleic acid sequence (col. lines. “Additional nucleotides can be added to the staple strand at either 5′ end or 3′ end, and those are referred to as “staple overhangs”. Staple overhangs can be functionalized to have desired properties such as a specific sequence to hybridize to a target nucleic acid sequence, or a targeting element. … In some instances, the staple overhang can be also modified with chemical moieties. Non-limiting examples include CLICK-chemistry groups (e.g., azide group, alkyne group, DIBO/DBCO)”).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify Wang, Gietl and Huang’s teachings with Bathe’s teachings because all three references teach DNA origami, Huang teaches that adding small binding molecules to the staple strands of DNA origami results in increased binding and Bathe teaches that the addition of nucleotides can be done using click-chemistry groups like azide and alkyne groups. One of ordinary skill in the art would be motivated to modify the teachings of Wang, Gietl, and Huang with Bathe’s teachings because adding a nucleotide via click-chemistry via a staple overhang is a method known in the art.
Claim 7 is rejected under 35 U.S.C. 103 as being unpatentable over Wang et al., hereafter “Wang” (“The Beauty and Utility of DNA Origami.” Chem. 2. 359-382. 9 March 2017; 10.1016/j.chempr.2017.02.009.) and Gietl et al., hereafter “Gietl” (“DNA origami as biocompatible surface to match single-molecule and ensemble experiments.” Nucleic Acids Res. 2012 Aug;40(14):e110. doi: 10.1093/nar/gks326. Epub 2012 Apr 20. PMID: 22523083; PMCID: PMC3413134.), as applied to claim 1 above, and further in view of Deyle et al., hereafter “Deyle” (“Phage Selection of Cyclic Peptides for Application in Research and Drug Development.” Acc Chem Res. 2017 Aug 15;50(8):1866-1874. doi: 10.1021/acs.accounts.7b00184. Epub 2017 Jul 18. PMID: 28719188.).
Regarding claim 7, Wang teaches a nucleic acid scaffold (DNA origami) comprising a scaffold strand and hundreds of staple strands (pg. 359, “DNA origami is a process of molecular self-folding: a long single-stranded DNA (scaffold), typically M13 phage genomic DNA (∼7,000 bp), is folded into prescribed objects by hundreds of short synthetic DNA oligonucleotides, typically 20–60 bp long, which are designed to be complementary to different parts of the scaffold DNA (Figure 1A). The synthetic DNA strands crosslink spatially distant segments of a scaffold together, hence the term “staples.””).
Gietl teaches DNA origami comprising a scaffold strand and hundreds of staple strands, while also teaching that extending staple strands with the sequence of interest allows for hybridization and self-assembly (pg. 2, “DNA origami structures are based on a ‘scaffold’ DNA strand (the single-stranded DNA genome of bacteriophage M13), which can be folded into 2D and 3D assemblies at the nanometre scale with the help of hundreds of short oligonucleotides called ‘staple strands’ (24). … staple (‘anchor strand’) strand is extended by a sequence of interest that allows hybridization with complementary sequences to form a specific and functional DNA structure. The assembly of a DNA origami including modified staple strands, oligonucleotides complementary to the anchor staple strand and additional oligonucleotides required for the functional DNA entity follows the same convenient protocol of temperature-controlled self-assembly described.”).
Wang and Gietl do not teach each peptide being a cyclized peptide.
Deyle teaches that cyclic peptides can bind to protein targets with high affinities which makes them attractive for research and therapeutics (pg. 1866, “Cyclic peptides can bind to protein targets with high affinities and selectivities, which makes them an attractive modality for the development of research reagents and therapeutics.”).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify Wang and Gietl ’s teachings with Deyle’s teachings because Wang and Gietl teach DNA origami comprising a scaffold strand and hundreds of staple strands. Gietl teaches that extending staple strands with the sequence of interest allows for hybridization and self-assembly and Deyle teaches that cyclic peptides bind to their protein targets with high affinities which makes them attractive for research and therapeutics. One of ordinary skill in the art would be motivated to modify the teachings of Wang and Gietl with the teachings of Deyle the high binding affinity of cyclic peptides is known in the art.
Claims 8, 10, and 13 are rejected under 35 U.S.C. 103 as being unpatentable over Wang et al., hereafter “Wang” (“The Beauty and Utility of DNA Origami.” Chem. 2. 359-382. 9 March 2017; 10.1016/j.chempr.2017.02.009.) and Gietl et al., hereafter “Gietl” (“DNA origami as biocompatible surface to match single-molecule and ensemble experiments.” Nucleic Acids Res. 2012 Aug;40(14):e110. doi: 10.1093/nar/gks326. Epub 2012 Apr 20. PMID: 22523083; PMCID: PMC3413134.), as applied to claim 1 above, and further in view of Liberg et al., hereafter “Liberg” (US 11,479,610 B2) and Bathe et al., hereafter “Bathe”( US 2020/0237903 A1).
Regarding claim 8, Wang teaches a nucleic acid scaffold (DNA origami) comprising a scaffold strand and hundreds of staple strands (pg. 359, “DNA origami is a process of molecular self-folding: a long single-stranded DNA (scaffold), typically M13 phage genomic DNA (∼7,000 bp), is folded into prescribed objects by hundreds of short synthetic DNA oligonucleotides, typically 20–60 bp long, which are designed to be complementary to different parts of the scaffold DNA (Figure 1A). The synthetic DNA strands crosslink spatially distant segments of a scaffold together, hence the term “staples.””).
Wang does not teach the two staple strands comprise a first staple strand comprising a first peptide, a second staple strand comprising a second peptide, and a third staple strand comprising a third peptide, and wherein the first peptide is Ac-C-K(N3)-EYGIQRITC-NH2, the second peptide is Ac-A-K(N3)-VGSPKNAVPPC-NH2, and the third peptide is Ac-C-K(N3)-GEVAKAAKVKC-NH2.
Liberg discloses a peptide that comprises the amino acid sequence “EYGIQRITC” and partially amino acid sequences “VGSPKNAVPPC” and “GEVAKAAKVKC”. See the peptide represented by SEQ ID NO: 37, ; col. 116, lines 5-11 “SEQ ID NO: 37 - Full-length human IL1RAP – MTLLWCVVSLYFYGILQSDASERCDDWGLDTMRQIQVFEDEPARIKCPLFEHFLKFNYSTAHSAGLTLIWYWTRQDRDLEEPINFRLPENRISKEKDVLWFRPTLLNDTGNYTCMLRNTTYCSKVAFPLEVVQKDSCFNSPMKLPVHKLYIEYGIQRITCPNVDGYFPSSVKPTITWYMGCYKIQNFNNVIPEGMNLSFLIALISNNGNYTCVVTYPENGRTFHLTRTLTVKVVGSPKNAVPPVIHSPNDHVVYEKEPGEELLIPCTVYFSFLMDSRNEVWWTIDGKKPDDITIDVTINESISHSRTEDETRTQILSIKKVTSEDLKRSYVCHARSAKGEVAKAAKVKQKGNRCGQ”.
Liberg does not teach the peptides having N-terminal acetylation or C-terminus amidation.
Adessi teaches that most L-amino acids peptides degrade rapidly when they have free N- and C- termini and that the acetylation and amidation of those termini are essential to biological stability and activity (pg. 967, “Most L-amino acid peptides with free N- and C- termini are degraded rapidly, usually within a few minutes. … Acetylation and amidation are essential to the biological stability and activity of many neuropeptides. The end-protection strategy has been widely used to improve enzymatic stability in peptide drug development. For example, the in vivo half-life of the N-terminal acetylated somatostatin analogue was improved from 3 minutes for the natural peptide to more than 400 minutes”).
Liberg and Adessi do not teach the peptides being connected to the N-terminal acetylation via an azidolysine.
Bathe teaches that additional nucleotides can be added to staple strands at either end via modifying the staple overhangs and using click chemistry resulting in a functionalized staple overhang that can hybridize to a nucleic acid sequence (col. lines. “Additional nucleotides can be added to the staple strand at either 5′ end or 3′ end, and those are referred to as “staple overhangs”. Staple overhangs can be functionalized to have desired properties such as a specific sequence to hybridize to a target nucleic acid sequence, or a targeting element. … In some instances, the staple overhang can be also modified with chemical moieties. Non-limiting examples include CLICK-chemistry groups (e.g., azide group, alkyne group, DIBO/DBCO)”).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify Wang and Gietl’s teachings with Bathe’s teachings because all three references teach DNA origami and Bathe teaches that the addition of nucleotides can be done using click-chemistry groups like azide and alkyne groups and that the addition can be functionalized to have desired properties such as a specific sequence to hybridize to a target nucleic acid sequence. One of ordinary skill in the art would be motivated to modify the teachings of Wang and Gietl’s teachings with Bathe because adding a nucleotide via click-chemistry via a staple overhang is a method known in the art.
Regarding claim 10, the peptides as described, either in its entirety or in part, above by Liberg comprise about 5 to about 15 amino acids each (col. 116, lines. 5-11; SEQ ID NO: 37).
Regarding claim 13, Liberg teaches a peptide that comprises the amino acid sequence “EYGIQRITC” and partially amino acid sequences “VGSPKNAVPPC” and “GEVAKAAKVKC”. See the peptide represented by SEQ ID NO: 37, ; col. 116, lines 5-11 “SEQ ID NO: 37 - Full-length human IL1RAP – MTLLWCVVSLYFYGILQSDASERCDDWGLDTMRQIQVFEDEPARIKCPLFEHFLKFNYSTAHSAGLTLIWYWTRQDRDLEEPINFRLPENRISKEKDVLWFRPTLLNDTGNYTCMLRNTTYCSKVAFPLEVVQKDSCFNSPMKLPVHKLYIEYGIQRITCPNVDGYFPSSVKPTITWYMGCYKIQNFNNVIPEGMNLSFLIALISNNGNYTCVVTYPENGRTFHLTRTLTVKVVGSPKNAVPPVIHSPNDHVVYEKEPGEELLIPCTVYFSFLMDSRNEVWWTIDGKKPDDITIDVTINESISHSRTEDETRTQILSIKKVTSEDLKRSYVCHARSAKGEVAKAAKVKQKGNRCGQ”.
Claim 14 is rejected under 35 U.S.C. 103 as being unpatentable over Wang et al., hereafter “Wang” (“The Beauty and Utility of DNA Origami.” Chem. 2. 359-382. 9 March 2017; 10.1016/j.chempr.2017.02.009.) and Gietl et al., hereafter “Gietl” (“DNA origami as biocompatible surface to match single-molecule and ensemble experiments.” Nucleic Acids Res. 2012 Aug;40(14):e110. doi: 10.1093/nar/gks326. Epub 2012 Apr 20. PMID: 22523083; PMCID: PMC3413134.), as applied to claim 1 above, in view of Skeiky et al., hereafter “Skeiky” (CA2407352A1) and Betts and Russell, hereafter “Betts” (“Amino Acid Properties and Consequences of Substitutions.” In Bioinformatics for Geneticists (2003) (eds M.R. Barnes and I.C. Gray). https://doi.org/10.1002/0470867302.ch14).
Regarding claim 14, Wang teaches a nucleic acid scaffold (DNA origami) comprising a scaffold strand and hundreds of staple strands (pg. 359, “DNA origami is a process of molecular self-folding: a long single-stranded DNA (scaffold), typically M13 phage genomic DNA (∼7,000 bp), is folded into prescribed objects by hundreds of short synthetic DNA oligonucleotides, typically 20–60 bp long, which are designed to be complementary to different parts of the scaffold DNA (Figure 1A). The synthetic DNA strands crosslink spatially distant segments of a scaffold together, hence the term “staples.””).
Wang does not teach each staple strand comprising a peptide.
Gietl teaches DNA origami comprising a scaffold strand and hundreds of staple strands, while also teaching that extending staple strands with the sequence of interest allows for hybridization and self-assembly (pg. 2, “DNA origami structures are based on a ‘scaffold’ DNA strand (the single-stranded DNA genome of bacteriophage M13), which can be folded into 2D and 3D assemblies at the nanometre scale with the help of hundreds of short oligonucleotides called ‘staple strands’ (24). … staple (‘anchor strand’) strand is extended by a sequence of interest that allows hybridization with complementary sequences to form a specific and functional DNA structure. The assembly of a DNA origami including modified staple strands, oligonucleotides complementary to the anchor staple strand and additional oligonucleotides required for the functional DNA entity follows the same convenient protocol of temperature-controlled self-assembly described.”).
Wang and Gietl do not teach the scaffold comprising one or more sequences as set forth in any one of SEQ ID NOs: 19-30.
Skeiky teaches a peptide sequence comprising “GTACACCGGATGGTCACCGCG” (SEQ ID NO: 21) See the peptide represented by SEQ ID NO: 12, amino acids 12121-12141 (pg. 8, line. 10, “The invention further provides polypeptides encoded by SEQ ID NO: 12 …”).
Skeiky does not teach amino acid 10 (A) matching the amino acid (T) as described in the instant SEQ ID NO: 21.
Betts teach amino acid substitutions and teach that alanine can be substituted with other small amino acids and threonine is a small amino acid (See pgs. 300-307, “14.5.1 Alanine (Ala, A) - 14.5.1.1 Substitutions: Alanine can be substituted by other small amino acids. … 14.5.17 Threonine (Thr, T) - 14.5.17.1 Substitutions: Threonine can be substituted with other polar amino acids, particularly serine (see above). 14.5.17.2 Structure - Being a fairly indifferent amino acid, threonine can reside both within the interior of a protein or on the protein surface. Threonine is also Cβ branched (see Isoleucine). 14.5.17.3 Function: Threonines are quite common in protein functional centres.”)
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify Wang and Gietl’s teachings with Skeiky and Betts teachings because Wang and Gietl teach DNA origami and Skeiky and Betts teach the peptide as shown in SEQ ID NO: 21. Regarding the limitation “wherein each peptide specifically contacts a different region of a protein, thereby binding the multivalent nucleic acid scaffold to the protein”, the peptide of Skeiky and Betts comprises the amino acid sequence that is claimed to contact a different region of a protein and because a chemical composition and its properties are inseparable, a person of ordinary skill in the art would reasonable expect the peptide of Skeiky and Betts to also contact a different region of a protein MPEP 2112.01 (II).
Claim 15 is rejected under 35 U.S.C. 103 as being unpatentable over Wang et al., hereafter “Wang” (“The Beauty and Utility of DNA Origami.” Chem. 2. 359-382. 9 March 2017; 10.1016/j.chempr.2017.02.009.), Gietl et al., hereafter “Gietl” (“DNA origami as biocompatible surface to match single-molecule and ensemble experiments.” Nucleic Acids Res. 2012 Aug;40(14):e110. doi: 10.1093/nar/gks326. Epub 2012 Apr 20. PMID: 22523083; PMCID: PMC3413134.) and Bathe et al., hereafter “Bathe”( US 2020/0237903 A1).
Regarding claim 15, Wang teaches a nucleic acid scaffold (DNA origami) comprising a scaffold strand and hundreds of staple strands (pg. 359, “DNA origami is a process of molecular self-folding: a long single-stranded DNA (scaffold), typically M13 phage genomic DNA (∼7,000 bp), is folded into prescribed objects by hundreds of short synthetic DNA oligonucleotides, typically 20–60 bp long, which are designed to be complementary to different parts of the scaffold DNA (Figure 1A). The synthetic DNA strands crosslink spatially distant segments of a scaffold together, hence the term “staples.””).
Wang does not teach each staple strand comprising a peptide.
Gietl teaches DNA origami comprising a scaffold strand and hundreds of staple strands, while also teaching that extending staple strands with the sequence of interest allows for hybridization and self-assembly (pg. 2, “DNA origami structures are based on a ‘scaffold’ DNA strand (the single-stranded DNA genome of bacteriophage M13), which can be folded into 2D and 3D assemblies at the nanometre scale with the help of hundreds of short oligonucleotides called ‘staple strands’ (24). … staple (‘anchor strand’) strand is extended by a sequence of interest that allows hybridization with complementary sequences to form a specific and functional DNA structure. The assembly of a DNA origami including modified staple strands, oligonucleotides complementary to the anchor staple strand and additional oligonucleotides required for the functional DNA entity follows the same convenient protocol of temperature-controlled self-assembly described.”).
Wang and Gietl do not teach the composition comprising a heteromultivalent nucleic acid scaffold and a pharmaceutically acceptable carrier.
Bathe teaches an immunogenic composition comprising a nucleic acid nanostructure (DNA origami) comprising a scaffold strand and one or more staple strands and a pharmaceutically acceptable carrier (col. 8, lines. 31-36, “The terms “scaffolded origami”, “origami”, “nucleic acid nanoparticle”, “nucleic acid nanostructure”, “nanostructure”, “nucleic acid assembly” are used interchangeably. They can be one or more short single strands of nucleic acids (staple strands) (e.g., DNA) that fold a long, single strand of polynucleotide (scaffold strand) into desired shapes …”; col. 4, lines. 39-42, “Pharmaceutical compositions and immunogenic compositions including the nucleic acid nanostructure are also provided. The composition can include, for example, a pharmaceutically acceptable carrier …”).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify Wang’s teachings with Gietl’s teachings because both references teach DNA origami comprising a scaffold strand and hundreds of staple strands. Gietl teaches that extending staple strands with the sequence of interest allows for hybridization and self-assembly. The combination of references would have had a reasonable expectation of success due to both references teaching DNA origami and Gietl teaching the benefits of adding sequences to staple strands.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify Wang and Gietl’s teachings with Bathe’s teachings because all three references teach DNA origami and Bathe teaches that a composition comprising a nucleic acid nanostructure and a pharmaceutically acceptable carrier. One of ordinary skill in the art would be motivated to modify the teachings of Wang, Gietl and Bathe because creating a composition comprising a nucleic acid scaffold and a pharmaceutically acceptable carrier is a method known in the art.
Regarding the limitation “wherein each peptide specifically contacts a different region of a protein, thereby binding the multivalent nucleic acid scaffold to the protein”, a recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. If the prior art peptide is capable of performing the intended use, then it meets the claim. The scaffold as described by Wang and Gietl meets the limitations as described in the instant claim 1, thus it is interpreted as being sufficient enough to have the peptide contact a different region of a protein, thereby binding the multivalent nucleic acid scaffold to the protein as described in the instant claim.
Status of Claims
Claim 8 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph. Claims 1-15 are rejected under 35 U.S.C. 103.
No claims are allowed.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Daliyah M. Brown whose telephone number is (571)272-0136. The examiner can normally be reached Monday-Thursday 9:00 am - 4:30 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Lianko Garyu can be reached at (571) 270-7367. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/Daliyah M. Brown/Examiner, Art Unit 1654
/LIANKO G GARYU/Supervisory Patent Examiner, Art Unit 1654
Prosecution Insights